Blogok, cikkek

RE: net

mailto:info@firstmedcenters.com”>info@firstmed=
centers.com
. The contents of this e-mail must =
not be disclosed or copied without the sender’s consent

 

 

——=_NextPart_001_00C8_01DAB7E1.EE50FAA0–

——=_NextPart_000_00C7_01DAB7E1.EE50D390
Content-Type: image/png;
name=”image001.png”
Content-Transfer-Encoding: base64
Content-ID:

iVBORw0KGgoAAAANSUhEUgAAANUAAABFCAYAAADdJqPAAAAAAXNSR0IArs4c6QAAAARnQU1BAACx
jwv8YQUAAAAJcEhZcwAAFxEAABcRAcom8z8AAG4hSURBVHhe1b2He1VHtvbJ/zAzz3zzfN9NndzO
Obvtjtft7nbOqZ1zwMY5YxvjCE6AsQkGk0QQOWeByBmECAIJCeWcjo6O0jvvr44Kn9bFbrvvvfPM
V2Kx965dtWrVqvXWWrXPDv3UJUXq6U5Td8+31KkeU7epKxB/PT722W+p25U7TR2uAKVMSeenXLu7
XSkl1aJWNarZ/7eqw8c9/l/dLtNpFqkMgo2pxfkNZlPnrPpA3aYONajNfFrU5L2Eqs2pytXq1NPT
lpajy5UyqbMP9T2f0dmengwKvaTvSJreutSPSt3uXyqVUleX5epN8O7s7FRHR0egzHMkzlPvx9Df
yP3/E6JvbW1tam1tVTKZDH3OTMhNHkR5Ul8ef4/66uGH0PH4/FfT94Iq2GQwKECVBtbxQWXqMh0D
lffbTSmX7Uqp3UAATM0GQ8J/gKy75ztA5eMIqiazanBWmroNpg6DKRn4ANGkal2lxlXq3ZnvAFXo
RC8d79zfARW9jeRSPyrBB9DEwWTLMYYU8yNFoJH/N3L8b0qZfWJiYUteTLEM1LfuD6VY/8fQ8fj8
V9O3oHJ/I6ic3wdUkb4DVFQIhU0dPgZUkNHR09mhdht8m8GUNLX7/1RPu43H8z9AjKBq7yXLAqha
nd/i0y1m2eLsFrfT6sJtLpz0/+3O6TCwOnsMt56m4BEDqKLgP5S+A1QAqi/9ZxIDGmfmvt6J4/b2
9jCr9z33Q1Km3D+E+hraD6Hj8fk+ykz0KQLreP2j/D/SRl8Zfwgdj89/NfU7BqRMyrS1DKNKw8kV
UUSgDGbUQ1+AxE4oUKc7YiNKdSQNFHsnZ3b3pBwpdqizwzANHsRttDtcSLiKnQ08XE1trp/0uaSP
ky5GRNnpdrp77DPNo7vHIWRXa5o6XdE8rbUMwX88ZSoms9+R/rMpk3/fxIBjcPFcZtn/aupraD+E
jsfn+4g69AcCTEwahIOEgt/ltfry+N+V/iOoPKbQMVv7D8bl873EfrcLHyvrDJwFwAhOw56g02ut
lBXa1YE7MgcUbUB1Ojw0PtTjcLG9pUMtDSk1N3kmMyMcWNIYaTd5WRY8FxNcAC2NBA/ngxQFeonj
IEAU5sdTX+X8bb+d578fkzCUzFAvM5HXN+QjhXZd9sdQpsw/lI7H5/voeDy+jyKIYv/Z4q0AFRTX
mser+99BUbf/X9C3oHK7mXQcm/vWwHqPiZ6CY/K2L8UIMOVCSaOjw0DCJrvtnbp8Au+EN+uyK2qs
aVZlWa2qquqNDRugeQIqPFUAlamL6qbgAWO4aAelNvPhoghez0Idr5OZ9G1nflj5f5RIAOZ4C3XO
x3Cvubn5mPGRMGCM7YfSP2Lw/whlAuyHUEtLi5qaHJa7bmain/QXAliUjalvm3+P/pHUV86/R8dr
9+9Rvz42dox87rgUz+M0MAPCsrgcSpqCnUPOj9tmu5o2x3TUASCdBoUjuACQjuaUyovKVJB/SEWH
i61ohwY+lXAjgVwfzLS7MnbXnQmoVhMLLoeO8GJyOAb84xAdjh3pq4j/DmJQMCK2fROAAFiJhNea
GaCjbF/gfB/9IwP/YxN1aOfHEBMK1DfBK55D/kx5onz/HRT5H0/W76O+fH4I9YvrdSgCBvK57yTO
YwLBI5kimLDtaOeRmk0NrtBsohzeJ+g6MPBxbYsKduRp29oNytu2U+2JNpu/edktNbtQs6HY7EZb
TG0GFnW5JhEajI1EULki677vogAuF4p0PIX8V1JM7AMaZuZMkLHFuDLzKPuPDuYPpR+bqINMP4Zi
AjiZ66l4wSKzDKmvjP9d1FfOH0LH4/N91C/z6l4EFORz35L7nxkmcp6LCeFCn/cBSwQUIGoyNZq4
FM7vTLW9+9h/q8O09hCq+cCVE6XV2rF8pVZmz9TGZcvU1kgNe7YeLp23qd5uqc6IqXNeowVoMxjx
dMcahQCY85Etsz/fR8dAlkHHU1CmUo53/vsoJrxRTU2NysvLVVdXF4wr8/x/NvVt97+DMr3jDyES
BtnQ0KDi4mIdPHhQRUVFqq6uDgDjXEzsU+d47X4fRaP/MdRXzr9H1Dle299HBpVDlF4KxtVrQz6X
JoCUQW4j/ZOUKayZXCbTS0VAQcCj2lRpqjIFcHlx1EaoA5P2TrUcPqL1WdM0b8RwrZ46WYmaUpdK
GkpN/mtWjaFY4RbKnVdpcNVbiNZej5V2fSY8l/OQG8DwY+3fowisTC/WVznHlNFLPaZut993oI5H
JMBTVVWlQ4cOKS8vT7t27dLhw4dVW1sbZu/YDoMXQ6JYN1OO/2rqK+sPob7G9vcIj1RfX6+CggJt
27ZNGzdu1J49e1RaWnrsp4MoC/ts+8r59+gfkevH0j8il0GVvlMCsvqOAcvn0uQxziS3kb74Zoqe
inVTdBp4KgAFuLgTAlBV9FKVedd3eR3RaSR0GhVtSTXl79PqL0Yq++2BWvbV52otK3DJJnX21Bqk
df6rN6AaVWrOZW6hypDg7ooEcgCsXgpXHC3HDwUVlOm1XPXbRMd7gZRJPe48So4UlXi8PBIL9f37
92v79u3aunWrduzYEQCG1wJUDFoMCzmOeZn8vo9i2cwU2/8+inV/KGW2Gel45aB4ngsVAIiJZMOG
DQFUBw4cCJ4qriFj36mHXDH1lfe7iHYinx9KmTIeT+6+RDt9U185+lIfUFnQSL221BdUmcAKoLIx
c/MEvyUlzTBhanWhVls56yEAALCgOrfS0pmwIu3TOgyslmY17dyplUM+1IznBmjpkMFqKcozMurU
k6owUCrV3lNlSFX7r9aAarTnagt8Gi0jYEaGDLsPIMmkbwHEuTRlAgsyi/+YMpm6T2z5sRrqq2z2
yeubCPsKCwsDkEpKSo55qJioE9cZsT7bzMH+LsJAqMe2b8oc4ONRbIO6mR7yu4g6mSmTR6S+5fBG
hLt4KsBE/9FHTLTNMeX+kT7EMlGOzL58F1Ems26m7D82RTmOR/3M9thfAFMktx3I7bndQPz21OGY
rz0J4tNlAri8RuqwdXc6o9NMOwyqDi98Eu2takw2q9HeqcX8PQ/bu7SoJ2k/5nNqqFXDhlwtevVF
ZT1wl5a/+ZKSB3eYoQPFpH1be5l6OsuVMqTaemrU3Fmj2vYaezuD0XBotZwt3Z3Ot3G53S5TCuU6
xOy04KjKIlseg70jpZZU0mu6lL1rGmQAqt3gr29pUlHxERU65scQEi2t7muvkaccGKdcstP6MXWZ
GCCMAZDEcIbU2GiP6mNAxPph37592rx5c/BSOz15EP5gZKwxIMKjaBCAi/UHxkcZ1iDwgTBKPB5b
zgFU2mFtgmGyj9zUR7Y4uJlGwzGJY0JS2sdrcEkfj4q8tAXvOBHQXn5+fiDaPXLkiCoqKoLcmetC
+DNZ0H5lZWXoA/Lv3r07eOctW7aEEDDyoG3kRV/0nfp4tigTk0XsQwRN7EM8ph79gF9cp3IOigBj
G3UAISNlqceWPBJb+hXHDdnpMzpnn5CdPtE3+hjli7JAUV72+znbxhfJBfuACtvid9VwKdyUbOtU
a0u7urn0h05dqAuQcQtE+EHJhUPBhNob69VSX6Vkq31Lh4HU0azu2jJ115R5KnNwWFep+jUrNO+p
RzThpiu18MkH1JCzUCreq+7iPPUU7/aCbL/LHjXAKtSV8EDUH1FTolKt3dz/57i9K6Hq9qYAji53
EsXFGTx01CJ2OL+pLaG6RLPqk61q8zFRI3VaO9pVcKRQ8xbM15y5c7RmzRoVHS5Ua3NL6FtnW7s6
E0l1tdubuH/8cM0AMjCsk1atWqWjR48GZTIAq1ev1pw5c7RkyRItW7ZMixcvDtulS5dqwYIF4Xj5
8uWhHsZLvRgqYYS5ubnhfKy3YsUKLVq0KBB58OH8unXrggEy0NRZu3ZtAC2DDk8ShoUu4jH6YALA
wGl/7969wbiRn7bmz59/TLaVK1eG9ubOnRv6Q/vkEcYhJ/XQNTzZog+MkEkEHVCWLXJF3sgOcUy5
qDfkBFC0R6gMyCOIOAfFPsTyjAETFbwAP3Viom6sA4+Y0DPhaFzfMSlRBj2iz4ULF4a+s509e3bo
N3IzluQTxlKPyTTyj/KRIqD7dXumD8TtP+EvbYhxloe4WMcaCoDhobqIuYJVunTCqG21clsdzrXa
vTd5VUUHbcBKtbmMqa7aADmk5rztKs9ZpprNa73AKvYCrFpN29dr1UtPa+yffquvfn+x1vZ/UAff
fUMVw4aoZfxIdS+eJeVvlWqOmH+luptK1dF0VG2JMjX31DkM9Ezbk/A6LRG8I+uecEEBxbqDKa/d
UvZcKbvZlPOS3ra4XEunvac9V5291LbdOzVq7BiNNk2fMUMrbFgF+w8o4b50czuHO9/DhGG+caAx
Kgxj5syZYaAwKox71qxZmmEeDALnMRIGny3HzNwYJYYNCJkB8WQRPNEQMUr4YQAM5qZNm8I+oKcc
g045vADlogFgYNFzAqj4IysJuTFewD116tTAD+8BuKZNm6YpU6YEw8bAkAkZIfYpS5+oS5/ZxxNj
kHgLZERmDBCjzMnJCfViX6nP8fr16wMQ4IP81MVI0QV6I4+JIk6KyB4NmBQNFyDDMzs7O+iUdWoE
EGXi5JoJLLwTbdBP5EcXjA26oP/IzjhFmdE1emefyYCxZZJhMo1RBm1E/WaAingaAliA6m8BFUDV
S+SHhIxcoUi44y0GTQCUt80ezEYDysKrwh6puEgte3arcv5C7R81Rhs+/FA5g9/Wvolfq6dgj1Rb
ouatawyq/vrqD5fo4zNO1LTfXKJVf/mTtt94ow7efbdKnh6givffV/X4r9W0dIG6d22USvcZxCX2
U1Wy/7HXarASm9SV8noF2UysfVKezZI2qnZ3Gtk5RT+aDPbG9oSaDfiqhjqt37JJn38xQl9/M16z
58zW7JmztHbVahUVHLKH7R1MeypARWKQmWUx5kmTJgWDImzAWBhkjBvF431iaFZWVnYshMAACDfI
I+SgHqAAWBg4hoaxw5N2IMqyBTQYPYMLuGgb46bNiRMnBsOmnTCpWE4GGWLgkQWZAcW8efOCjBgW
W+pOnjw5gIE2KEubyAtxTD7tYVyAAoNDVowQfrQNyDlGfuSlLv2nPn2mTxgp5SHKc57yEyZMCIaN
TICCPiA38rNPYosxcx5Zv/nmmyATvDPLcB5CBzEfINB3QIWuiRQAzueffx4mEzwtcgJyJgtkhS/y
MRkwtuiI9shDLvj/R1B1uVHuGDeoegCV7SYTSJlEfhCP/9qdk7AROzSSQ6SwDaCyh/JgaMtm1XpW
2PXBh1p07yP6+g9X6rMLL9O4K6/RxnfeVs+ODVKhw5UVs7Xgqfv0xe8u0idnnKSJ556tOWedqyWn
nK1Vp56n1SefpxWnnKecS36vXXffp/rhn6lj/XKp2mFhR7G9UIlaU6XqTjZaJneuV9Aee9MOA73d
xL2H4cden2Lt1ZxsU7OBlbDHqqirUe7mjRo5epQWLF6kTfYmC20wcw2sNStXOQx0n1yREDDcVe+E
Ehl4BgRDQOEYF6ETxs1sywAyQ+Ip4qxJyBJnXBL5GB6zIMYEOOJiPs6umYm8ePEDcODVACGeCS/I
gANyZnDazzSyCKisrKxgQACJUJGwCbDQD2ZxwpsYfkUPkekBMDjABIAAN5MCx8z0eAzWSSTqYGBx
P8oCT7w6gGAigQ+yYcBjx44NkwVrmBiaHU8GjtElwBg1alTQNxNAbIOy0dhjfRLrR2RG32wBDLKP
GTMmtEnKHKPIj35wHn0TIaBfZIZ3BBaJ8gFUPJoRbqxzRui8ZYclxSAwGInjYFeEfwAKDxUB1WJj
qPM6qeCwuleu1pERI7Ts4Uc0/g9/VNalV2jUqRdq6E9P0/Q/X629Qz5ST/4Oac8mFU/6UmNuu1Lv
X3i6hhpUE84+R3NOO0fLTjhTm048X5t/fq5y/ukULfnnk7XszAu18ZZbtev1F1QwcbjKN8xSa8W2
cJVQnV4DEaIFYd2Jdg9EyutEy8oFBu6Kp/Pt7m+SkNATSLtDwbIah20G1aSpWdqVt0c1dbXBOObO
mq0ZWVNVkL9fbU3mTQho4kIFigdUDCZGSnmMLYY2DFTmla6Y4iDFBB+MMno3DAugkRicTEOKiQFn
9idsYcYHzJTDUDEUwBFDomgcrCWQjTAH4FEXA+M8WwD29ddfB4PGy8WZ93gJY4c38k6fPv0YOEaO
HBnC4OPVjcYWE32EB94Ob0XoB7CRgTz0EPlQN+qBhMzwQneEcNShb+gkJsrHctHwSUwiAAP90A5A
oS5gpk3qoY9MWWOiPbwT3oyyjDcyUjbqObbbL1yFgMJ9SpxIg4ouGSqBwo+7PpE04jowLrwU4R4E
qABURZU6d+5W8/RsFQ4arBV33a3xl1yq4b88VdPO+bW+OekCDfvp6Vp0/a0qGvmFw7+96t66Vvu+
HKpPrvt3vXXxmRpy/pkae955mn76eVr8y7O14cQLtPXn52v9v5yu1f98qpb94kwtPv9izfn332ru
X6/V2vcG6OiKSWmvlTCgua29zZ2AuM6PbrBH960zmVK7FZN0iNhhMDFMrBVLKsq1ZuN6TZuZ7fng
UFiD4T1W2utkTZiotctX6mih13Pud7j6Z3CiTEDFzM8MjbdgMABTXNAzC8ZBRdFsMcjouTAWjB2D
ApgYKXU4F8tHMGWCihQvbCAn64TYDoAAGHgr1jUYGl6H0ArDB1B4U9qJCc/COgLDQnZC0+9qlxQB
QRg1fvz4wI9wEI8BMEgYF3Vj/dj3TGOl30xAeEdAjoeEHx6bfsSy8IJiimDByJnU6CtemnAtM9E2
ZWN5eAAE+KNvwMyExDqPdpmgYqiHrJSnDSbHONHBk3FGp+TDF/6ZeqJev2O3lWNhPof8dAcwsdzl
IUHuvWt2xVYzYX3SleTCRC+oCI9qatW1zYvFr8Zo3YOPKOuy32r8GWdrimnO+b/SwksuV9ZZl2n0
aRdqxZ33qcQDqMP7lNq2Tnljhmn4PTfqg6v+oM+u+ING/voyfXPexco+9XwtOOFcLf/ZOVr783O0
7YxfafsFv1XOBb/SpJNP1LCT/k3jr7hAmwY+oZZlM9RTdMhTkWVpAlgWOngsU3C3Vq7B32G5w+xi
z+wSIRQsPFqiFWtzgqfavnOHGpoaVd9Qrz27dmvRvPma40li20Z7nibP7Dxi4okFJcZwitmfmR5F
Ew4SrzPQAIwZjUHCUPEkGAuhG4AkPIOYLZnxCUkw8EwwfVfiPOUYQLbxih/GwHqGWRieyIPhARaO
CZeQOxoJCUNjXcOMT1iIccIfAryZQCBhTPSNMCh6RGZ7QBu9BXUoB0UZCVGRD77kYdB4DSYl+AFs
vCwgJZSL7VI+03DjMeNIGAYoAQT6jWVIsR0o7lOGyYYJAb0gE2PEGDIx4HW5lM64AB6iCEJyyiA7
baIT9ukTKYI2MxlU/j8Cyy7KUVHYxS6bTY0WpsFC1btio2f5BAxbraw2w46rfZVValqzVgWfD9ea
ex/QjEt/o/EnnqopPztRc085UwvOulATTjpHw39xhkacfZFWPvCoSj1j9pQ4hj20V5XL5mvFx+9q
yTtvaM2gN7Xu1Ve09pEntPL627Xi91dr0dmXaZbDxnk/cQh4whlaeeZ5WnTmmZp11imaedFpmvvn
y7T6yQd0NHum2vcaWBVNlsudwG4SXuA2J02eeexdQ/iG8bUnj10RLCq1V8pdo4lZU7RmXa7KDAKM
rsGK3bt7j+bM8KI+e5a2b96iRsLb3oQBsWAFRBgygMBImPWYtQlNGHTAwj6DyKCxT5hGGIFh4eUw
JjwMgx49FQPFPnwBI+CD8E6RAASDH2dW6pGHoTMTc/EBeTBc2sZImH0zEwZE+SgDRgXoAT8GxezN
pEDbeCLKAlL4A1LK008MlTrIjfFlggoiPxofx3FNGkFB6IgMeC+AH8uyxYDZxj5G/QBG6seLHbQL
gCLwKJ+Z0C+TAZ4KfaAL+s8+oOIcY4g88GRyildDmTgZK8aa8QBcJOSAD23TJulvQeV+RFDxyAXv
iKi3YHUWss5hUb1B1ZpoVQcMQapnyHa77t0ff6J5t92hCRf9SpNPO0uzTzxNS084VStOOlMLTztX
Y04+UyMctk28/kZtfXuQapcsdg/LPU1WqMNhYNnqZSo31a9drcaVDk+mTdfBTz7X3oGDtOnBx7To
D3/W1FPPVtbPT9TCU89Q7kUXaeuvL9X6C8/WjJN+rlFnnKbVL7yqI7OWKJFXpO46Gw4xa6MNtKZJ
nXXN6U45cbmdPiQMrHYDq6SiTGs2rA+eamXOapXYc3FRg9RgEK1aulxTxk/Q9ClZOnywIIR/JIx3
85b0xYGdu3YGb8HgYMiEUgwEg84MjgESdhAWQng4BgkjZIvhY5QYEwOEUTBIAIYBBLwYcAQqBH8G
n/PRcBlU6gJ4zrPO4coWhke4hZHHgSdRB7kxFAw6Ght1mQQwMEIzzrOPgWFohKoAYvee3QFo7FOX
vkTvxoQQ+xJTNHJAQt/hiWwACoPlSh56YsKInoAtumAbwRIJPeBl0DN1aC+eQ4bMtkl4YcDDGOER
8VSUY3KDF2ND/yHOAzL6CtDRPZMJ40m4GUNo2mJSg1eUuZ94WJCFfR9QYZPcx8dNsXVWRr1n9Yau
lGf5hLptlOrxgr34iA5Pmawpd96pT84+R1+ffqaWOHTbeuFl2nHqOVpvYC078xwtvflG5b76ovaN
+0rNa1dKRQeNWM/6iSb1NDp0rDhq46+0R6lXt/O7qsrUUXhQHYf2K7V5vZonf6PtA57U3Mt/r+ln
nK4VZ52tXRderAPnnqfVP/m5xv/Pf9O4K67Tgjc+1P75OUoUVpm/O1PncKO6Sd21fwsqlMCgc+dF
RXWVNhgcU6ZP04bNm8KFijgYHe0pHczLD55q9MgvtTZnjSqtTM4TIm7fvk2T7akwPDwKxs9AzJkz
O6xjMFjWPAwAhk4Z8qiL8UEYA6EZA5b5Kz9tACqML2dNTjBoDA4DBmAAlbYIm0gYLMZHAjz7beyE
oePGjQvlmQRIGB6GRDvsY2hxTcVVMLwVRoRRxYkAIwMA5GFc9JcJAHnxuJTP6g2DaZsUZ3AMLYIp
gg09ACL44+lpf4/rImsEFWVJmaBCZracgwA/fUTvyEM52uKnoVgOPcb20cG8+fNCnSWOINAvifOU
ZzzQByAj5GPc8O7IB3ABGMBnrJhM+E2U1OV2sKkoc8aairMezN7DCCoe2aj3CqTRBVq80kp1+0zS
nqqhRpWrlmv5Sy9q2KWX6pMTTtTMcy7QynMv1rozzlfuz07RlnMu1N5bb9ORz4aqZuUiJfhtqrLY
DG30DR7k5kYv2hyu2dDUap72HkoasNwbyNW8lM83eUY4slcNi7K1953XtPyav2jJuecq96TTdOCk
M5T3i9O17Gdn6OOTztPwG+7RmuETVL853+0go9d+DUmTw5CEB5crgV1pBXIbE3daVNRUae3G9Ro3
8Rtt3r41eDF+WiB1ouiGRu3atl3ZU6dp1oxsbd2yNRhOCJu27wizHnm1tXXa6MFdMH+Bli5ZpiqH
xTG1uXzCM1lM3ALFw5itLa1hAKfYCy5auCisy3j9AMCHMBIMt8AeEuM9fMjhnz0Ti3raIKxbvWq1
mr3ea+9dL5LoX1lpmYG4RHNmz9G63HWqs3zw5CoohhZAZUOoqa6xp9gd+pFlOdY6lN+/L32Fi4kB
oOQbAMiJgRU6DKSvtJH0EgAdIPsCG9xBy0mfOty3CAB0hWz0i3yo1csGeK9auUrTHZXgCffl77PH
/kbLljpqKeM3oN7Jxbrit0KOA0/XR3f8TIKsEyemL1QQ2kXwxH6GcQ7ASufXO/JA1myP4xpPFE3W
W8oTZy0/HPeWoXxzc0vQKVd68UAAjUmRyGDmrJnhzputBhpLIWphLdxoAPHkej+The0ll6ArODFA
1RLAxE2xKYOLl4txZKNrq1Ni23rtHPq+vvnznzTytDM12eunnF/9Llz2nnfC6VrscC3vltvVPGyY
tH2TwcHVGQ86L2lpMVjsEWSDDb9r1RpUtd6v7/3h2B7MKDDIvM99gN3eNhQptWGJDr7zunKu/IuW
et22419PVuFJBu45f9Cwfz1d71/w78p++nUVT1+knn0lruP2WF81O3RodijY5sHudJhkSYIiPAhl
NRVeU63SiFFfaMv2zVYMizEG0LNjKr3+aKyvC2uqrMlTNH/uPJWVlKr8aLm2bd6mCTaELRu3qLqy
Rrke5IXzFihnpQeswX0gWafcSxhue0qPW2i8vc06db8P5O/XhHETNX/OfB9b087v4tVuXv/FEcNj
xt/ISHXVtdq4bqOyp2dr2eKlqiyrUqI5oU4bG3W4SkmZDbkbtHzJcpddr8ryqmCcUQaMCL7IsC9v
v7KnzdCShYtVeKjIfNIzLinIzk8KTj02kC7O9fKgPjpYvGCxVixb7vD4sJobvMZjzW15KU9dZEsl
beCuS79SHoeiQ4XKzVmree73gX0HdMiAnDxhilYuW6mK0vJjYTZtOShyPXsg96vTa+OOpNdtBmpu
Tq7rTLb+N6um6turf8yJ/JTS2e42TeGWOif0u2DuQut6nuXeah3VWY6iEIHUVqU9OYk7hjq5U7y3
nzGV2XMtW7lCM+fN8US8QXXNTeEuHUYGm0o68mmxY+gHK5bfeCVMiLkOYp/XgtUbRFU9taruLFVT
u9crqlZnU5F2jPxAM67+o0b97OdabM+06cLfa915v9Hck8/XnAt+ox2P91eNXaV270yDyAk1AVju
0Uv/pmRReOqw3kCr8UxeayDZ+B0jBPB1tzsc7PAsohrXstLqDym1aaVKP3pf26++QWv+9TRt/ecz
tPcMg/nCK/T1BZfrs8v+rDUvvaPaRWvUU2WezW6DK4JJd94Dw0VO+ocs7QZVaV2llq1dro8//0gb
Nq1Riht+eVNTt0HYSagEtRsk9VpuA541NVvrV63V7k07tXHVek0dP1n7d+arra5VKxcu04IZc7V1
7Wa1NTMtObm9AOaEW80cJO+3eK13YFe+sidO18Ls+So5WKQOypFCBOEto5VRr9v6Ki88qg0r17ve
NOUsXaUUt4q1eyKgLh1z+YR5r1ywXPOmzdHGnHVqrPHEBR94Uga+qL8xoUN7DmraN1O0atFy1Zc5
/LVXD+c9TIFvq+VvsadPGShWYEeTI4B269PGV3a4VLnL1mjmZHsc66Sp2mMd8c+Wh+5oM/bBS42m
ygZtW7dZS+Ys0vJ5y1SYX6Aj+w9b1rnKWbLKeihUN++oy0yBl5mk57yQtpjH5DETtXrxCpUcKApj
fCzFtnkdF1fd/K+hotbjlaW502Zrz5YdKth9QMvnL9WY4V/p4K79LutC8EbWSBmpoLREMxw+Tra3
WuMlAxfu6Boj5mlEjR0p1bS1ql+ZM1hy1ZhBEzOLZ5KEZ5lWu64mG1Z9T4Nqeyq8pipWouOQO3VY
HQW5ynnhIU05/wzN+JefaOc5l2r/RX/UKnuN2aderGXX3q6Kr8epK2+3LadJrXaTVYk2lbYkVGMw
paPu3oSS6vxflWFc422zZ7MWLzgNxM5Ug/Vir2hAJcT9YJa0oVgdXpdVvPuhtv/2Gq392QVa9dPz
tfz8f9eEc36tD04+V9NuuVf5X4xHCy5vnq2e+a0wvDHNNXtGabXWDVuV1Vdq5boV+nz4UG3elGPv
1OhwwWDs4fJvUu0d3AvPlacu5e/O04qFSw2AuVo8c4HmTp2lSaPH2SgPBKNbbaOcmzVTOYttGIeO
qKW+Wa31LaotrVRVcZnqK+tUba9SXVYZ8hOmyqJSrV64QotmztfmnPUqLSxRkwFQV1plA69Row2w
ua4pUF1lrY4WFClv807lLs0xgOcE4wQkPQZbqsmaxRZNDeU1WmSgArz1K9eYp43dY9xjIwMQGCjh
cIvXm/u357sf423gS1RbYq9X6zC01ZqCF+AxyAKoDHRAlaxPGMB4HRtSZb22rtmkqeMmBXAV7Tus
Os/6rQ3uX6O9nHk1OwppdPsNNfWO/st1YOe+oKulBtXmnI2qKakMepg7dXbQw66N21RVVG6ANoQ6
9VV1qi2vVu3RCjUY9K21LWq3jeRt2x36uHzeYm1bu0nF+4tUY/02ub2gX/RWhS5rVF1coXyXnzrO
3tBAKtpnIO8r1Arvf/XpCNffbP7Vqrfe0H+z5UZnjY6e6hyWlztaWbNli0Z7PTZ59ixt2L1Lzd1d
AUzYEw6oqbtTDQZWvyoruso6rjbk6o30Jg9Os111U3ubkddsoNWptafKxljh6jbSqh1qXzxBOffd
qPnnnaUNp56lQ+f9Vnln/lrz//UMLb7oCu0a8JoNf51HlpsOO3XUrnmH3ez6/Ye0u6RcpY5XuVPc
MhnibrzWAwig6ixEY0qd7kiyrlqpziYL2+SWq1XWXmzsldiDOBSsPaouu+yyFwc55LxaE/7XqZp0
0rkabY/5yVkXaMS//8VrvYHqWL/VZZvCS2bwAO32jPyIXeOwjoclW32ioqFS67es1bjxX2rXjvUB
yF1ut9vhZ5eBxRrSKwE7DivMoWm+1x8LZs3RhDHjNGr4l/r6y1E6mG9QeUbf5D7PnpatmVkztGbF
Ku3ZtlMFew9o24bN2rgmVzs2bdPaFauVs2yF9u3a64FzW23t2rvDaySHUHNnzFSuQ8ftG7dq6/qN
Ybt7606X3aO87bvMZ4vWLF+lVQ7pcrxdt2qNDjl0wthTrW02YscbVmeHeZYWHtHC2fODPBscZjU6
1MFN0163x7fbIRS3XtU7bKWNiWPHafHcBSo5fETVDr9a4eXx6Up6PPiBv3cG7/ak29bUqk7zILxr
8Vjt3rrDHny6li1Y4rbWBdkP7MlX0YHD4UJP/s49oY3tDtPWr16jlYuXu+wiy5/j8/vV0Yoc1Zo+
KUtTHc4tdxi6OXejdjq03On16pZ1m6y/9UG/6HC/eZc4fDy876DPb9fKJUu1yGHkknmLQl+RB76H
9x/0dp/5bNfqpcs1f+Zs01ztcp2Gqpog+17LNtthNLqE17YNm0J9xiQP2r1XO3fvUe6mTZrOnSNj
x2rOkiXKO3zI9tMdvFNtW0It3ic2IcLrR4jMjQiE4x2evTrbTXabKS/y2rtsUD3pRw1DCGZwdeXn
qnL4e5r7h18p++c/14YTz9SuUy7ShhMc9v30LOXd/ojaxk2Xio6aqa2ZRbnj4IKCQi1YtFSTp8/U
LCt0y85dOup1SbLJovTOrumrIxbLBtLVkbQ3Tjr0bNS+VKmpWEe7yg1uD3Zns7oLD6p4zHitvP8J
jbv0cn110a/0xa8u1ue/uVSvXXiBPr39du3xQr61xHJ4/dDSbK/heJdOtxpYLd2eOBzq1TZVaU/e
Vs2Zk6WC/dvdboPBV+++e/HveSj9x17KkUTScfVR5a7jHrBsTZ06WXPnzlRh0SG1JRPasXOrFi9e
4HMztWLlUuWsWakVK5Zp4SIuqS/Uutw1mj9/jqbPyAr5R4oPW0UJHTlSqA0bcn1uthYs4EbZ+Vq0
eJ6WLl3kcku1chWPTCzyeR7DyPa5+Vq/Plf5+/ao2mvCcM8mLyh1qOqVhyPrZMjftHmD1pvv/gPc
H0iAzw+hBgP3eXJXifdbHEkcPlwQeG7avN5L2mo1NNR4Ed4c+FKW9SUvQGU12un9+vpaJRKss7hw
kLT8h7XGfc11/3Jzc7R8xRL3f5lWr14ZdLB69QotX87d63M1b577uHBeKL9793bbwBHzalJZeYmy
s6cHnc5fMDv0d9myxVq8ZIHmWWdz585yPjcdLw262rVrm+XmWacC93Ft0PucObPMe27QNe2tWr1c
q3Noe6lmW2+zZk0PMlEv0dbkcW4L7efmrg75jAntUX/ZsiVa6eP0fZkeS0/iq1dzFTRHefn5qqqr
Dbe5JTpskck2tdl5NDscbCD8U6OntmZTq6ehCDVTjxe1PZ7N7eeNNsfj7V7TtFYqsXaJDr36nGac
e7am/8tPtf4kLp2fo5UnnKvF5/xGFW9+JG1y2OcFazdvRuI3Lbxh8VEtmTVbwz75VB8O+Uhjvxmv
xRZ4z569qqmp9eLWIR/rK1745zjNVSxOl8q7W7QnVaG8rkod6ak3pBIGus28rkKVa9cqz8DKGThI
S58fYHpSS1/sr6/uukXj+z+qPdnT1FJSbFB1eVlXb0Xy4mjw65ndBpUwqFrbGlRWUqAdG1epqvSg
++zFp/ub6gZUvK46/bLqNpOXyGp2+cLiA9plIG7bsVF79m5TTV2ZkqlmlZQeCsdbtq3Xrj1btGOX
PdSmtcpdv0qbthoE+3dpy/b1ysldrnUbVqv4aIGXla2qb6pWkWXY6Tqbt67z2i5H6zeuDtuNm9dq
kz3p+o05gc96y7l95yYdKtyn6voytbUTrgImInvIoZono9Zkg4rN80jxwSBfRydXH+m510PHyqZC
fk1duWfjTTp8ZL8nWIdNrtvu/sRy1Om0x+aYbX1jVdAbbZHX2FIbdHK4aL/2HditzdvWBVnXmbZ4
f+v2DaFf6zYg/+qgt4OH8lReVayGphr3oUnVtaXuZ244T51troMeN242UM1nrUN0+k5+Xr7XQ4X5
qqwpVa0jDeTeHfTudlx3vfWW43UyddDh1l4+nDt4KD/U6eh2JOJ+NbXWWvcHPV72iJZx87bctP49
Phu9xl631uOwZq322U55zo6LVI31DeHKaYe9FMStbfw8w2+fjZ5s+qnEiiuzIVfb3BoMLn7x5SXm
PHQYL3E31zo8c+hXVqRGIz7vicc067zzNeuXp2rd2RdrxcnnaPlZl2jjtXeoZvIsL9IcajhE6Kiu
VnupPYVDiJZqhxnrcjV+1EgNfOs1vfD6C3rrg3c0ctxoLVy6RHvsYusqqxyquV17EmYBMM6j80UO
Agtt2kdt4DVWRL0Hvrm5Tl0OK3sOF6trT566tm9U9/a16tq6WlVzp5imqWv3Ni6VmWdSqQZz4vc1
8+32cTeP8/OSi24bSovXbUcPq9NeyyvkNDn0w5g8Fwcwse12+3wIocegDuFhV4s62hvMq8m8WrzG
aLaXb1Sqrc5qq1EyURv2Wxq9hmrmNhrWZx4Ml6mvKVFrC1esmMV6efp8t3l0JOvV2lSpJoOm0dTi
/TaXbTc/znW5PcrDizqdyOD207NimnqcH2QwISPHXFFFRmSN8rJFxqryw2pqYHXdFvoAz1gu6CPw
5cdc+FoOfu4IsgPotPyhb5atqaFctVVHVFtdHPqB3LQR+uAt+kKeWAfe8E211af7x7rWZegnslOf
uqEvPo+OYt2wNQXd9fJss3zVFYWqKC0Ieg513I9QJqPNzD4xFgnGyG3SXktjhZo82TRVORS2HXe1
uZ9egxJqc5mcp8FTLW7XEV3wGvwjYvDau58qDaAaE9+tYVzQExNUmNKdx1W6Fiu/plI6WqKqiRO0
9rbbNefiS7Xg/Iu19te/19yzL9DCy/6gXU88o8blawxCe7cmd6LBawaHCnLM2cNTt+VF9k6zNfiT
QbrvmYd0//OPacCgV/Tu8I+9APxG8xYu1LZtO1RUVKLaRh6YZy70MsvENcBKC1Vhl90ASOiMOykv
iO0i5CBe2mcQHdxu2il59pJDII+w5XcZbqniaqOrBG/IpMExl6qT7rQXoh4NH7vz7Sz4nRdeiUsF
E/u88B3PfUwyl7GnUcqg8vrzW8XBw+2Sz364g57znLNO2XIOozZw0/XYQr28Dd5Qh3K0EQaGc/Do
bSO2TznKhzyIcr3nj1Ev/1Cub74Ni3Y8ex9rO+x/ez78xBH37clkDxna/ptyvXLZMAMdk5tzvXXD
trePxyjKHWWPfYTieerF87FM3I/nWPgxXlydNDCjjH9zjvKWw0A61gfy2A8TRW8fKONwP0y8YAD7
4cmM3svzgVWLQc3PB9iPy/TYa3XZPvupzoXqTQ1d6mow+uqTaqsxcisb1VJeo+aSCjUfOKSWHTuV
WL9Be977UNl//JOmXnKZsi+5VLMv+7XGnHW2si6/QnveGqTmzVvcuAeF36D4wRNv5/g8KN8h1fb8
jRo+eYTuffFh3f7sg7r31f56/O2X9OygN/Tm+x/oy9HjvK5Ypt279jksrLfc9kxeUNdZaKjWvNv4
vYVOua8dZV5wegFf73i5PmusmudMVmpzjjodhrTtz1PLzh1qtuxth4rUfrRK7WWOhY949jxcrlSh
w6ISQ7WkXJ32eJ0lPvYiPeVFfntxidrLK5T0AjpQheuUFrt+kdoqi9VWVqi2o4ecV2i+h709rGS1
fWmNQ7KqEiWPHFDS4VeyulRJl0m6LPltLtNW6fOunyx3O1VHA7V5wmktLlCi4kgok4SH80K5CrdH
XVMCon2fazPfNrcbtr1l0ufT28Cnl0K75LlukvY4ho/z0mUsp6mNc/CCzCdTlnbvpxyxpKyDFP1G
NvSBLtinnKmdsvQLXcR2ye89n6Rd9zMBIY/LtJtvWoZe2ZCjV87Yh0jpc71ye0uUkbAe0vx6++h9
eKZqvQ6vTcsR9OZ8+tLmOm2H8z1Gh1zG54sOqNUhdZA1tFPq+hVeZtjDVteqdt8B1e/zWsy20lZb
HyhZXqUOL126uTOjPaVur606WpsMqiqjssKu7WiTGg+Wq2jbPu1YuV7r5i3VqqmztZJLkMO+0sp3
P9LyV15X1m13aNhFF2vYeefp4zNO0+ATf6EXf/av+uQPv9HWIR+oaac9BXdH1Hrmx0PwYyrxdych
S7MOledr6rJpGvD+S3r4rWf06Dsv6snBr+mxV1/U4889rxdfeUNDPvxMk8ZN1YpFXlPkOlbevFuF
hbwohAsYRhOTjrGq+pRK1+9QztDPNe3WGzX98ku18sY/aZ/XVUUOLXe+85ZWvvqKFr8+UJtHjFLe
xGk6MG2O9k2ZrX2TZurgxOkqdh/Lps9R6dSZKpsxW0dNB7NmaP+0mdqXPVe7Zy3QrtkLtXvOfOXP
m6e9c2Zqx4zJ2jJlvLZlTfDxdO2bl638uTOUN3u6ds6Yom1TJ2qXy+zOztIu0/ZpE0Me53ZMnxz2
t2Z943NTXI+62c6fpPXfjNbmyeNdflIot9M8IlFns9vcNGmcNk0e5/a/CXnwhrZOnaAt5olclGNL
Xjhv3vCjDXjvdLvIggxpHpO+5eUyyED9IIfbRs7dM6e6nzNVsGiuDpkOLpgd+kwf4bvDZWO5SPQd
GbZaT/DaM2taINpHfvqCrLtnZlmPM0J92kNW5IgUZCc/UugLcmWFfmw2n40TxmrjpK+D3OiBNqPM
++fPCvVoC1nRJ/W3+niPyxxcOCfUXzv2S23rHavt08x/9kztWbBA2+cu0PJvJmnFxCxtnD1fmxcu
1vblK7Qvd70aiorS9o43S9lDcqGim99wWrxuqE+opqhC+7fmad2iVVqWNVsLRk3U/E+/1JxBH2n6
869q4sOPadydd2r0Ddfpq2v+rI9+e4lePucUPXPuyfrk1mu0bewXatq/2wbvRprt/r0e60l54esY
O5UggEuoKVWnrQe3afjU0Xr+o4F66LVn9ODLBtcLz+mZF17RwDcG682X3tbAZwdq+OBh+ubz8cr+
eob25O5Sc5m9X4we8NrVSZUsWaclL72hry+5WON++RPNO+dkLf39pVr4lyuUdcXl+uqPf9SwK6/R
qDvu0dcPPK7xjz6tcaYx3h9994Maf+8jmvzAY8p68HHTY5p0/6Mae9/DGu3tqAee1IgHn9KwR57W
8Mee1sgn+mvkY49p2EMP6LMH79Owhx/Ql088qtFPPaGvnnxMn9x3jz666w4Nufuv+vLxRzXy8Uec
d7dGPPKQRvV3e6aRjz0c6kMjH3tEY556Ul8P6K9RTz6u4Q8/qM8fvD+c++LRhwMPiH3yPr3/ntDG
Zw/cp+GPPBjO0e5XXuNSl/zPLdfnD8Hjfh/fG445hyxBJrf/lWX+0sfw5BzyseWY9gN/9y1d5xG3
/1A4F/rh9r4e8JTGPt0/3a7liHWCTnplRzef3n9v6D/nRpgHfR3rvo7u/0SoF+qYvggyPRb0Qd0o
TyaRhxycpw+UjeWjzigzIshzX9AT9dAr8sb+woO2GA/6h0zjnx2gT6zbD/56R69M1htln3xCI595
Vp8985zeefRxvfPYk/rgqWf1+kMP683Hn9AXg97RlqVL1Fxeaju3YYZQ0eEfEz522ua1RW19k44c
KtHujTu1dVmuNs5Zqg1T52rN2Mla+skIzX7rbS0c9JZWfDBIi70WmjLAyr7nBn16742a9sYz2j9v
mlqL9hmxINchYCqhzkS9GmqOqskL1s4Qz/eoqrlGSzeu0uARQ/Xgc/11v5U84IWX9Nab7+rDQUP1
5nNv6cWHntXHr3ygr98bqemfT1De0k1qOVSlngbPCITxPJdSk1LZwjVa9dSLmnr+BZp5ws+08qxT
lXXiz/XlCb/QiLPO1Fd/+Hd9ed2N+uS6m/TRDbfq/Zvu0Pu33KHBN9yit668Vm//5Wq9d9W1Gsr5
q2/Q+3+5Vu+a3vnL9T53o9748016/apb9MZ1t+r1a2/Q69dcp4HXXae3brhBb5pev+YavX3TTRp0
08163gAe8Pvf64U//UmDb7lFb994o/Ou0Ds332yg3a33b789lKPuoN4679x8i9677TZ9cMcdpjtD
Puep8455sIXPm9dfrzeupW3L5WPqvXur+2Oe1CXvjWuv7a1LvVuCbK9dfY3r3qB33QZl4Yls8KUs
9dJy3BzKUYd8yiAXfGj7tauv1itXXRXOD0K23vq0GdoxvXLllaG9t8yTvJf/cqVedR30Rb+CrJ6U
37e8sT46TMtwk7fQjYHeugG64dg2loltxz7EOhzDH50g7ytXXhX0hfzoh35HPpRBDvoXCb3SB2R9
45prPd4e41tu1UCPyat3/lXP3Xa7nr/D2zvv0l1XXKG7//Jnvfroo1oyLUtVhQXqZj3O10F72tWv
yrFUrQ3dfiXcSdHWllKirlWJ6ha1VjWrtcJrq6PVaiooVN22rWrcuUWt+dvVsnez6jctV8WSGSqe
N1lli2eqadNqdRYftBepD4u8zvZmO61adXa0hkvOTYk6pZxf31yvbXt2auSYMXrx5df08kuv6+2B
7+qd19/Tk/f118ABb2jaqCzlr92pyj1HVL7jsOr3OA7eV6LuQ2UyKt2Gw8BEj0oWrtKS+x5V1uln
aPFJJ2j3ZRcr+5c/1/hTTtbym2/SoaEfq3b2XBVNydKBqdO0d+ZMh2mzHBY4jFm4QAVz5+jI/Hmq
WrpU5fMXqGTmbB3JnqPCGXN0yKFiPqHi1Hk6kL1Aux0W5k2brkOuc5hQ0PvrRo3SHvMtXrRYBXPm
6MCsWSaHkLNnaz9tTZ0eyh52G7ssw64pDvlmTFeR26L8nqlTtXPylGN8D81xaOX6+2fN1N7p9tDm
vWeqw6Pp0wM/6kD7Z84KdfOmTVPB7Mhnsg44/8jChYE4R3t5013GfCH28wLPqYFv/owZQd5D1gf8
92RNzWhn7rFy7O/LzjbPqaEN+rlvpkNX5+3LdohFX92H/BnZob/0n/IH3A9k3ed8eO3Oygpt7LUc
6fOz07zgbbkCj2yH3+YZ24mETmgLXshNHY7pJ/oJ5ywT++iNPqCHogVpXWybMCGMQbpstmVJ62x3
1pQg/6G5Hifr4YD3g+4pY1vZ7r7kuv4m89u1zI7G2w0ul7c2R7WlR2zqLepJOIriQhagKnYsVeYV
f41X/jgAlivhPy6CxAsm4aKAUdjqtVFdqboqeBiwQOJtsnmbpZ0bJS5fF+RLbiTche51VGeywWEm
cOVLegk11POG1qT4skdFUakWzpivIW9+pNf6v6KhA4do9Mdj9N4r7+uDNz7U+C++Uf6WPC8uG9Rd
16LOGvPzwrDnKM9hsV7zzNDYpKJZczTXs8mUk0/SEq/v9vz6Es088QRlnXu2djgsa12yUCo/KhUe
UOrwfrUa9InyI+qurww/FbSVHVJDwS417tupNoeu/KisSrdR4fNelHYXl6unuML7leooKlFnSYlB
7eOKcnUdOeJwN98TiftcXZ3OrzSVQ6XqLj2qbn58LvdEUOZFeKEX90WF6io1D8o7r/1wgdoOHlTK
+dQRz+nwEpPiInUcPqT2Q15I+1zn0RL1lFkuZDO/bsvRXnhYqSOFzi/ztsi8D6un1Dyqrf+aKtc5
Gup2uJx47srU4TIpy50m8/WaoKe4OLTdY3npXw/yVph4nMJlUpYlLZfHPshR5nHwBOdzXa7fTf0y
99X1Oadq6y7oAT2m+96FvC6fdPvtrtNR4jGAl2XssT7Y7zCfTvejy+11u+3Ay3yRg35104bLoPfO
o97G/ZLi0M+UdcVY9AQ9WgaPUZCjuibkJwoOptv2fqfbYL/NukGm8LKiKusN2S03uutwGynLlnS/
mg4fVqtl7KyrUbt1m6q1O7JzCEDid0I7EIdltvWU+h2xwbs74eX/zUYP9yx2AyiuKhIXOoO7g/kl
nqsDTVWHVbwtR+Vrl6hx6Tx1LJirbqO3Z90Gde/OU89Bg80KU50Vz+8DDvm6ulNKGkjcQMpH3gLv
mqT2rdquSR/ZW/31aX3+2sdaOm2JchbkatyXEzXw9UGaNtWz167daq6vtgwWuMvhY8LAbq2VvE5T
8X7tH/elsm64SlNOOVELHf5tOO9szTj5RM38zWXKH/iymnnHIJeL2wzo1ko1m5I9fC84ac/cqH1H
dmj1hvlavNiL0Jx5OrJ/mzq4ZMwP31y5DAtQ951bddoteKeJy+5Jy9OGTN5PuRzHKUJeE/XIpyz7
XKInv8u8iLs5xz71eD9iqEtM7nyU3+Et+fHRGMqFetT3udAebXkb5HE+W357g09H5IWunddqHvws
woKa3x1jHcpzZwRtkB/q0Ybb4hxtcKEJXkEX7PscMvI+x5ZG9TQ2eE1u3qF/GTJm7lMv6gQ7Ip8t
+egQ/bAf+bZZJibxKMextl2fMAuZg0wuy2+P3u92Xic/iyAHd4FYD80VpWG9041O6Ef4bdJt0P+o
U9oMMvYS+0FuE+VDPRPtME7hfC91t/tfi03F/e9x2QAYeyrPH/ZUfOO9I9zLFJ44cFvh4/Em40nJ
bu5r6rLzMgDtnVZMHasxzz+pMXfergV33qPt/Z/T/pcGKu/1d1T19UR1bbLnarZX6WqybE3qcOPh
dcwAyjwDNfWocvsRrRg9R4MefEUj3/xcaw2o8qKacLXvi9Hj9N7HQzV24ljt2LlBzS2eQQwGNXgW
asBbHFTnrjXKHfySPr34DGWffYqWnWpv5RBw2iknafE1f1Hp50OV2m1PmjJIOuq8bqxXfQ+v3+zQ
/vpiTVs/R2+OGazH335Cj736sJ59/Ql9PvJ9bd5qt17tGdRrwrQSrOBkuyeENh9amZ58Ojx4SRs+
HjhpI0hhlDyjcMy1Z5LzeVmpB7HTA0XdLg8stwmF37/Csw3pMn+zH89HPpn84763XRl8O2xo7Hcz
6KFM5AVveHF7Es8YMQicM4Vz6X1kTLovrQZawhTKOb/dBpW0QafcRk+Uk3OB0rzpE7ctdbh9bm2K
7XTZKDudH/ob5Oe3nkgcm1dvfo/rcYsax9QPfTKF/pAHX0ARyptchv6GOoDEqaKyTAvmz9WIzz/V
hHFjtC8/z/3hNyjaI8V2uy0fbSSN7WaTgWlZuXk6lKFf8KQ9AByBb3vmKYoee6keT/Y99lQ2MjsQ
L3l6Ejz64TWOgdViFKW8pqIORs+W30Z5rN5zkQlgddobH1DOlHEafP01evWk0zTyhLO17OIrlPub
q7Xgoj9qxwNPqG7CRLtdhwzdjfZSjWp3nGm1hDvrU+0eOG7Ftw22F7cof8l2jRr4mcYNHat1KzZ5
IDtV1dii5Zs26KPRw/XZmM+Vu2GZ6hscYvAzcJO3NQXq2r9BxdO/1KxHbtHQs3+mRRefoxVnnKrp
//xPmnn2Wdpw/31qnjbZnnOPO1Fr3dR70uDTPAmvIbuUW7pXb0//TFc+c5vOvekyXXLjr/Xr6y7T
fU/+VdlzJqmYH4959gtFcg8jDwEmeGaJAXWE61mRh/Z4wI7HwdnngTwexefRFp4G5SFHHlyLT59i
/DxcxxOx4TvI3DZ/LPFgovXvvFA+5FiF3ufBufB4erg1xkbayy/U8kQI3w7LmfKMDHVYxlCOtuHn
soFcr8tjjFzpp1Tdpv/gxzHlu+whkvYerfZq3N/Xjbfz2KVseO2eVFL2GtwkfYynCVngTbuc59ad
zkAdbp+ndJHPx97y0GF40tZthSd6vU0/FJrmgxzIzjHt0Of008rpPORBb7H/3MHQ2tIS9BNT3p49
GvzOO7rrrrv07LPPaiVPPtfw+BDzI/LEMUHfyGH7tCdq86SB3EEezlmOHmQBVICWLRNDF3dXeKw9
6fbYtgNgjI1Og6q9q0X9OkCXkdbtcIfnZdIhn4scA5SdgqnSiuUeh2RLjSrXr9Hk+x7U8FPO17R/
OkMbTvy1NpxwqbL/xylafP7vlPfsi+rckuvwwOuRcLde0nw6VOvZrL454QgOF2+mlrOhsF6Lp8zX
rMm8xnizGhLpm15Lko1atGW15ufMV/7+zY5eAJXDvqRj39Ldal2WpUXP3q0xf7lQ4y45VTm/vURL
TztN4/6v/6Elv/6dCt4YqG4vJFXiNUezY+quZuO43Rw6VGEFrKsu0NDF4/XnZ+7QaddcpAuv/5Uu
uepi3fXobZo5d7LKyr3GYSbzgHYbULhwHrTrwpU7HTxwSHNmL9Cwz0cGmjVzrpcOVTY8nqjtdLTA
h8Hb1NjgVpPcwOpK1icPSabau0O5Tn5zS9tGOB8iDofb4cZmjxNbeMGn3qFzXW1T4NeWwDOl64T6
fSjdRk9oAwrteTKLcrHt5M4A/0MG+NFGss1GlMHneESbtskgG3wjcYz8USb48zGLcEyWtxyH/vlc
Y2OrDb0x9Kej98FH8tO8XNjH6BpZ07qi8TQfcB6w3lsG3SR4B2VvO1u37NRbbw7Wvfc8qOeff1lL
l6z0MpMnBz0nu136Cs/4tC98+hI6TCbwsL2KDh7K+ybuie02sLp7uC+S+x8NUlO7cZQAVD0g8Nhs
7MrIBjC962ArvKPCSz2DKv1IfWeySe1792j72+9r8e+v0+J/OUeb//kC7fjXi7Tu33ib7EVac82N
Khg2RIndBlZ3vf1Cmw3agLIADV4nJBocg/JuPiumrb5du3K9rlmRq3Xbdqrc8b/PGoSdKmms0NGa
IjU1eQGd8BqqxYvWin1qWzlLeYOf1xe/O1MjLjxBs35/npZdcoFm//Ikjfunf9O22/6q5jHjpPz8
9MUD3n1Bh82z2lRmOfan6rS8ZIfemPCxHhz0lJ778EW99N6LGj7mE+3cvdHhJoPQpY7mZrftGaBX
2UQGrU0JLVm4XANfG6Q7b7tbjzz4uEYOH6WyYj7/kx4QjDWFUfOAH+8BwQg4h1G576mEeVvffFSc
sLitxdFCYyLsUybpeu2tnkXbAAWvOca48HSEK9QzP6uQxy/Cl/4xOh8HGT3+nOeJA3jxcGZ4QNPl
4NviSS3RxGybthPkaE94bHuNmUT5lMHWapma61uCbBzzFC31OixXW7Nn+GZ7J+9HI6f/nTzYaF4h
Lyaz7nD7ncjj/KTB3drosMv16XOvvQa5v+2b990exH7sG9997jYf9En/0QuyUx+ZigqKlbMyV/Nm
LdTSRSuUv+egGutaAg/0l3IIxhil5UUvPrZs6Aq52e+0TnjCmMdoUq0Jj4/ttqXB4LVr6XDcFQDl
MTS4kg4B2zq9dViY5OofYU2aLClhGR7Eu+g3gsqrGXsrfA4LQMdtRYVqmJKt/Q8M0JoTL1Xu/32G
tv2vc7T/jN9pw+m/0pKLf62ld92qA+OGKVm4XR2JCgJMA8teqq1RqbAwZmQsuGeN8kMltv8D2lN0
WGVtTQafFW7DZxUXhOk2zBrsoQ7sVMfyeSr84E0tvekvGn7av2nsWT/T/N+cr1lnnqYsg2rGORfo
yMuvS0tX2ku5Tr19LXd2eKbhO8LVHrFqW0WNuZe7ldX7NmlO7gKt3LxCazYsdyi3ybMoN1ayeHYo
Y1B18QZeBtU6STa36XD+IX352Ze66+a79NuLfqPbr79dX3wyUrXlaCsjuby7EbrAC3Z6DKauXupk
C6gYPAOsrckaqm91uI71ubiNI9VsHfhcmOEwgkge/LAuxqisIuqHr/33yhjVFoh9n4r5XChqrfck
Zwp1euXjIc5wlYryLotxJS1TU22LGqp5yLDZfbch9fKET9Iytjuvk48x07ap2/U6Wgw+DMj/eEtw
ADx1AB/9Qxa3y9Kkm4dHrYtu6yG0HfXFfi/PY+S+E22xhDkmO7xIPt9l+21tSAQ9os82TxwcN9c5
WuBp5dCG68GLeqYgrycadBjHJGxNPYDM3rudVwo0Nnhi8RLCtssjNjCxNA73PG6pFjW3u03bFlbb
L1zVCuSeRFD5kNvrDJ/em1kJvLgfwlU6nMtl3Y2bVf3ux1p/0Z807//4uZb9nz/X/nN/px3n/0ZL
z71Qky46X3PvvVnbR32g6rwcD0CRheFFjeYYbgJ1Q/ZaXbW1aqurVVNLffrucxs8j1oke9J3FIfL
lFy6LDigDn53eOklrb3qKs09/1wt/dX5WnTh2co+81SN/dlPNfnMs7T21jtU97XXdLu9JqrgKqHr
85i5FZhodwja4vWCY3LGjTFp87qJ39A6PVl0NNapo4HLpD7DTcBNveDHEGwoHR6s0n2HtTx7vt4c
8Ipu/uO1uvLSP+jpex5V9tdZ9sBui8SgReMIjXiAmrwAr7UhN9taYn40HLaZ5HMYT0+L6zXaQO1Z
ugFBvQfTszvv3LCSvuUBv+PwONZOnzZ6PM7QsfpuSwZHmq/zOaZurB95UTbych4Aw/DCG7kAJbbT
apmtqzCJ2EBTBmMnT19zzuvl8DV06vfyCHyZOMLk0ZtPHnaLHLEM/HnEnodaY37kg0zktdKmy8Vz
vcAJcho4vLIuvLeEto614/IcR56ROBd5uAjuNbw9if2MZB8XPFRzu72VQQXU+jmuMENz4ElFGoC5
D1lDo6sILL5cyBNFxJLh96qKo+pYsFBlTz6n1eddqnn/eoJWn3Smck4/W0tt3Fmnn6Lxl5yjqXdc
pQ1fvKODy7NUuWuVuir4cbjayjUPfiuqM+H9Qk8Q0S7XoOtIeNa311LpUbXnrFPLN1NV/uog7br6
Fq046yItPOl0bbr0Mq08/zxNOelEjTr1ZM2+6kodHDxYbWscdpbxW40ld1iV/p3A7By+1NvwO3D5
jsXbmu2JWg2q+nrVFBbqyPYdgZrKytVZZ/l44YlDg1o+9p27RavnL9W00RM05PVBeuqeR3T3tbfo
nutu0fMPPalRQ4Zpx/ot2r89T9vWbNIO05G8g2rnrbktVqipB6NlsKxbBrnNa6SGsmrVllQEqvd+
S5UDX8+wlAlE+fB1Fcfuweg90himDayt1t7DYU0I27326HJfO+35OwjV3M+UJ4FAPia/GzlcLo4x
xGP43egoPBzae46hMM8ue6JO51O/zeuWRk9SPObfVFEX8o/JSHlPHKE+H2RGHnTuPibdn24AizE6
G9nhVX2k3H33dG2PJ8LKxrTcyJNu3xWCPZpCf51peUI7yO6JjvIt1Q1qrqpXO3oAtC7KezdKDhQq
b/MOHd6zP63P0I7Po0P4ehcwdXnCSlGXc7RrvvQb/XW5j20NjrDCE9Vu19V42U1TAx92cMTlybfL
6y1WVMkuj2dHyuTwj8uTaTJH3DSMTSGe7ZWfSdHddWWumnhwUoYYl6kP75WmT9K+Jx7Woksv1tQT
fqZZv/y5FhlQC888XZNP/oVGnflLTbvlT1r20qPaOfw9NS6eKe3cpJ5D+eF96j3cgeH1S1d7+p0U
3V083FinrsrS8MNgYsValbw5RPl39df2y2/V5vP/qNUnnKflPztdG869WMvOPk9TzzaI/3y51r78
rOoWzFIXr4BuafYsb+IigfvCWrPNA9bkMID1KeuiI/uLVLAzX9tW5Gj+uAka99EQZQ0frj1rc9VQ
clTdjqXbvQDesW2XvvpilAYPHKRnH39K99/+Vz1wx1167N4H9NRDj+pp0ysDntPXw0dq7LAv9Om7
H2jEkE+0dM581ZdW2Ng9Tfc+dsJaJdHYotICBn2b1q9YrTWLl2vNkuVav3y1tq5Zp4JdeTbgaodf
BoQ9JXVC2EIYaDYpHj83371btmv3xi02oEMq2rtfB3fu0f4du3XAxP6BcLxL+7bvct4eHeIx9P2H
1FzjNSZvbbIH77RsndYF3xmDP2876mhOqP5oRShP3bzN27Vzw2ZtWJmj3GUrtS13g0oPHDbY+I3G
+kU2+he8evq4zedqiktVmLdPVZa13dFQ0m1VOSSn38vnLdTGVWvcj0pPKGU6evBw6EOD+83LZkJf
kQd+CYdu7nP4Bprzut1WW22DjnjJsHvTVh20vmgr6Nmp3PvzpmXrk8Hva+JXYwP/wNMsA09Th/tf
a7kOu497zOOw5Sy1DOgSveV7fY/s+e7/nm07zPOoyo6UaH/eXm3dtEX53vL+wmOvUjPx4YtmRzj9
UvaNUIfDLi6PhrOUA8mmCC6yjGElknVqbChyBFds92VAHF6nqhlfaOOz92rir8/QhNN/qjmnn6B1
F5ytNWedYY9iUJ3yC82y18q54UrtffQhVbz1plq+/FItWZPVunSB2ndsUsmmHOWvX6naonx1lh1R
z4GDSqxcpwPvDvOa6UbN+MklWvBPF2jrKb/Tup9eoEX/z8ma9b9O0OzTz9GSa6/RhrdeVuGCLLUV
cwndM6DDxs6UZyG7XFTd7D602EO1GVF0sexopZbPXabxw0bp3edf1eO33qlbL/+jHr3jDk0bP14F
+/OtoGYV11Zr3uqVeuPD9/XsKy/rvoce0NXXXq3b77xNDz/2sJ7o/4Tuvvcu3XnXHXrltVf02huv
6fmXntfAtwZq2oypKi23p+XHx95UXl2htevXauy4sXr/w/c08M039NagNzVo8CANfu8dvfrGq+H4
y1Ffav6i+dqVtztc3On0QPCSyHZPgIc8acyZN0fvffCuXnz5Bb0+8DW99MqLesHtvvLay+b1tj4c
8qGGfPyRy7wX+CEP9L77sSpnpY5arsrqSrW0GRgszDxp8tfs4x27dmjq9KmB/6uvvxJ4w/flV18K
bQ35eIimTsvyCmCjyip56tnG3suhy3K2+Xj7ru2a7PEd+skQTZoySavWrNK8hfM0+uvRevudt/X0
M0/pnXcHhX5MnjpZX43+Sl+P/1rrN65XncNw3ndv+Hj80i9wbTdPLqfbQtXU2qRde3Zp4uQJ+nz4
51q6fIkOeHnQxFrdad/+fXr3/cG64abr1f/p/tqdt8t2mw7N4dlqfkUlRZozf07Qx5NPPakBzz5t
XdJP+pvu59ChH+nzTz7R8E8+05eeLD/5YKjeGfi2hr7/kWbPmKXiovR3tGJCNn6e6Oe5MFwU4Dco
Lg7a7sKsfgxYaTSFS62Aqq2j0Z0qtRss8XkDK+kQ5/AaHckermVP3qbJfzhPE884IXirtaefoXWn
nKbFP/mJlp54gnLPP0drL7xI6373B225/iZteuABbXjuGeW+/bqmv/q8pr37pio3rgm3zHQfOqKC
keO17JaHNfGXl2maAbXkXy/RxpN+q1U/uUBz/+dpBtopWv6HK5TnQS9fOlMtR/MsV5UnIz5X6pDF
EwUv5Kg3kKrthXlzQIxuDh0s1rRxWRo44GU9cNMduv1PV+mqy36te2+5RZMMqgMFBw3ClI54rbfu
YL6mrVii8bOn660h7+rGv96iG+64SXc+cLceeuoR3fvo/Xr82f4aM+lrTZs7Q5NnTtX0+dlat22j
arweJGxuc9x9tKZcS3KWaeiITzTglecCDXz/bX321XB9OX6Uho35Qm9/NFjPvvqCHn3mCb048GXn
j9a2vTtU55Abk4LX/iMFbidb7336gV5661W9OugNPf/GS3r2tRf08tuvafDH72voF5/qw2FD9bp1
+sTz/XXXw/da5pt18923adLMLBWWF6uyqdrRmkNgj2yiV77cLev16VfD9IzH47Fnngz1h1he8uA5
+OP39PJbr1m2V/TO0Hc1fd5M5RXkO5JKWjIuMHeryQv3Tbu2asTYkbrn0fv0xHP9NXjo+3rTfX11
0Ouh/ivejhz3lVZvXKtxWd+Evt776ANBh0d43szhFP1t8+ISGdu60xcBaAM5Zy2ao6deHKD7HntQ
c5ct0MGjh1WX4NdUaY/lob0/33BVGBvGob6Vd1Yy9rwpLBnamLVorsu9p8efezLoHNleG/yGXrAs
L735qt4f+oE+H/aZPhv6id546TXdf6d1eNV16v/IE5o0bqInZkchvZ4qmfTI9O7347cnruq1ukk7
2BDu4c2PAcvEPm/5JPzr8LACw/bwoDu/YFX4ZKnaj2xSUdYXWvLkvRr/20v0zamna86pXmOddZ7W
nHyaNp12uraedZYB9jNN+1//ogn/9nONPelUDXfe++eeqRfPOk0fXXuVahfMTd+rZU+y+qW3NP78
f9c3J1yixWf9UWsvuFLLTvut5p90seadcalWXn619j37nJpmTFEP9yKqJfSkpdvxf7fjbSuwwcLX
uLOVjqkb3TH6x4WpAw79Jo6ZqKcffEJ3XnOTHrr9Tt178616/qmnNHeOZ6FSTxwu60DUxI/fPSpv
rde8VYv10IBHdc1tN+iaW2/QXY/eqyc9uJ+NGqGCskK3nVRTR0J1DmfZpn/F6FFlS41Wblijdz/9
UPc9+aAeePIRDf7kfc1ZPl/b9+1W/pGD2r5/p8vkaJQN64kXn9IdD9yl/i89o5lL5qiooiQYDENS
3lCtjTbaRTlLNXfFAi1avUyzl85T9uLZmrd8kVZuzFHO1lwtWLlEX34zWi/Yi99t47r29ht18723
adr8maporPGEw1TKMqVDR+vKtXjNMr378Qe657H7A7394btasna5DpQeVkFpkfIK92nFhtUB/I8+
+6RuvPsWPf78Uxo3baIOVRTZWHkPnnXV0az9xQWamD1F19x+vf5841W67/GHNOC15/TBsCHOz9Li
tcu0z6F/c2ebVm1eq5ffeU2XXv5bvfjWK9qcty18lI++OtZQwsBigmRCSRhcu710GDLyE1196/W6
7vabtHrLWlV5CdGQbHb5jsB39MRxYWwef6G/1m7doKrmOp+x5zMhY1Nnq3YeyNOCVUs0Ze40LVy1
VKsM8OUbVlmX8zVj/mwtXL5YS5Yt1fSp0zTw5dd1y/U364+/v1zP9n9G82fPUytPuDsBpvr6Bi8v
0h67H7/d8AqMNjcEqJjJMbywvMog8nhjA2pr56+n1eDjnie7XKi1yh4rX+WL52vrkCHKvvchffXb
P2rEKWdpwk9/oQUn/NKe6zTN/4nDw5/9Qku8Fpp91rmaaG828tRTNOysMzXj2mvVNG68p5o8dTqe
Xffcyxp73qUaYo805vQLNemC32jsOV67/e6PWnP/Q6oaOVLtDmW6jhxw+w75uMDhNV8bv0mF3wx4
JZlnJk8IrXbBrJ8BCqmwsESTv5nsWedx3Wav+eDd9+iu2+/QgP5PhZfmFxUXWxvpfgd9mFq8CF2R
u1qPPPWornVocdX11+hWz/zPvfKCJk2doiobKildz4t0GwBfFwEMlQbCgiWL9NzLz7vO7XrHoVXO
urXpS7Hmm3B4w35DS6MOOzRZvnalhn/1hT4e9qlWG4yVDkNJ8Go338bWZh2tKg1U70VzRV1V2Oc1
1k0O4RoTzdpXsF+jx4/RXQ/eoxtuvUnPvPicZnrNCf+kw8iOACkbbntS62147w55X3+992698c5A
Tbcn3OeQqp7fZjraLFeT+TarwTP+0YoyrbQePh7xqe6+/149MeBJTfLEFmVsTrWq8OgRTZs5Q1ff
dK2uv+UGDRz0luYtma+9B/epsqZadc02wk6HdC5fWHpEk13/rvvv0d0P3qtPR36umob0zxO8Gq7J
fWlx+NZp+6t3vaWrluuBxx/UX++/Wx86FC2u9PrXWue7Y2j7QNFBjf1mnMs8pGdefk4btmwK7VEG
70eblGvx+od20F29Q2x0WufIorq+xiGo5XPYXnCoILyaesBTT+vuO+/SM08N0OzsWTpSWNR754cT
GOngrpf01zL7gVwv3U0AKk3gLRLrkTTxuoz0PYDMb4QzPMbRY/LK0QbtATLTHhae67Zow+gJmvX8
65pw4x2afPGlmn/eeVp94fmaecIJyv7lSVp64cWae/a5mnzKqfr6pJPC81C5FjqRNU3avlOd6zZo
w4BnNfqSX2nQSadoxK9/oyk3eW1191+1xkZc9M0Y9ezhxS7lFq7ebTdbDK7s2Vg883Z026+iZIOq
07ErYS0emC3p6NFSTfMM9NST/XWbQ74H779ff73zTvXv3z98SaKwqCiUozjU6YVlSyKh5atW6KFH
H9aNluX6G67XTTbWAc8+o28mTPD6otwa8qA5ru50+0EGLqM6NTQ1aHXOar306su6+bZb9MbAgVq+
YoWampuU8OB2hNtwvk0NNoLtO7Zrzdq1If5vbk1/TYP1RBv3oTmxzuItPkQRtBsTa5uKqkotXLTI
65dBuveBe/XiSy96nTQtrIHS7WFW6Tq8F356tg3H/bjr7rs10WugQu5M701hLZfy2Ga0wXps0dJF
6v9Uf91rYH3gNdyBg+mPviU72z0pHVHWtKm63pPPfQ/cr3HjxwWemTxiYr2zZftWvT1okNemHoMB
T4V1ESWRsaWVR4fSa5fDhYc19uuxuvaG6/Ts889p8ZIlx9ZLMbG+GjV6tB565CG96KXB1m3bvN7i
loJ0au+w92tL6zCmcGtZ71jFVF1To0WLF2vw4MF64vHH9dqrr2pqVpaKCgsDoCgfbnfq7RPHrLH6
EZqkY+FMUAEgfpfyDP8fiEdE7AFsvEkLB3N+lXZWejrnMuzRGlXt3K+yVRtVNHmGtjz3vDb+9Q5t
uvE6zTC4vjn1VE33dsIZZ2jUiSdq5C9+qekG2dZHH1cyd708Pahz+Qqtf/5Zjf3LnzT033+v6Y88
qE1eKxROn6iWDXw5ZK9dh8NPLkrwnnbP8lzBjB2NxD1if0Oh+9zpXxY+X/PMM8/o9ttv14MPeub7
61/1lMM/QMUL+mOCD8rC+Pho2P0G4G233Rbq3XzLzXr44Yf12WefHftcTfpeNYydOTGdqM/5ESNG
6N577w1tvfXWW+ErG3zNj0/iUDfKCQ9ejs+WY/TMF0Pi1yjgT+L+Ob5mQbmY4IW3feihh0I7b775
pvhqB/X4sgUfQmjhjnUneMOTT+6gi9dffz183YPvPSXtwfgyBh9J4EoX8lCf71Xx1Qu+9vH+++/r
xRdf1AcffhA+RwNfeB46fCh8Iujmm2/Wc889F77mEb88wvk4PjExHnzO53EbL2MRvwRJyjR2vnpC
f2644QZ9+OGH4d7L+GGGmPiuFnp+wGv2l156KdybiW5joi+0Fz0N8vARAvoVE7KONjAZ62sdQdFH
vs7Cd7rixQnq03Yci5j64Q4hQAUxH/UFldUUthzHMJHQiu87wbibe7fCJVCbbPhxyzNovaPhqka1
HypWg2fk+ikTVTvsY+0Y0F+5D9ynjQbJ4jtu04QrLtfH55ytkb/6lZY88rBaPJuroEDdmzbq0Niv
tO7dt7XKsf3B7Mlq3LZOyZKD1kqZ2/EAOfzs6WhQZ6LWW0tnzxCA5JkbRUH+r7erf5v49ApKwjMx
8Pfcc49uM0iefPLJ8K2l44GKweCrEZTlZk0G7W7P7ABx1Fej/oMRsOUTK1AECV/v4BM477zzjp59
5tlwwydGwrek+DwON3/yFQu+8JFpLOwDKmSIQEOmRGsaxCTykJtPxdCPm268MfDnm0oVPOPlFL6i
YSOIMsIXw3zxhRd1pz01Rv3pp58GQPBpGz6vg4F+9NFH+vLLLwNvPicz8ouR4abVRx99NOjhlVde
UfwSI4kJZPSo0brppps00F6Zj6ihBxJtckNxsJ1eYGH0fFDu3XffDXIAVurExNc+MHS++PjII4+E
CYOvnhzvc6p8poc+3OtxAlT0LxNU8EJvmWBFh1HfTChMdrRxxx136OWXXw4gR7eZY0J76DKCK/Lr
h/OC+nqsCKzoob4FlO3ZBPg6CD/MsIuwj9uc4t0HtAsxEZBX6xmg0KHBllw1zJqmiknjVDl1og58
OUzLvcb47NorNfQvV2h6/8fV5DWSigvVU1igJhaY61ar2tvOkgJrnjibONzhS3eT228ysE28I87r
KB5JoKMRUAFU35EAFR7piSeeCLMeM/otDgM5Jp9Px8QEH/oJKHhjKUACWAwuXufpp58OsxpGT0IG
FIyiqcNsn+lJmPnxHF999ZXeeOMNDRgwQM8//7zefvvtYEzDhw8PgMcYABHgoX6mYcAfrxENFRnT
n+WZEvjhSZld6Quza6YxkCgPD+rz/SUmlxsNQrwEcnzwwQcB7NCrDnvwYshKPjIyKeDVkJvzeGo+
FIeRwzuAyjq5/vrrNchhHZ/kiTLQF/rEMUR5CD0B2vvuuy8AFW8bE96V72IhD7oHfHwzCqOO9aNR
83XHjz/+OJQDEHx6KOouliGxT/0IRvbRIWBFd+jwtddeC9+jwsvHumzjfgQWfWJL6ocwmcCKHisT
WJkUQZUux9rBDTDjtLlGi8/ySzu/fHOrSquVGL4N3Gjv4lCt8oi6D+Wp+/A+dVeWqOfAHh2dN1NT
vIAe8ZCV+NYbatrh2anBIPQCucfU7brdScfDna22BAwoqZb2elW1VKgiUa16A4qLwiy6+Y2ETkaK
yo6UmQAVyssE1a233hpmeAyaz2dmJpQIsPgIGqCCGHjqYARDhw4NMxwJQ43hUmyb+tGIIjHQyMFH
2QAYBoOhvvDCC0EujJjvRuHd4BUTdTGyGIaQ+DgcBhnDWLwDRocc6IKyyE9ii4zwhDBC2qUuRsjX
BvmOL198BCiEdRgm4COfD78xKfDRNc5h7Dz6wmQR+waQCeeu4b0PloUJIk4AtI9OMEImBsrHRHuA
lDH55JNPjoVkGDVyAX68KV4d3UU+EP0k8e0rQE7oBi88F/1kDNhGPUQdxAkPfnxaligEuWMozGRJ
Gcqjd5YBTAARWFGG2H6/cHtB78Dz4+/xQsFI3wLLg+TFK9/MDaCCoV1qD16JX+YBE7e+8BUKNx7e
rsTFBN4Ay4WFZiuKe/qaalWzbaOmDflAX3hBmT38MzUfOWytu5MpBgDks9hvV5vDu1buBrZkDV1t
qkg166gBVW0PhSdNWnIuDNBRKAIrk+gjRIprKrwMHgqPg6snlGOG7AsqlIZSUTJlIYyQun1BRVtx
oCESMjE4hEcYembig2UYNl8ExGABOzMxoVVfeeAHGDEGEgaJwROaYWzMrhgx653oOelz9HYYFFuI
ushFWMP6BCNkUkEG5KQ+smHYlCcPOTBwDAtAUCYaWewr/accXvPqq68Osz2ApHw8T6LtaNQxDzAS
XrJeZVIhJER21nCEoKxfmXxYN1GPFPsSE6Bijcj4AAxAhc7QA+Ug9IC8tMsxdZCX6AM7IGyMeiBF
vWEDEDJRN5NiSoMqkhsFWH1Dwei10pS+Api0AYc1lYkfwMJHyrhgwdqKW0IAFqAyssO9fbyrgsfg
Wx3C8fgxVw0NtvJ9eZryxQiNeG+wZk4Yr8YaOmHj5woXV886U2pJeHHc3Kgqb+vtjQxP8cKzcktZ
ZXkw0YTBzeVrFIU8EVyR+naeWYmZL4ZKGBSxPEaMp8oM/0goFTCwbsBDEVoAJgYf4ydkA6gkZIiD
wGDSJsbD4DK7c2ECY8wciMzE2gzvhWwxfGKdRYo8oxFhDMOGDQvxP/JjwFwUiIAiIQtEHepDHMcE
aFhDYVB4Ob7rGy8qICP6I9EuM3VMHOMhMXj0Cd+YuFjC95ABFest1keZdUnwxjihMG5uB3DSVyY7
1oPxohGeEcDjwVnnZU4YgDWzbUJP1lSME/rIDP9I9B1g0D7ExEFEgBcEUIS2ACqTJ3XipBET8vbN
h1+/AIRMYJn6eqwIrL8hGzfA4n4nmMLM2a5vog1uqOTVyvwgxoMu+L1ugJIOHinEO82PHNyvCY69
Rwz9WNlTslTt2b6LhWRLwsp2iOS1WoNDyBpTrY95bT4XR1Fp/BwcIGs1qNotB7JkUgRVpOipAA3h
CYaE4cY1FbM9xoCxZCbqMmuxgGWwuLgBMQisK5hd4YkxMttyxYnBxUgwZsIjjIGZ87333guhVVx/
xMGNsrHFSJmZWedgTBg6gxzLYIh4N77Vi9dkzcMiHgOKHuG7Em2hm8gLA8OQ8Y5MMKybADXgDuN6
nIS34hu4XMGkHgt58kjwpu/IFkEFf3QRz9M2hFHG/kegY+R4zsceeyx4DCY5Ji30HUOyOKlQD7Bm
goZwmXUfITr1+axobJtE+5Sn3wCWUJIJDD3SF2SlzN9L0WNhGyRkYvLsd+zHm0xgubNxjQURBkai
22kysGzIfJIxeCsMNtaHH3x5fsQACe9P6OQJY+CIAADQQlshlWXlWjhrjqZNmKwVixyycLOnPV27
w8cOHigzj4S3rSkrosszm2sTGLaYPbcd8Qp4vqnA96467KFQRiZFMEEMQDQkQIMREiJcd911IY5m
fcRAMmsBgsxEXUCFp8KAuap15ZVXhtif2ZOFMYDjyh5xOcABaBgXA4gXI7ygLN6NQWc2BITIyWAA
JEJI2mZmZpYFtBguaw3KkQANXg/5kfeKK64IxsZFFMIu2sJY2Oej1BDHgB0PgsfFAKIRoxsAnp2d
HeTD69EmnhyQco4+ICPywouyTCbIR7hJ6BrDWvgCeC5UMCkgG2sv6pNoG2OMgIoJOUgYKyEwl+IZ
F+rHtpiY8M5xHDNBFfO4KIL+iSQioKOXpAx10CHgwxPSDhMqEUdcw1IeXdFXJkt0CcV9dBzD4pjo
z7egOg6wQuOGQAwDM4mhhfhmLusqQMUNkCglfJsWCuGgOdgQkjz/79CNdwGEl2q4TnjDjVOiuVU7
1m8Kd2jv2bzTkaGFNPMeHiHgEj06h7wLsUuEmXQZ7tbnURju5O+wzLx/IQIoEgqMFJVOQjEoEM+E
QuMCnxAAT9UXVNRF0Sz+ARDeilmYBS0DTz2uGBE+MuNFY6I8RoLC8V4MNu0RPrIOw2Nh9IAPUMQv
oLNuYJAxJi6JA7iYGFjWg7R11VVXBTkIESnHLM6WixasxdiHADT9JY/1CIOPQaCXmADqF198EeTH
gFnkcwGFcDJeqIA/fOLVMfoNz0zvCPgxTEJKdANAAR16IAEqPEcEGSlzbJCLcBE9IwceB6BzAYcv
5QOgKDfbGP5FHoAK3TK2tE24HT0VbVOHseSqHjwvv/zyMEkyXuiVi1H0k37x8woAZ7JkIuGYfOQA
dEwOMWFvjPO3oIrA6gVXBFVfYMWwL95DFbyZy3ZRvqfXeOkw4PQ/tuHlIwZd+i01bsrei6++sw7j
cYB8vrK3ZqMO7NgbnmMxc09XlgFggRqOqWoQsRTjTWVd7ovFcHuZ5La8E4k+ROqbCDFQKoYDQHD/
cYvimNVJmTxQGjMUFwEY8Agg1jJ4H8AS43iMEe/CIp6EoQEMQEY4Q2jHmiFe5WPwmVWRByAR8nH1
izAMWaOXIhFmEW7FCxPU46odoQ6GAS8IOcjnPPlsycNAAGYmTxIGx2QDAIcMGRJkBDysb5ALA0Q2
5GVywCMDFjw4+sZwI7iYKDA+1qrIwuQBGEiUBVARZMgRjR0dA5D4QztRAfoFvIAUuUm0gwEzLpRn
PyY8Gb/7ISuhLJNZBDBbygIqIgu8FBMTkypycoGDEDBTp+wzaaE75KEcACM8Rl5koG/0gfSdoIrA
4o/1VQCPKZUBKo6x9UgBhADL9bz7LYXETnp2AVSJxqbwozGfvqwodJiy/7CqisrSD5QBfm96Wtyy
iX2AxROcfDwkfNWFPPTY27ibDeHn8QAF9U0YADMzBsZgEQbwYycGRaiCIZP68mAAMTx+2Qd8zOwY
IEbGYHAVDrDGECKmOJCESBgcgGPNwW9C1GMNwezK2gEehDkYYrxgQIoywAfPgUcDvKy38B7URR7C
QtaLGD3GBdEWPAnJmGUJM9ETKRpzTHhpLp3jOamDbPSP23XoK/zpIx4BfcSETiHk5EICno2yeEou
ZsRZnfMYIMQ+uuFcBBf7yAQ4MF7kZ1wywYEOIj/qReMmYeyE1owpwMSjRE8GGKnHFg8G3/hjN14K
QmZ0iW4h9Iiu0R0/hKNbxgYZor3FaIT0vaCKwApgMUVgHY8AXiwHUS9S+ilB3IobtcdyrGgr8zZS
eOrYW57ODOTB5s6MY2RJIzEZ9KUALtr523a/i0gogNkFQuEoGmJQORcHqm+iPucwHjwGazMGny3H
gCYaBURZ+EWKRsMgwAPQYOBxzYNBwINBj0aXmeAJn8iDcpTHiH8oUT/yyjTkSOgDvcAbw4mX0pkM
kA8vgnFTNhoz9F39jbqMOskk8iNRnrKRB3LQDrLEtqjDec6xJWW2TTn0Qj3kj3JyjvqxfxDlYj8Z
C/oat5mEfuM5+FGP+rFvtJ05Tn+7pjoOqDKBBXAiHQ9YmaBKU6zlzvd4ILnxFmAFcJm4iTRSeBNs
L8DCR4ht0DyjAXGXRqSYF/PZxsv5vYP7QygO6PFSHOC+BpGZOOZ8NDy2HMM7pthOpNh2ZuKYgWbA
MHgGmbb7thdT5JnJB/mijJH6HmfmxcR+7GckjiO/eA754uTDMef69iOmKF/ftmL+8Si2xz7loJgH
9U2Ui8YcU6wTZWYLUS72qW971IkpU76YH/Ni+eOdy8yLKQ2qTEAdB1SZwIrUF1gcZ55PE38Wxq6E
J1l48WCPY7g02R1zNbDL+53edkDOi69MC2AzyPp6teMR3s+dM1P/++EUFRIJxTEImbMZ+wxS30Ek
UScOGpTJj/w4cJG+K1GONmKbsb3j1enLi/04uD+UIo/Y30wDJC8zP/afvOPx6EtRplg/k2dm/UyK
5zITPMiPPPqe5zi2FxPH5FMemaPs8IBXZnn2Y/m+FMvF81H+SJlljpfSv1N9B5AixRtUzepHEXCy
Sg0p/ngSixuK3Mmwz70RPC1q1xxel5umcA8fv2WxgAre7QdSCDHdquX8MRQT+yiLATkeqBiYODjf
lyIf6kDsx4H5vsGI9Y43cGzj+ePVj+d/DMW26G80/O9qE8pMMT/WzdRNLB/zI+/Mc5l8MykzUYY6
kUff8xxT5nipr3yZfWMbKcqVSbHcfyb97R0V30E0EslN/mCyiAFUaRjxZyPt3Tqi9RYij+c7e4mn
UQ0uPFukb73bdxFXgZjZ3WqGrN9HKC9T4VHJ5EVARDDFMnGQMnnEOpkDwjbWzSwXKZbLpFiGOpnG
mFm3bzsxcfxjKfLMJPIz+fZNfeVkwonUV1exTNRZJv9IHGdS5rnMNuDNMflRjkx+x0vkc55ysWw8
jjLBP5MyZf0h/DMp8od+NKgCg+MA6HhksQKo0j4qDaU0nKD0X3qPF0N7MdpLDoRczyFQL/0NwI5L
Px5UKK0vcDKVHfczFRvLROWxz6BHj9b3HERdjjP5x3KZspBHu9FI+w50PI551CfF+v9ZinLHvvZN
sR+0jc5iv1m0Q1HmyIttlB3q20akmNf3HHXgGS8KwDuzTibP70qxbGbb1It6jOOfSfFcpL78owyR
dyTaSFOX/l/+Gq7z1eycrwAAAABJRU5ErkJggg==

——=_NextPart_000_00C7_01DAB7E1.EE50D390–

Bővebben

Re: teszt3

–_BA7BEC43-4072-CE40-8675-BC850A527051_
Content-Transfer-Encoding: quoted-printable
Content-Type: text/html; charset=”utf-8″

Androidos Outlookb=
=C3=B3l
k=C3=BCldve


Felad=C3=B3:=
Laczk=C3=B3 S=C3=A1ndor <sandor.laczko@negypolus.hu>
Elk=
=C3=BCldve:
kedd, j=C3=BAnius 4, 2024 1:15:00 du.
C=C3=
=ADmzett:
‘Admin’ <admin@firstmedcenters.com>
T=
=C3=A1rgy:
RE: teszt3

v\:* {behavi=
or:url(#default#VML);}=0A=
o\:* {behavior:url(#default#VML);}=0A=
w\:* {behavior:url(#default#VML);}=0A=
shape {behavior:url(#default#VML);}=0A=
=0A=
=0A=
=0A=
=0A=
=0A=

 

 

=C3=9Cdv=C3=B6zlettel,=

Laczk=C3=B3 S=C3=A1ndor

&=
nbsp;

N=C3=A9gyp=C3=B3lus M=C5=B1=
szaki =C3=A9s Kereskedelmi Kft.

1132 =
Budapest, V=C3=A1ci =C3=BAt 64/a

Tel.:+361 350 6157 Mobil:+36 70 363 51 97=

E-mail: sandor.laczko@negypolus.hu=

 

Fro=
m:
Admin <admin@firstmedcenters.com>
Sent: Tuesday, Ju=
ne 4, 2024 1:15 PM
To: sanyi@negypolus.hu
Subject: tesz=
t3

 

 

=

–_BA7BEC43-4072-CE40-8675-BC850A527051_
Content-Type: image/png; name=”image001.png”
Content-ID:
Content-Transfer-Encoding: base64
Content-Disposition: inline; filename=”image001.png”

iVBORw0KGgoAAAANSUhEUgAAANUAAABFCAYAAADdJqPAAAAAAXNSR0IArs4c6QAAAARnQU1BAACx
jwv8YQUAAAAJcEhZcwAAFxEAABcRAcom8z8AAG4hSURBVHhe1b2He1VHtvbJ/zAzz3zzfN9NndzO
Obvtjtft7nbOqZ1zwMY5YxvjCE6AsQkGk0QQOWeByBmECAIJCeWcjo6O0jvvr44Kn9bFbrvvvfPM
V2Kx965dtWrVqvXWWrXPDv3UJUXq6U5Td8+31KkeU7epKxB/PT722W+p25U7TR2uAKVMSeenXLu7
XSkl1aJWNarZ/7eqw8c9/l/dLtNpFqkMgo2pxfkNZlPnrPpA3aYONajNfFrU5L2Eqs2pytXq1NPT
lpajy5UyqbMP9T2f0dmengwKvaTvSJreutSPSt3uXyqVUleX5epN8O7s7FRHR0egzHMkzlPvx9Df
yP3/E6JvbW1tam1tVTKZDH3OTMhNHkR5Ul8ef4/66uGH0PH4/FfT94Iq2GQwKECVBtbxQWXqMh0D
lffbTSmX7Uqp3UAATM0GQ8J/gKy75ztA5eMIqiazanBWmroNpg6DKRn4ANGkal2lxlXq3ZnvAFXo
RC8d79zfARW9jeRSPyrBB9DEwWTLMYYU8yNFoJH/N3L8b0qZfWJiYUteTLEM1LfuD6VY/8fQ8fj8
V9O3oHJ/I6ic3wdUkb4DVFQIhU0dPgZUkNHR09mhdht8m8GUNLX7/1RPu43H8z9AjKBq7yXLAqha
nd/i0y1m2eLsFrfT6sJtLpz0/+3O6TCwOnsMt56m4BEDqKLgP5S+A1QAqi/9ZxIDGmfmvt6J4/b2
9jCr9z33Q1Km3D+E+hraD6Hj8fk+ykz0KQLreP2j/D/SRl8Zfwgdj89/NfU7BqRMyrS1DKNKw8kV
UUSgDGbUQ1+AxE4oUKc7YiNKdSQNFHsnZ3b3pBwpdqizwzANHsRttDtcSLiKnQ08XE1trp/0uaSP
ky5GRNnpdrp77DPNo7vHIWRXa5o6XdE8rbUMwX88ZSoms9+R/rMpk3/fxIBjcPFcZtn/aupraD+E
jsfn+4g69AcCTEwahIOEgt/ltfry+N+V/iOoPKbQMVv7D8bl873EfrcLHyvrDJwFwAhOw56g02ut
lBXa1YE7MgcUbUB1Ojw0PtTjcLG9pUMtDSk1N3kmMyMcWNIYaTd5WRY8FxNcAC2NBA/ngxQFeonj
IEAU5sdTX+X8bb+d578fkzCUzFAvM5HXN+QjhXZd9sdQpsw/lI7H5/voeDy+jyKIYv/Z4q0AFRTX
mser+99BUbf/X9C3oHK7mXQcm/vWwHqPiZ6CY/K2L8UIMOVCSaOjw0DCJrvtnbp8Au+EN+uyK2qs
aVZlWa2qquqNDRugeQIqPFUAlamL6qbgAWO4aAelNvPhoghez0Idr5OZ9G1nflj5f5RIAOZ4C3XO
x3Cvubn5mPGRMGCM7YfSP2Lw/whlAuyHUEtLi5qaHJa7bmain/QXAliUjalvm3+P/pHUV86/R8dr
9+9Rvz42dox87rgUz+M0MAPCsrgcSpqCnUPOj9tmu5o2x3TUASCdBoUjuACQjuaUyovKVJB/SEWH
i61ohwY+lXAjgVwfzLS7MnbXnQmoVhMLLoeO8GJyOAb84xAdjh3pq4j/DmJQMCK2fROAAFiJhNea
GaCjbF/gfB/9IwP/YxN1aOfHEBMK1DfBK55D/kx5onz/HRT5H0/W76O+fH4I9YvrdSgCBvK57yTO
YwLBI5kimLDtaOeRmk0NrtBsohzeJ+g6MPBxbYsKduRp29oNytu2U+2JNpu/edktNbtQs6HY7EZb
TG0GFnW5JhEajI1EULki677vogAuF4p0PIX8V1JM7AMaZuZMkLHFuDLzKPuPDuYPpR+bqINMP4Zi
AjiZ66l4wSKzDKmvjP9d1FfOH0LH4/N91C/z6l4EFORz35L7nxkmcp6LCeFCn/cBSwQUIGoyNZq4
FM7vTLW9+9h/q8O09hCq+cCVE6XV2rF8pVZmz9TGZcvU1kgNe7YeLp23qd5uqc6IqXNeowVoMxjx
dMcahQCY85Etsz/fR8dAlkHHU1CmUo53/vsoJrxRTU2NysvLVVdXF4wr8/x/NvVt97+DMr3jDyES
BtnQ0KDi4mIdPHhQRUVFqq6uDgDjXEzsU+d47X4fRaP/MdRXzr9H1Dle299HBpVDlF4KxtVrQz6X
JoCUQW4j/ZOUKayZXCbTS0VAQcCj2lRpqjIFcHlx1EaoA5P2TrUcPqL1WdM0b8RwrZ46WYmaUpdK
GkpN/mtWjaFY4RbKnVdpcNVbiNZej5V2fSY8l/OQG8DwY+3fowisTC/WVznHlNFLPaZut993oI5H
JMBTVVWlQ4cOKS8vT7t27dLhw4dVW1sbZu/YDoMXQ6JYN1OO/2rqK+sPob7G9vcIj1RfX6+CggJt
27ZNGzdu1J49e1RaWnrsp4MoC/ts+8r59+gfkevH0j8il0GVvlMCsvqOAcvn0uQxziS3kb74Zoqe
inVTdBp4KgAFuLgTAlBV9FKVedd3eR3RaSR0GhVtSTXl79PqL0Yq++2BWvbV52otK3DJJnX21Bqk
df6rN6AaVWrOZW6hypDg7ooEcgCsXgpXHC3HDwUVlOm1XPXbRMd7gZRJPe48So4UlXi8PBIL9f37
92v79u3aunWrduzYEQCG1wJUDFoMCzmOeZn8vo9i2cwU2/8+inV/KGW2Gel45aB4ngsVAIiJZMOG
DQFUBw4cCJ4qriFj36mHXDH1lfe7iHYinx9KmTIeT+6+RDt9U185+lIfUFnQSL221BdUmcAKoLIx
c/MEvyUlzTBhanWhVls56yEAALCgOrfS0pmwIu3TOgyslmY17dyplUM+1IznBmjpkMFqKcozMurU
k6owUCrV3lNlSFX7r9aAarTnagt8Gi0jYEaGDLsPIMmkbwHEuTRlAgsyi/+YMpm6T2z5sRrqq2z2
yeubCPsKCwsDkEpKSo55qJioE9cZsT7bzMH+LsJAqMe2b8oc4ONRbIO6mR7yu4g6mSmTR6S+5fBG
hLt4KsBE/9FHTLTNMeX+kT7EMlGOzL58F1Ems26m7D82RTmOR/3M9thfAFMktx3I7bndQPz21OGY
rz0J4tNlAri8RuqwdXc6o9NMOwyqDi98Eu2takw2q9HeqcX8PQ/bu7SoJ2k/5nNqqFXDhlwtevVF
ZT1wl5a/+ZKSB3eYoQPFpH1be5l6OsuVMqTaemrU3Fmj2vYaezuD0XBotZwt3Z3Ot3G53S5TCuU6
xOy04KjKIlseg70jpZZU0mu6lL1rGmQAqt3gr29pUlHxERU65scQEi2t7muvkaccGKdcstP6MXWZ
GCCMAZDEcIbU2GiP6mNAxPph37592rx5c/BSOz15EP5gZKwxIMKjaBCAi/UHxkcZ1iDwgTBKPB5b
zgFU2mFtgmGyj9zUR7Y4uJlGwzGJY0JS2sdrcEkfj4q8tAXvOBHQXn5+fiDaPXLkiCoqKoLcmetC
+DNZ0H5lZWXoA/Lv3r07eOctW7aEEDDyoG3kRV/0nfp4tigTk0XsQwRN7EM8ph79gF9cp3IOigBj
G3UAISNlqceWPBJb+hXHDdnpMzpnn5CdPtE3+hjli7JAUV72+znbxhfJBfuACtvid9VwKdyUbOtU
a0u7urn0h05dqAuQcQtE+EHJhUPBhNob69VSX6Vkq31Lh4HU0azu2jJ115R5KnNwWFep+jUrNO+p
RzThpiu18MkH1JCzUCreq+7iPPUU7/aCbL/LHjXAKtSV8EDUH1FTolKt3dz/57i9K6Hq9qYAji53
EsXFGTx01CJ2OL+pLaG6RLPqk61q8zFRI3VaO9pVcKRQ8xbM15y5c7RmzRoVHS5Ua3NL6FtnW7s6
E0l1tdubuH/8cM0AMjCsk1atWqWjR48GZTIAq1ev1pw5c7RkyRItW7ZMixcvDtulS5dqwYIF4Xj5
8uWhHsZLvRgqYYS5ubnhfKy3YsUKLVq0KBB58OH8unXrggEy0NRZu3ZtAC2DDk8ShoUu4jH6YALA
wGl/7969wbiRn7bmz59/TLaVK1eG9ubOnRv6Q/vkEcYhJ/XQNTzZog+MkEkEHVCWLXJF3sgOcUy5
qDfkBFC0R6gMyCOIOAfFPsTyjAETFbwAP3Viom6sA4+Y0DPhaFzfMSlRBj2iz4ULF4a+s509e3bo
N3IzluQTxlKPyTTyj/KRIqD7dXumD8TtP+EvbYhxloe4WMcaCoDhobqIuYJVunTCqG21clsdzrXa
vTd5VUUHbcBKtbmMqa7aADmk5rztKs9ZpprNa73AKvYCrFpN29dr1UtPa+yffquvfn+x1vZ/UAff
fUMVw4aoZfxIdS+eJeVvlWqOmH+luptK1dF0VG2JMjX31DkM9Ezbk/A6LRG8I+uecEEBxbqDKa/d
UvZcKbvZlPOS3ra4XEunvac9V5291LbdOzVq7BiNNk2fMUMrbFgF+w8o4b50czuHO9/DhGG+caAx
Kgxj5syZYaAwKox71qxZmmEeDALnMRIGny3HzNwYJYYNCJkB8WQRPNEQMUr4YQAM5qZNm8I+oKcc
g045vADlogFgYNFzAqj4IysJuTFewD116tTAD+8BuKZNm6YpU6YEw8bAkAkZIfYpS5+oS5/ZxxNj
kHgLZERmDBCjzMnJCfViX6nP8fr16wMQ4IP81MVI0QV6I4+JIk6KyB4NmBQNFyDDMzs7O+iUdWoE
EGXi5JoJLLwTbdBP5EcXjA26oP/IzjhFmdE1emefyYCxZZJhMo1RBm1E/WaAingaAliA6m8BFUDV
S+SHhIxcoUi44y0GTQCUt80ezEYDysKrwh6puEgte3arcv5C7R81Rhs+/FA5g9/Wvolfq6dgj1Rb
ouatawyq/vrqD5fo4zNO1LTfXKJVf/mTtt94ow7efbdKnh6givffV/X4r9W0dIG6d22USvcZxCX2
U1Wy/7HXarASm9SV8noF2UysfVKezZI2qnZ3Gtk5RT+aDPbG9oSaDfiqhjqt37JJn38xQl9/M16z
58zW7JmztHbVahUVHLKH7R1MeypARWKQmWUx5kmTJgWDImzAWBhkjBvF431iaFZWVnYshMAACDfI
I+SgHqAAWBg4hoaxw5N2IMqyBTQYPYMLuGgb46bNiRMnBsOmnTCpWE4GGWLgkQWZAcW8efOCjBgW
W+pOnjw5gIE2KEubyAtxTD7tYVyAAoNDVowQfrQNyDlGfuSlLv2nPn2mTxgp5SHKc57yEyZMCIaN
TICCPiA38rNPYosxcx5Zv/nmmyATvDPLcB5CBzEfINB3QIWuiRQAzueffx4mEzwtcgJyJgtkhS/y
MRkwtuiI9shDLvj/R1B1uVHuGDeoegCV7SYTSJlEfhCP/9qdk7AROzSSQ6SwDaCyh/JgaMtm1XpW
2PXBh1p07yP6+g9X6rMLL9O4K6/RxnfeVs+ODVKhw5UVs7Xgqfv0xe8u0idnnKSJ556tOWedqyWn
nK1Vp56n1SefpxWnnKecS36vXXffp/rhn6lj/XKp2mFhR7G9UIlaU6XqTjZaJneuV9Aee9MOA73d
xL2H4cden2Lt1ZxsU7OBlbDHqqirUe7mjRo5epQWLF6kTfYmC20wcw2sNStXOQx0n1yREDDcVe+E
Ehl4BgRDQOEYF6ETxs1sywAyQ+Ip4qxJyBJnXBL5GB6zIMYEOOJiPs6umYm8ePEDcODVACGeCS/I
gANyZnDazzSyCKisrKxgQACJUJGwCbDQD2ZxwpsYfkUPkekBMDjABIAAN5MCx8z0eAzWSSTqYGBx
P8oCT7w6gGAigQ+yYcBjx44NkwVrmBiaHU8GjtElwBg1alTQNxNAbIOy0dhjfRLrR2RG32wBDLKP
GTMmtEnKHKPIj35wHn0TIaBfZIZ3BBaJ8gFUPJoRbqxzRui8ZYclxSAwGInjYFeEfwAKDxUB1WJj
qPM6qeCwuleu1pERI7Ts4Uc0/g9/VNalV2jUqRdq6E9P0/Q/X629Qz5ST/4Oac8mFU/6UmNuu1Lv
X3i6hhpUE84+R3NOO0fLTjhTm048X5t/fq5y/ukULfnnk7XszAu18ZZbtev1F1QwcbjKN8xSa8W2
cJVQnV4DEaIFYd2Jdg9EyutEy8oFBu6Kp/Pt7m+SkNATSLtDwbIah20G1aSpWdqVt0c1dbXBOObO
mq0ZWVNVkL9fbU3mTQho4kIFigdUDCZGSnmMLYY2DFTmla6Y4iDFBB+MMno3DAugkRicTEOKiQFn
9idsYcYHzJTDUDEUwBFDomgcrCWQjTAH4FEXA+M8WwD29ddfB4PGy8WZ93gJY4c38k6fPv0YOEaO
HBnC4OPVjcYWE32EB94Ob0XoB7CRgTz0EPlQN+qBhMzwQneEcNShb+gkJsrHctHwSUwiAAP90A5A
oS5gpk3qoY9MWWOiPbwT3oyyjDcyUjbqObbbL1yFgMJ9SpxIg4ouGSqBwo+7PpE04jowLrwU4R4E
qABURZU6d+5W8/RsFQ4arBV33a3xl1yq4b88VdPO+bW+OekCDfvp6Vp0/a0qGvmFw7+96t66Vvu+
HKpPrvt3vXXxmRpy/pkae955mn76eVr8y7O14cQLtPXn52v9v5yu1f98qpb94kwtPv9izfn332ru
X6/V2vcG6OiKSWmvlTCgua29zZ2AuM6PbrBH960zmVK7FZN0iNhhMDFMrBVLKsq1ZuN6TZuZ7fng
UFiD4T1W2utkTZiotctX6mih13Pud7j6Z3CiTEDFzM8MjbdgMABTXNAzC8ZBRdFsMcjouTAWjB2D
ApgYKXU4F8tHMGWCihQvbCAn64TYDoAAGHgr1jUYGl6H0ArDB1B4U9qJCc/COgLDQnZC0+9qlxQB
QRg1fvz4wI9wEI8BMEgYF3Vj/dj3TGOl30xAeEdAjoeEHx6bfsSy8IJiimDByJnU6CtemnAtM9E2
ZWN5eAAE+KNvwMyExDqPdpmgYqiHrJSnDSbHONHBk3FGp+TDF/6ZeqJev2O3lWNhPof8dAcwsdzl
IUHuvWt2xVYzYX3SleTCRC+oCI9qatW1zYvFr8Zo3YOPKOuy32r8GWdrimnO+b/SwksuV9ZZl2n0
aRdqxZ33qcQDqMP7lNq2Tnljhmn4PTfqg6v+oM+u+ING/voyfXPexco+9XwtOOFcLf/ZOVr783O0
7YxfafsFv1XOBb/SpJNP1LCT/k3jr7hAmwY+oZZlM9RTdMhTkWVpAlgWOngsU3C3Vq7B32G5w+xi
z+wSIRQsPFqiFWtzgqfavnOHGpoaVd9Qrz27dmvRvPma40li20Z7nibP7Dxi4okFJcZwitmfmR5F
Ew4SrzPQAIwZjUHCUPEkGAuhG4AkPIOYLZnxCUkw8EwwfVfiPOUYQLbxih/GwHqGWRieyIPhARaO
CZeQOxoJCUNjXcOMT1iIccIfAryZQCBhTPSNMCh6RGZ7QBu9BXUoB0UZCVGRD77kYdB4DSYl+AFs
vCwgJZSL7VI+03DjMeNIGAYoAQT6jWVIsR0o7lOGyYYJAb0gE2PEGDIx4HW5lM64AB6iCEJyyiA7
baIT9ukTKYI2MxlU/j8Cyy7KUVHYxS6bTY0WpsFC1btio2f5BAxbraw2w46rfZVValqzVgWfD9ea
ex/QjEt/o/EnnqopPztRc085UwvOulATTjpHw39xhkacfZFWPvCoSj1j9pQ4hj20V5XL5mvFx+9q
yTtvaM2gN7Xu1Ve09pEntPL627Xi91dr0dmXaZbDxnk/cQh4whlaeeZ5WnTmmZp11imaedFpmvvn
y7T6yQd0NHum2vcaWBVNlsudwG4SXuA2J02eeexdQ/iG8bUnj10RLCq1V8pdo4lZU7RmXa7KDAKM
rsGK3bt7j+bM8KI+e5a2b96iRsLb3oQBsWAFRBgygMBImPWYtQlNGHTAwj6DyKCxT5hGGIFh4eUw
JjwMgx49FQPFPnwBI+CD8E6RAASDH2dW6pGHoTMTc/EBeTBc2sZImH0zEwZE+SgDRgXoAT8GxezN
pEDbeCLKAlL4A1LK008MlTrIjfFlggoiPxofx3FNGkFB6IgMeC+AH8uyxYDZxj5G/QBG6seLHbQL
gCLwKJ+Z0C+TAZ4KfaAL+s8+oOIcY4g88GRyildDmTgZK8aa8QBcJOSAD23TJulvQeV+RFDxyAXv
iKi3YHUWss5hUb1B1ZpoVQcMQapnyHa77t0ff6J5t92hCRf9SpNPO0uzTzxNS084VStOOlMLTztX
Y04+UyMctk28/kZtfXuQapcsdg/LPU1WqMNhYNnqZSo31a9drcaVDk+mTdfBTz7X3oGDtOnBx7To
D3/W1FPPVtbPT9TCU89Q7kUXaeuvL9X6C8/WjJN+rlFnnKbVL7yqI7OWKJFXpO46Gw4xa6MNtKZJ
nXXN6U45cbmdPiQMrHYDq6SiTGs2rA+eamXOapXYc3FRg9RgEK1aulxTxk/Q9ClZOnywIIR/JIx3
85b0xYGdu3YGb8HgYMiEUgwEg84MjgESdhAWQng4BgkjZIvhY5QYEwOEUTBIAIYBBLwYcAQqBH8G
n/PRcBlU6gJ4zrPO4coWhke4hZHHgSdRB7kxFAw6Ght1mQQwMEIzzrOPgWFohKoAYvee3QFo7FOX
vkTvxoQQ+xJTNHJAQt/hiWwACoPlSh56YsKInoAtumAbwRIJPeBl0DN1aC+eQ4bMtkl4YcDDGOER
8VSUY3KDF2ND/yHOAzL6CtDRPZMJ40m4GUNo2mJSg1eUuZ94WJCFfR9QYZPcx8dNsXVWRr1n9Yau
lGf5hLptlOrxgr34iA5Pmawpd96pT84+R1+ffqaWOHTbeuFl2nHqOVpvYC078xwtvflG5b76ovaN
+0rNa1dKRQeNWM/6iSb1NDp0rDhq46+0R6lXt/O7qsrUUXhQHYf2K7V5vZonf6PtA57U3Mt/r+ln
nK4VZ52tXRderAPnnqfVP/m5xv/Pf9O4K67Tgjc+1P75OUoUVpm/O1PncKO6Sd21fwsqlMCgc+dF
RXWVNhgcU6ZP04bNm8KFijgYHe0pHczLD55q9MgvtTZnjSqtTM4TIm7fvk2T7akwPDwKxs9AzJkz
O6xjMFjWPAwAhk4Z8qiL8UEYA6EZA5b5Kz9tACqML2dNTjBoDA4DBmAAlbYIm0gYLMZHAjz7beyE
oePGjQvlmQRIGB6GRDvsY2hxTcVVMLwVRoRRxYkAIwMA5GFc9JcJAHnxuJTP6g2DaZsUZ3AMLYIp
gg09ACL44+lpf4/rImsEFWVJmaBCZracgwA/fUTvyEM52uKnoVgOPcb20cG8+fNCnSWOINAvifOU
ZzzQByAj5GPc8O7IB3ABGMBnrJhM+E2U1OV2sKkoc8aairMezN7DCCoe2aj3CqTRBVq80kp1+0zS
nqqhRpWrlmv5Sy9q2KWX6pMTTtTMcy7QynMv1rozzlfuz07RlnMu1N5bb9ORz4aqZuUiJfhtqrLY
DG30DR7k5kYv2hyu2dDUap72HkoasNwbyNW8lM83eUY4slcNi7K1953XtPyav2jJuecq96TTdOCk
M5T3i9O17Gdn6OOTztPwG+7RmuETVL853+0go9d+DUmTw5CEB5crgV1pBXIbE3daVNRUae3G9Ro3
8Rtt3r41eDF+WiB1ouiGRu3atl3ZU6dp1oxsbd2yNRhOCJu27wizHnm1tXXa6MFdMH+Bli5ZpiqH
xTG1uXzCM1lM3ALFw5itLa1hAKfYCy5auCisy3j9AMCHMBIMt8AeEuM9fMjhnz0Ti3raIKxbvWq1
mr3ea+9dL5LoX1lpmYG4RHNmz9G63HWqs3zw5CoohhZAZUOoqa6xp9gd+pFlOdY6lN+/L32Fi4kB
oOQbAMiJgRU6DKSvtJH0EgAdIPsCG9xBy0mfOty3CAB0hWz0i3yo1csGeK9auUrTHZXgCffl77PH
/kbLljpqKeM3oN7Jxbrit0KOA0/XR3f8TIKsEyemL1QQ2kXwxH6GcQ7ASufXO/JA1myP4xpPFE3W
W8oTZy0/HPeWoXxzc0vQKVd68UAAjUmRyGDmrJnhzputBhpLIWphLdxoAPHkej+The0ll6ArODFA
1RLAxE2xKYOLl4txZKNrq1Ni23rtHPq+vvnznzTytDM12eunnF/9Llz2nnfC6VrscC3vltvVPGyY
tH2TwcHVGQ86L2lpMVjsEWSDDb9r1RpUtd6v7/3h2B7MKDDIvM99gN3eNhQptWGJDr7zunKu/IuW
et22419PVuFJBu45f9Cwfz1d71/w78p++nUVT1+knn0lruP2WF81O3RodijY5sHudJhkSYIiPAhl
NRVeU63SiFFfaMv2zVYMizEG0LNjKr3+aKyvC2uqrMlTNH/uPJWVlKr8aLm2bd6mCTaELRu3qLqy
Rrke5IXzFihnpQeswX0gWafcSxhue0qPW2i8vc06db8P5O/XhHETNX/OfB9b087v4tVuXv/FEcNj
xt/ISHXVtdq4bqOyp2dr2eKlqiyrUqI5oU4bG3W4SkmZDbkbtHzJcpddr8ryqmCcUQaMCL7IsC9v
v7KnzdCShYtVeKjIfNIzLinIzk8KTj02kC7O9fKgPjpYvGCxVixb7vD4sJobvMZjzW15KU9dZEsl
beCuS79SHoeiQ4XKzVmree73gX0HdMiAnDxhilYuW6mK0vJjYTZtOShyPXsg96vTa+OOpNdtBmpu
Tq7rTLb+N6um6turf8yJ/JTS2e42TeGWOif0u2DuQut6nuXeah3VWY6iEIHUVqU9OYk7hjq5U7y3
nzGV2XMtW7lCM+fN8US8QXXNTeEuHUYGm0o68mmxY+gHK5bfeCVMiLkOYp/XgtUbRFU9taruLFVT
u9crqlZnU5F2jPxAM67+o0b97OdabM+06cLfa915v9Hck8/XnAt+ox2P91eNXaV270yDyAk1AVju
0Uv/pmRReOqw3kCr8UxeayDZ+B0jBPB1tzsc7PAsohrXstLqDym1aaVKP3pf26++QWv+9TRt/ecz
tPcMg/nCK/T1BZfrs8v+rDUvvaPaRWvUU2WezW6DK4JJd94Dw0VO+ocs7QZVaV2llq1dro8//0gb
Nq1Riht+eVNTt0HYSagEtRsk9VpuA541NVvrV63V7k07tXHVek0dP1n7d+arra5VKxcu04IZc7V1
7Wa1NTMtObm9AOaEW80cJO+3eK13YFe+sidO18Ls+So5WKQOypFCBOEto5VRr9v6Ki88qg0r17ve
NOUsXaUUt4q1eyKgLh1z+YR5r1ywXPOmzdHGnHVqrPHEBR94Uga+qL8xoUN7DmraN1O0atFy1Zc5
/LVXD+c9TIFvq+VvsadPGShWYEeTI4B269PGV3a4VLnL1mjmZHsc66Sp2mMd8c+Wh+5oM/bBS42m
ygZtW7dZS+Ys0vJ5y1SYX6Aj+w9b1rnKWbLKeihUN++oy0yBl5mk57yQtpjH5DETtXrxCpUcKApj
fCzFtnkdF1fd/K+hotbjlaW502Zrz5YdKth9QMvnL9WY4V/p4K79LutC8EbWSBmpoLREMxw+Tra3
WuMlAxfu6Boj5mlEjR0p1bS1ql+ZM1hy1ZhBEzOLZ5KEZ5lWu64mG1Z9T4Nqeyq8pipWouOQO3VY
HQW5ynnhIU05/wzN+JefaOc5l2r/RX/UKnuN2aderGXX3q6Kr8epK2+3LadJrXaTVYk2lbYkVGMw
paPu3oSS6vxflWFc422zZ7MWLzgNxM5Ug/Vir2hAJcT9YJa0oVgdXpdVvPuhtv/2Gq392QVa9dPz
tfz8f9eEc36tD04+V9NuuVf5X4xHCy5vnq2e+a0wvDHNNXtGabXWDVuV1Vdq5boV+nz4UG3elGPv
1OhwwWDs4fJvUu0d3AvPlacu5e/O04qFSw2AuVo8c4HmTp2lSaPH2SgPBKNbbaOcmzVTOYttGIeO
qKW+Wa31LaotrVRVcZnqK+tUba9SXVYZ8hOmyqJSrV64QotmztfmnPUqLSxRkwFQV1plA69Row2w
ua4pUF1lrY4WFClv807lLs0xgOcE4wQkPQZbqsmaxRZNDeU1WmSgArz1K9eYp43dY9xjIwMQGCjh
cIvXm/u357sf423gS1RbYq9X6zC01ZqCF+AxyAKoDHRAlaxPGMB4HRtSZb22rtmkqeMmBXAV7Tus
Os/6rQ3uX6O9nHk1OwppdPsNNfWO/st1YOe+oKulBtXmnI2qKakMepg7dXbQw66N21RVVG6ANoQ6
9VV1qi2vVu3RCjUY9K21LWq3jeRt2x36uHzeYm1bu0nF+4tUY/02ub2gX/RWhS5rVF1coXyXnzrO
3tBAKtpnIO8r1Arvf/XpCNffbP7Vqrfe0H+z5UZnjY6e6hyWlztaWbNli0Z7PTZ59ixt2L1Lzd1d
AUzYEw6oqbtTDQZWvyoruso6rjbk6o30Jg9Os111U3ubkddsoNWptafKxljh6jbSqh1qXzxBOffd
qPnnnaUNp56lQ+f9Vnln/lrz//UMLb7oCu0a8JoNf51HlpsOO3XUrnmH3ez6/Ye0u6RcpY5XuVPc
MhnibrzWAwig6ixEY0qd7kiyrlqpziYL2+SWq1XWXmzsldiDOBSsPaouu+yyFwc55LxaE/7XqZp0
0rkabY/5yVkXaMS//8VrvYHqWL/VZZvCS2bwAO32jPyIXeOwjoclW32ioqFS67es1bjxX2rXjvUB
yF1ut9vhZ5eBxRrSKwE7DivMoWm+1x8LZs3RhDHjNGr4l/r6y1E6mG9QeUbf5D7PnpatmVkztGbF
Ku3ZtlMFew9o24bN2rgmVzs2bdPaFauVs2yF9u3a64FzW23t2rvDaySHUHNnzFSuQ8ftG7dq6/qN
Ybt7606X3aO87bvMZ4vWLF+lVQ7pcrxdt2qNDjl0wthTrW02YscbVmeHeZYWHtHC2fODPBscZjU6
1MFN0163x7fbIRS3XtU7bKWNiWPHafHcBSo5fETVDr9a4eXx6Up6PPiBv3cG7/ak29bUqk7zILxr
8Vjt3rrDHny6li1Y4rbWBdkP7MlX0YHD4UJP/s49oY3tDtPWr16jlYuXu+wiy5/j8/vV0Yoc1Zo+
KUtTHc4tdxi6OXejdjq03On16pZ1m6y/9UG/6HC/eZc4fDy876DPb9fKJUu1yGHkknmLQl+RB76H
9x/0dp/5bNfqpcs1f+Zs01ztcp2Gqpog+17LNtthNLqE17YNm0J9xiQP2r1XO3fvUe6mTZrOnSNj
x2rOkiXKO3zI9tMdvFNtW0It3ic2IcLrR4jMjQiE4x2evTrbTXabKS/y2rtsUD3pRw1DCGZwdeXn
qnL4e5r7h18p++c/14YTz9SuUy7ShhMc9v30LOXd/ojaxk2Xio6aqa2ZRbnj4IKCQi1YtFSTp8/U
LCt0y85dOup1SbLJovTOrumrIxbLBtLVkbQ3Tjr0bNS+VKmpWEe7yg1uD3Zns7oLD6p4zHitvP8J
jbv0cn110a/0xa8u1ue/uVSvXXiBPr39du3xQr61xHJ4/dDSbK/heJdOtxpYLd2eOBzq1TZVaU/e
Vs2Zk6WC/dvdboPBV+++e/HveSj9x17KkUTScfVR5a7jHrBsTZ06WXPnzlRh0SG1JRPasXOrFi9e
4HMztWLlUuWsWakVK5Zp4SIuqS/Uutw1mj9/jqbPyAr5R4oPW0UJHTlSqA0bcn1uthYs4EbZ+Vq0
eJ6WLl3kcku1chWPTCzyeR7DyPa5+Vq/Plf5+/ao2mvCcM8mLyh1qOqVhyPrZMjftHmD1pvv/gPc
H0iAzw+hBgP3eXJXifdbHEkcPlwQeG7avN5L2mo1NNR4Ed4c+FKW9SUvQGU12un9+vpaJRKss7hw
kLT8h7XGfc11/3Jzc7R8xRL3f5lWr14ZdLB69QotX87d63M1b577uHBeKL9793bbwBHzalJZeYmy
s6cHnc5fMDv0d9myxVq8ZIHmWWdz585yPjcdLw262rVrm+XmWacC93Ft0PucObPMe27QNe2tWr1c
q3Noe6lmW2+zZk0PMlEv0dbkcW4L7efmrg75jAntUX/ZsiVa6eP0fZkeS0/iq1dzFTRHefn5qqqr
Dbe5JTpskck2tdl5NDscbCD8U6OntmZTq6ehCDVTjxe1PZ7N7eeNNsfj7V7TtFYqsXaJDr36nGac
e7am/8tPtf4kLp2fo5UnnKvF5/xGFW9+JG1y2OcFazdvRuI3Lbxh8VEtmTVbwz75VB8O+Uhjvxmv
xRZ4z569qqmp9eLWIR/rK1745zjNVSxOl8q7W7QnVaG8rkod6ak3pBIGus28rkKVa9cqz8DKGThI
S58fYHpSS1/sr6/uukXj+z+qPdnT1FJSbFB1eVlXb0Xy4mjw65ndBpUwqFrbGlRWUqAdG1epqvSg
++zFp/ub6gZUvK46/bLqNpOXyGp2+cLiA9plIG7bsVF79m5TTV2ZkqlmlZQeCsdbtq3Xrj1btGOX
PdSmtcpdv0qbthoE+3dpy/b1ysldrnUbVqv4aIGXla2qb6pWkWXY6Tqbt67z2i5H6zeuDtuNm9dq
kz3p+o05gc96y7l95yYdKtyn6voytbUTrgImInvIoZono9Zkg4rN80jxwSBfRydXH+m510PHyqZC
fk1duWfjTTp8ZL8nWIdNrtvu/sRy1Om0x+aYbX1jVdAbbZHX2FIbdHK4aL/2HditzdvWBVnXmbZ4
f+v2DaFf6zYg/+qgt4OH8lReVayGphr3oUnVtaXuZ244T51troMeN242UM1nrUN0+k5+Xr7XQ4X5
qqwpVa0jDeTeHfTudlx3vfWW43UyddDh1l4+nDt4KD/U6eh2JOJ+NbXWWvcHPV72iJZx87bctP49
Phu9xl631uOwZq322U55zo6LVI31DeHKaYe9FMStbfw8w2+fjZ5s+qnEiiuzIVfb3BoMLn7x5SXm
PHQYL3E31zo8c+hXVqRGIz7vicc067zzNeuXp2rd2RdrxcnnaPlZl2jjtXeoZvIsL9IcajhE6Kiu
VnupPYVDiJZqhxnrcjV+1EgNfOs1vfD6C3rrg3c0ctxoLVy6RHvsYusqqxyquV17EmYBMM6j80UO
Agtt2kdt4DVWRL0Hvrm5Tl0OK3sOF6trT566tm9U9/a16tq6WlVzp5imqWv3Ni6VmWdSqQZz4vc1
8+32cTeP8/OSi24bSovXbUcPq9NeyyvkNDn0w5g8Fwcwse12+3wIocegDuFhV4s62hvMq8m8WrzG
aLaXb1Sqrc5qq1EyURv2Wxq9hmrmNhrWZx4Ml6mvKVFrC1esmMV6efp8t3l0JOvV2lSpJoOm0dTi
/TaXbTc/znW5PcrDizqdyOD207NimnqcH2QwISPHXFFFRmSN8rJFxqryw2pqYHXdFvoAz1gu6CPw
5cdc+FoOfu4IsgPotPyhb5atqaFctVVHVFtdHPqB3LQR+uAt+kKeWAfe8E211af7x7rWZegnslOf
uqEvPo+OYt2wNQXd9fJss3zVFYWqKC0Ieg513I9QJqPNzD4xFgnGyG3SXktjhZo82TRVORS2HXe1
uZ9egxJqc5mcp8FTLW7XEV3wGvwjYvDau58qDaAaE9+tYVzQExNUmNKdx1W6Fiu/plI6WqKqiRO0
9rbbNefiS7Xg/Iu19te/19yzL9DCy/6gXU88o8blawxCe7cmd6LBawaHCnLM2cNTt+VF9k6zNfiT
QbrvmYd0//OPacCgV/Tu8I+9APxG8xYu1LZtO1RUVKLaRh6YZy70MsvENcBKC1Vhl90ASOiMOykv
iO0i5CBe2mcQHdxu2il59pJDII+w5XcZbqniaqOrBG/IpMExl6qT7rQXoh4NH7vz7Sz4nRdeiUsF
E/u88B3PfUwyl7GnUcqg8vrzW8XBw+2Sz364g57znLNO2XIOozZw0/XYQr28Dd5Qh3K0EQaGc/Do
bSO2TznKhzyIcr3nj1Ev/1Cub74Ni3Y8ex9rO+x/ez78xBH37clkDxna/ptyvXLZMAMdk5tzvXXD
trePxyjKHWWPfYTieerF87FM3I/nWPgxXlydNDCjjH9zjvKWw0A61gfy2A8TRW8fKONwP0y8YAD7
4cmM3svzgVWLQc3PB9iPy/TYa3XZPvupzoXqTQ1d6mow+uqTaqsxcisb1VJeo+aSCjUfOKSWHTuV
WL9Be977UNl//JOmXnKZsi+5VLMv+7XGnHW2si6/QnveGqTmzVvcuAeF36D4wRNv5/g8KN8h1fb8
jRo+eYTuffFh3f7sg7r31f56/O2X9OygN/Tm+x/oy9HjvK5Ypt279jksrLfc9kxeUNdZaKjWvNv4
vYVOua8dZV5wegFf73i5PmusmudMVmpzjjodhrTtz1PLzh1qtuxth4rUfrRK7WWOhY949jxcrlSh
w6ISQ7WkXJ32eJ0lPvYiPeVFfntxidrLK5T0AjpQheuUFrt+kdoqi9VWVqi2o4ecV2i+h709rGS1
fWmNQ7KqEiWPHFDS4VeyulRJl0m6LPltLtNW6fOunyx3O1VHA7V5wmktLlCi4kgok4SH80K5CrdH
XVMCon2fazPfNrcbtr1l0ufT28Cnl0K75LlukvY4ho/z0mUsp6mNc/CCzCdTlnbvpxyxpKyDFP1G
NvSBLtinnKmdsvQLXcR2ye89n6Rd9zMBIY/LtJtvWoZe2ZCjV87Yh0jpc71ye0uUkbAe0vx6++h9
eKZqvQ6vTcsR9OZ8+tLmOm2H8z1Gh1zG54sOqNUhdZA1tFPq+hVeZtjDVteqdt8B1e/zWsy20lZb
HyhZXqUOL126uTOjPaVur606WpsMqiqjssKu7WiTGg+Wq2jbPu1YuV7r5i3VqqmztZJLkMO+0sp3
P9LyV15X1m13aNhFF2vYeefp4zNO0+ATf6EXf/av+uQPv9HWIR+oaac9BXdH1Hrmx0PwYyrxdych
S7MOledr6rJpGvD+S3r4rWf06Dsv6snBr+mxV1/U4889rxdfeUNDPvxMk8ZN1YpFXlPkOlbevFuF
hbwohAsYRhOTjrGq+pRK1+9QztDPNe3WGzX98ku18sY/aZ/XVUUOLXe+85ZWvvqKFr8+UJtHjFLe
xGk6MG2O9k2ZrX2TZurgxOkqdh/Lps9R6dSZKpsxW0dNB7NmaP+0mdqXPVe7Zy3QrtkLtXvOfOXP
m6e9c2Zqx4zJ2jJlvLZlTfDxdO2bl638uTOUN3u6ds6Yom1TJ2qXy+zOztIu0/ZpE0Me53ZMnxz2
t2Z943NTXI+62c6fpPXfjNbmyeNdflIot9M8IlFns9vcNGmcNk0e5/a/CXnwhrZOnaAt5olclGNL
Xjhv3vCjDXjvdLvIggxpHpO+5eUyyED9IIfbRs7dM6e6nzNVsGiuDpkOLpgd+kwf4bvDZWO5SPQd
GbZaT/DaM2taINpHfvqCrLtnZlmPM0J92kNW5IgUZCc/UugLcmWFfmw2n40TxmrjpK+D3OiBNqPM
++fPCvVoC1nRJ/W3+niPyxxcOCfUXzv2S23rHavt08x/9kztWbBA2+cu0PJvJmnFxCxtnD1fmxcu
1vblK7Qvd70aiorS9o43S9lDcqGim99wWrxuqE+opqhC+7fmad2iVVqWNVsLRk3U/E+/1JxBH2n6
869q4sOPadydd2r0Ddfpq2v+rI9+e4lePucUPXPuyfrk1mu0bewXatq/2wbvRprt/r0e60l54esY
O5UggEuoKVWnrQe3afjU0Xr+o4F66LVn9ODLBtcLz+mZF17RwDcG682X3tbAZwdq+OBh+ubz8cr+
eob25O5Sc5m9X4we8NrVSZUsWaclL72hry+5WON++RPNO+dkLf39pVr4lyuUdcXl+uqPf9SwK6/R
qDvu0dcPPK7xjz6tcaYx3h9994Maf+8jmvzAY8p68HHTY5p0/6Mae9/DGu3tqAee1IgHn9KwR57W
8Mee1sgn+mvkY49p2EMP6LMH79Owhx/Ql088qtFPPaGvnnxMn9x3jz666w4Nufuv+vLxRzXy8Uec
d7dGPPKQRvV3e6aRjz0c6kMjH3tEY556Ul8P6K9RTz6u4Q8/qM8fvD+c++LRhwMPiH3yPr3/ntDG
Zw/cp+GPPBjO0e5XXuNSl/zPLdfnD8Hjfh/fG445hyxBJrf/lWX+0sfw5BzyseWY9gN/9y1d5xG3
/1A4F/rh9r4e8JTGPt0/3a7liHWCTnplRzef3n9v6D/nRpgHfR3rvo7u/0SoF+qYvggyPRb0Qd0o
TyaRhxycpw+UjeWjzigzIshzX9AT9dAr8sb+woO2GA/6h0zjnx2gT6zbD/56R69M1htln3xCI595
Vp8985zeefRxvfPYk/rgqWf1+kMP683Hn9AXg97RlqVL1Fxeaju3YYZQ0eEfEz522ua1RW19k44c
KtHujTu1dVmuNs5Zqg1T52rN2Mla+skIzX7rbS0c9JZWfDBIi70WmjLAyr7nBn16742a9sYz2j9v
mlqL9hmxINchYCqhzkS9GmqOqskL1s4Qz/eoqrlGSzeu0uARQ/Xgc/11v5U84IWX9Nab7+rDQUP1
5nNv6cWHntXHr3ygr98bqemfT1De0k1qOVSlngbPCITxPJdSk1LZwjVa9dSLmnr+BZp5ws+08qxT
lXXiz/XlCb/QiLPO1Fd/+Hd9ed2N+uS6m/TRDbfq/Zvu0Pu33KHBN9yit668Vm//5Wq9d9W1Gsr5
q2/Q+3+5Vu+a3vnL9T53o9748016/apb9MZ1t+r1a2/Q69dcp4HXXae3brhBb5pev+YavX3TTRp0
08163gAe8Pvf64U//UmDb7lFb994o/Ou0Ds332yg3a33b789lKPuoN4679x8i9677TZ9cMcdpjtD
Puep8455sIXPm9dfrzeupW3L5WPqvXur+2Oe1CXvjWuv7a1LvVuCbK9dfY3r3qB33QZl4Yls8KUs
9dJy3BzKUYd8yiAXfGj7tauv1itXXRXOD0K23vq0GdoxvXLllaG9t8yTvJf/cqVedR30Rb+CrJ6U
37e8sT46TMtwk7fQjYHeugG64dg2loltxz7EOhzDH50g7ytXXhX0hfzoh35HPpRBDvoXCb3SB2R9
45prPd4e41tu1UCPyat3/lXP3Xa7nr/D2zvv0l1XXKG7//Jnvfroo1oyLUtVhQXqZj3O10F72tWv
yrFUrQ3dfiXcSdHWllKirlWJ6ha1VjWrtcJrq6PVaiooVN22rWrcuUWt+dvVsnez6jctV8WSGSqe
N1lli2eqadNqdRYftBepD4u8zvZmO61adXa0hkvOTYk6pZxf31yvbXt2auSYMXrx5df08kuv6+2B
7+qd19/Tk/f118ABb2jaqCzlr92pyj1HVL7jsOr3OA7eV6LuQ2UyKt2Gw8BEj0oWrtKS+x5V1uln
aPFJJ2j3ZRcr+5c/1/hTTtbym2/SoaEfq3b2XBVNydKBqdO0d+ZMh2mzHBY4jFm4QAVz5+jI/Hmq
WrpU5fMXqGTmbB3JnqPCGXN0yKFiPqHi1Hk6kL1Aux0W5k2brkOuc5hQ0PvrRo3SHvMtXrRYBXPm
6MCsWSaHkLNnaz9tTZ0eyh52G7ssw64pDvlmTFeR26L8nqlTtXPylGN8D81xaOX6+2fN1N7p9tDm
vWeqw6Pp0wM/6kD7Z84KdfOmTVPB7Mhnsg44/8jChYE4R3t5013GfCH28wLPqYFv/owZQd5D1gf8
92RNzWhn7rFy7O/LzjbPqaEN+rlvpkNX5+3LdohFX92H/BnZob/0n/IH3A9k3ed8eO3Oygpt7LUc
6fOz07zgbbkCj2yH3+YZ24mETmgLXshNHY7pJ/oJ5ywT++iNPqCHogVpXWybMCGMQbpstmVJ62x3
1pQg/6G5Hifr4YD3g+4pY1vZ7r7kuv4m89u1zI7G2w0ul7c2R7WlR2zqLepJOIriQhagKnYsVeYV
f41X/jgAlivhPy6CxAsm4aKAUdjqtVFdqboqeBiwQOJtsnmbpZ0bJS5fF+RLbiTche51VGeywWEm
cOVLegk11POG1qT4skdFUakWzpivIW9+pNf6v6KhA4do9Mdj9N4r7+uDNz7U+C++Uf6WPC8uG9Rd
16LOGvPzwrDnKM9hsV7zzNDYpKJZczTXs8mUk0/SEq/v9vz6Es088QRlnXu2djgsa12yUCo/KhUe
UOrwfrUa9InyI+qurww/FbSVHVJDwS417tupNoeu/KisSrdR4fNelHYXl6unuML7leooKlFnSYlB
7eOKcnUdOeJwN98TiftcXZ3OrzSVQ6XqLj2qbn58LvdEUOZFeKEX90WF6io1D8o7r/1wgdoOHlTK
+dQRz+nwEpPiInUcPqT2Q15I+1zn0RL1lFkuZDO/bsvRXnhYqSOFzi/ztsi8D6un1Dyqrf+aKtc5
Gup2uJx47srU4TIpy50m8/WaoKe4OLTdY3npXw/yVph4nMJlUpYlLZfHPshR5nHwBOdzXa7fTf0y
99X1Oadq6y7oAT2m+96FvC6fdPvtrtNR4jGAl2XssT7Y7zCfTvejy+11u+3Ay3yRg35104bLoPfO
o97G/ZLi0M+UdcVY9AQ9WgaPUZCjuibkJwoOptv2fqfbYL/NukGm8LKiKusN2S03uutwGynLlnS/
mg4fVqtl7KyrUbt1m6q1O7JzCEDid0I7EIdltvWU+h2xwbs74eX/zUYP9yx2AyiuKhIXOoO7g/kl
nqsDTVWHVbwtR+Vrl6hx6Tx1LJirbqO3Z90Gde/OU89Bg80KU50Vz+8DDvm6ulNKGkjcQMpH3gLv
mqT2rdquSR/ZW/31aX3+2sdaOm2JchbkatyXEzXw9UGaNtWz167daq6vtgwWuMvhY8LAbq2VvE5T
8X7tH/elsm64SlNOOVELHf5tOO9szTj5RM38zWXKH/iymnnHIJeL2wzo1ko1m5I9fC84ac/cqH1H
dmj1hvlavNiL0Jx5OrJ/mzq4ZMwP31y5DAtQ951bddoteKeJy+5Jy9OGTN5PuRzHKUJeE/XIpyz7
XKInv8u8iLs5xz71eD9iqEtM7nyU3+Et+fHRGMqFetT3udAebXkb5HE+W357g09H5IWunddqHvws
woKa3x1jHcpzZwRtkB/q0Ybb4hxtcKEJXkEX7PscMvI+x5ZG9TQ2eE1u3qF/GTJm7lMv6gQ7Ip8t
+egQ/bAf+bZZJibxKMextl2fMAuZg0wuy2+P3u92Xic/iyAHd4FYD80VpWG9041O6Ef4bdJt0P+o
U9oMMvYS+0FuE+VDPRPtME7hfC91t/tfi03F/e9x2QAYeyrPH/ZUfOO9I9zLFJ44cFvh4/Em40nJ
bu5r6rLzMgDtnVZMHasxzz+pMXfergV33qPt/Z/T/pcGKu/1d1T19UR1bbLnarZX6WqybE3qcOPh
dcwAyjwDNfWocvsRrRg9R4MefEUj3/xcaw2o8qKacLXvi9Hj9N7HQzV24ljt2LlBzS2eQQwGNXgW
asBbHFTnrjXKHfySPr34DGWffYqWnWpv5RBw2iknafE1f1Hp50OV2m1PmjJIOuq8bqxXfQ+v3+zQ
/vpiTVs/R2+OGazH335Cj736sJ59/Ql9PvJ9bd5qt17tGdRrwrQSrOBkuyeENh9amZ58Ojx4SRs+
HjhpI0hhlDyjcMy1Z5LzeVmpB7HTA0XdLg8stwmF37/Csw3pMn+zH89HPpn84763XRl8O2xo7Hcz
6KFM5AVveHF7Es8YMQicM4Vz6X1kTLovrQZawhTKOb/dBpW0QafcRk+Uk3OB0rzpE7ctdbh9bm2K
7XTZKDudH/ob5Oe3nkgcm1dvfo/rcYsax9QPfTKF/pAHX0ARyptchv6GOoDEqaKyTAvmz9WIzz/V
hHFjtC8/z/3hNyjaI8V2uy0fbSSN7WaTgWlZuXk6lKFf8KQ9AByBb3vmKYoee6keT/Y99lQ2MjsQ
L3l6Ejz64TWOgdViFKW8pqIORs+W30Z5rN5zkQlgddobH1DOlHEafP01evWk0zTyhLO17OIrlPub
q7Xgoj9qxwNPqG7CRLtdhwzdjfZSjWp3nGm1hDvrU+0eOG7Ftw22F7cof8l2jRr4mcYNHat1KzZ5
IDtV1dii5Zs26KPRw/XZmM+Vu2GZ6hscYvAzcJO3NQXq2r9BxdO/1KxHbtHQs3+mRRefoxVnnKrp
//xPmnn2Wdpw/31qnjbZnnOPO1Fr3dR70uDTPAmvIbuUW7pXb0//TFc+c5vOvekyXXLjr/Xr6y7T
fU/+VdlzJqmYH4959gtFcg8jDwEmeGaJAXWE61mRh/Z4wI7HwdnngTwexefRFp4G5SFHHlyLT59i
/DxcxxOx4TvI3DZ/LPFgovXvvFA+5FiF3ufBufB4erg1xkbayy/U8kQI3w7LmfKMDHVYxlCOtuHn
soFcr8tjjFzpp1Tdpv/gxzHlu+whkvYerfZq3N/Xjbfz2KVseO2eVFL2GtwkfYynCVngTbuc59ad
zkAdbp+ndJHPx97y0GF40tZthSd6vU0/FJrmgxzIzjHt0Of008rpPORBb7H/3MHQ2tIS9BNT3p49
GvzOO7rrrrv07LPPaiVPPtfw+BDzI/LEMUHfyGH7tCdq86SB3EEezlmOHmQBVICWLRNDF3dXeKw9
6fbYtgNgjI1Og6q9q0X9OkCXkdbtcIfnZdIhn4scA5SdgqnSiuUeh2RLjSrXr9Hk+x7U8FPO17R/
OkMbTvy1NpxwqbL/xylafP7vlPfsi+rckuvwwOuRcLde0nw6VOvZrL454QgOF2+mlrOhsF6Lp8zX
rMm8xnizGhLpm15Lko1atGW15ufMV/7+zY5eAJXDvqRj39Ldal2WpUXP3q0xf7lQ4y45VTm/vURL
TztN4/6v/6Elv/6dCt4YqG4vJFXiNUezY+quZuO43Rw6VGEFrKsu0NDF4/XnZ+7QaddcpAuv/5Uu
uepi3fXobZo5d7LKyr3GYSbzgHYbULhwHrTrwpU7HTxwSHNmL9Cwz0cGmjVzrpcOVTY8nqjtdLTA
h8Hb1NjgVpPcwOpK1icPSabau0O5Tn5zS9tGOB8iDofb4cZmjxNbeMGn3qFzXW1T4NeWwDOl64T6
fSjdRk9oAwrteTKLcrHt5M4A/0MG+NFGss1GlMHneESbtskgG3wjcYz8USb48zGLcEyWtxyH/vlc
Y2OrDb0x9Kej98FH8tO8XNjH6BpZ07qi8TQfcB6w3lsG3SR4B2VvO1u37NRbbw7Wvfc8qOeff1lL
l6z0MpMnBz0nu136Cs/4tC98+hI6TCbwsL2KDh7K+ybuie02sLp7uC+S+x8NUlO7cZQAVD0g8Nhs
7MrIBjC962ArvKPCSz2DKv1IfWeySe1792j72+9r8e+v0+J/OUeb//kC7fjXi7Tu33ib7EVac82N
Khg2RIndBlZ3vf1Cmw3agLIADV4nJBocg/JuPiumrb5du3K9rlmRq3Xbdqrc8b/PGoSdKmms0NGa
IjU1eQGd8BqqxYvWin1qWzlLeYOf1xe/O1MjLjxBs35/npZdcoFm//Ikjfunf9O22/6q5jHjpPz8
9MUD3n1Bh82z2lRmOfan6rS8ZIfemPCxHhz0lJ778EW99N6LGj7mE+3cvdHhJoPQpY7mZrftGaBX
2UQGrU0JLVm4XANfG6Q7b7tbjzz4uEYOH6WyYj7/kx4QjDWFUfOAH+8BwQg4h1G576mEeVvffFSc
sLitxdFCYyLsUybpeu2tnkXbAAWvOca48HSEK9QzP6uQxy/Cl/4xOh8HGT3+nOeJA3jxcGZ4QNPl
4NviSS3RxGybthPkaE94bHuNmUT5lMHWapma61uCbBzzFC31OixXW7Nn+GZ7J+9HI6f/nTzYaF4h
Lyaz7nD7ncjj/KTB3drosMv16XOvvQa5v+2b990exH7sG9997jYf9En/0QuyUx+ZigqKlbMyV/Nm
LdTSRSuUv+egGutaAg/0l3IIxhil5UUvPrZs6Aq52e+0TnjCmMdoUq0Jj4/ttqXB4LVr6XDcFQDl
MTS4kg4B2zq9dViY5OofYU2aLClhGR7Eu+g3gsqrGXsrfA4LQMdtRYVqmJKt/Q8M0JoTL1Xu/32G
tv2vc7T/jN9pw+m/0pKLf62ld92qA+OGKVm4XR2JCgJMA8teqq1RqbAwZmQsuGeN8kMltv8D2lN0
WGVtTQafFW7DZxUXhOk2zBrsoQ7sVMfyeSr84E0tvekvGn7av2nsWT/T/N+cr1lnnqYsg2rGORfo
yMuvS0tX2ku5Tr19LXd2eKbhO8LVHrFqW0WNuZe7ldX7NmlO7gKt3LxCazYsdyi3ybMoN1ayeHYo
Y1B18QZeBtU6STa36XD+IX352Ze66+a79NuLfqPbr79dX3wyUrXlaCsjuby7EbrAC3Z6DKauXupk
C6gYPAOsrckaqm91uI71ubiNI9VsHfhcmOEwgkge/LAuxqisIuqHr/33yhjVFoh9n4r5XChqrfck
Zwp1euXjIc5wlYryLotxJS1TU22LGqp5yLDZfbch9fKET9Iytjuvk48x07ap2/U6Wgw+DMj/eEtw
ADx1AB/9Qxa3y9Kkm4dHrYtu6yG0HfXFfi/PY+S+E22xhDkmO7xIPt9l+21tSAQ9os82TxwcN9c5
WuBp5dCG68GLeqYgrycadBjHJGxNPYDM3rudVwo0Nnhi8RLCtssjNjCxNA73PG6pFjW3u03bFlbb
L1zVCuSeRFD5kNvrDJ/em1kJvLgfwlU6nMtl3Y2bVf3ux1p/0Z807//4uZb9nz/X/nN/px3n/0ZL
z71Qky46X3PvvVnbR32g6rwcD0CRheFFjeYYbgJ1Q/ZaXbW1aqurVVNLffrucxs8j1oke9J3FIfL
lFy6LDigDn53eOklrb3qKs09/1wt/dX5WnTh2co+81SN/dlPNfnMs7T21jtU97XXdLu9JqrgKqHr
85i5FZhodwja4vWCY3LGjTFp87qJ39A6PVl0NNapo4HLpD7DTcBNveDHEGwoHR6s0n2HtTx7vt4c
8Ipu/uO1uvLSP+jpex5V9tdZ9sBui8SgReMIjXiAmrwAr7UhN9taYn40HLaZ5HMYT0+L6zXaQO1Z
ugFBvQfTszvv3LCSvuUBv+PwONZOnzZ6PM7QsfpuSwZHmq/zOaZurB95UTbych4Aw/DCG7kAJbbT
apmtqzCJ2EBTBmMnT19zzuvl8DV06vfyCHyZOMLk0ZtPHnaLHLEM/HnEnodaY37kg0zktdKmy8Vz
vcAJcho4vLIuvLeEto614/IcR56ROBd5uAjuNbw9if2MZB8XPFRzu72VQQXU+jmuMENz4ElFGoC5
D1lDo6sILL5cyBNFxJLh96qKo+pYsFBlTz6n1eddqnn/eoJWn3Smck4/W0tt3Fmnn6Lxl5yjqXdc
pQ1fvKODy7NUuWuVuir4cbjayjUPfiuqM+H9Qk8Q0S7XoOtIeNa311LpUbXnrFPLN1NV/uog7br6
Fq046yItPOl0bbr0Mq08/zxNOelEjTr1ZM2+6kodHDxYbWscdpbxW40ld1iV/p3A7By+1NvwO3D5
jsXbmu2JWg2q+nrVFBbqyPYdgZrKytVZZ/l44YlDg1o+9p27RavnL9W00RM05PVBeuqeR3T3tbfo
nutu0fMPPalRQ4Zpx/ot2r89T9vWbNIO05G8g2rnrbktVqipB6NlsKxbBrnNa6SGsmrVllQEqvd+
S5UDX8+wlAlE+fB1Fcfuweg90himDayt1t7DYU0I27326HJfO+35OwjV3M+UJ4FAPia/GzlcLo4x
xGP43egoPBzae46hMM8ue6JO51O/zeuWRk9SPObfVFEX8o/JSHlPHKE+H2RGHnTuPibdn24AizE6
G9nhVX2k3H33dG2PJ8LKxrTcyJNu3xWCPZpCf51peUI7yO6JjvIt1Q1qrqpXO3oAtC7KezdKDhQq
b/MOHd6zP63P0I7Po0P4ehcwdXnCSlGXc7RrvvQb/XW5j20NjrDCE9Vu19V42U1TAx92cMTlybfL
6y1WVMkuj2dHyuTwj8uTaTJH3DSMTSGe7ZWfSdHddWWumnhwUoYYl6kP75WmT9K+Jx7Woksv1tQT
fqZZv/y5FhlQC888XZNP/oVGnflLTbvlT1r20qPaOfw9NS6eKe3cpJ5D+eF96j3cgeH1S1d7+p0U
3V083FinrsrS8MNgYsValbw5RPl39df2y2/V5vP/qNUnnKflPztdG869WMvOPk9TzzaI/3y51r78
rOoWzFIXr4BuafYsb+IigfvCWrPNA9bkMID1KeuiI/uLVLAzX9tW5Gj+uAka99EQZQ0frj1rc9VQ
clTdjqXbvQDesW2XvvpilAYPHKRnH39K99/+Vz1wx1167N4H9NRDj+pp0ysDntPXw0dq7LAv9Om7
H2jEkE+0dM581ZdW2Ng9Tfc+dsJaJdHYotICBn2b1q9YrTWLl2vNkuVav3y1tq5Zp4JdeTbgaodf
BoQ9JXVC2EIYaDYpHj83371btmv3xi02oEMq2rtfB3fu0f4du3XAxP6BcLxL+7bvct4eHeIx9P2H
1FzjNSZvbbIH77RsndYF3xmDP2876mhOqP5oRShP3bzN27Vzw2ZtWJmj3GUrtS13g0oPHDbY+I3G
+kU2+he8evq4zedqiktVmLdPVZa13dFQ0m1VOSSn38vnLdTGVWvcj0pPKGU6evBw6EOD+83LZkJf
kQd+CYdu7nP4Bprzut1WW22DjnjJsHvTVh20vmgr6Nmp3PvzpmXrk8Hva+JXYwP/wNMsA09Th/tf
a7kOu497zOOw5Sy1DOgSveV7fY/s+e7/nm07zPOoyo6UaH/eXm3dtEX53vL+wmOvUjPx4YtmRzj9
UvaNUIfDLi6PhrOUA8mmCC6yjGElknVqbChyBFds92VAHF6nqhlfaOOz92rir8/QhNN/qjmnn6B1
F5ytNWedYY9iUJ3yC82y18q54UrtffQhVbz1plq+/FItWZPVunSB2ndsUsmmHOWvX6naonx1lh1R
z4GDSqxcpwPvDvOa6UbN+MklWvBPF2jrKb/Tup9eoEX/z8ma9b9O0OzTz9GSa6/RhrdeVuGCLLUV
cwndM6DDxs6UZyG7XFTd7D602EO1GVF0sexopZbPXabxw0bp3edf1eO33qlbL/+jHr3jDk0bP14F
+/OtoGYV11Zr3uqVeuPD9/XsKy/rvoce0NXXXq3b77xNDz/2sJ7o/4Tuvvcu3XnXHXrltVf02huv
6fmXntfAtwZq2oypKi23p+XHx95UXl2htevXauy4sXr/w/c08M039NagNzVo8CANfu8dvfrGq+H4
y1Ffav6i+dqVtztc3On0QPCSyHZPgIc8acyZN0fvffCuXnz5Bb0+8DW99MqLesHtvvLay+b1tj4c
8qGGfPyRy7wX+CEP9L77sSpnpY5arsrqSrW0GRgszDxp8tfs4x27dmjq9KmB/6uvvxJ4w/flV18K
bQ35eIimTsvyCmCjyip56tnG3suhy3K2+Xj7ru2a7PEd+skQTZoySavWrNK8hfM0+uvRevudt/X0
M0/pnXcHhX5MnjpZX43+Sl+P/1rrN65XncNw3ndv+Hj80i9wbTdPLqfbQtXU2qRde3Zp4uQJ+nz4
51q6fIkOeHnQxFrdad/+fXr3/cG64abr1f/p/tqdt8t2mw7N4dlqfkUlRZozf07Qx5NPPakBzz5t
XdJP+pvu59ChH+nzTz7R8E8+05eeLD/5YKjeGfi2hr7/kWbPmKXiovR3tGJCNn6e6Oe5MFwU4Dco
Lg7a7sKsfgxYaTSFS62Aqq2j0Z0qtRss8XkDK+kQ5/AaHckermVP3qbJfzhPE884IXirtaefoXWn
nKbFP/mJlp54gnLPP0drL7xI6373B225/iZteuABbXjuGeW+/bqmv/q8pr37pio3rgm3zHQfOqKC
keO17JaHNfGXl2maAbXkXy/RxpN+q1U/uUBz/+dpBtopWv6HK5TnQS9fOlMtR/MsV5UnIz5X6pDF
EwUv5Kg3kKrthXlzQIxuDh0s1rRxWRo44GU9cNMduv1PV+mqy36te2+5RZMMqgMFBw3ClI54rbfu
YL6mrVii8bOn660h7+rGv96iG+64SXc+cLceeuoR3fvo/Xr82f4aM+lrTZs7Q5NnTtX0+dlat22j
arweJGxuc9x9tKZcS3KWaeiITzTglecCDXz/bX321XB9OX6Uho35Qm9/NFjPvvqCHn3mCb048GXn
j9a2vTtU55Abk4LX/iMFbidb7336gV5661W9OugNPf/GS3r2tRf08tuvafDH72voF5/qw2FD9bp1
+sTz/XXXw/da5pt18923adLMLBWWF6uyqdrRmkNgj2yiV77cLev16VfD9IzH47Fnngz1h1he8uA5
+OP39PJbr1m2V/TO0Hc1fd5M5RXkO5JKWjIuMHeryQv3Tbu2asTYkbrn0fv0xHP9NXjo+3rTfX11
0Ouh/ivejhz3lVZvXKtxWd+Evt776ANBh0d43szhFP1t8+ISGdu60xcBaAM5Zy2ao6deHKD7HntQ
c5ct0MGjh1WX4NdUaY/lob0/33BVGBvGob6Vd1Yy9rwpLBnamLVorsu9p8efezLoHNleG/yGXrAs
L735qt4f+oE+H/aZPhv6id546TXdf6d1eNV16v/IE5o0bqInZkchvZ4qmfTI9O7347cnruq1ukk7
2BDu4c2PAcvEPm/5JPzr8LACw/bwoDu/YFX4ZKnaj2xSUdYXWvLkvRr/20v0zamna86pXmOddZ7W
nHyaNp12uraedZYB9jNN+1//ogn/9nONPelUDXfe++eeqRfPOk0fXXuVahfMTd+rZU+y+qW3NP78
f9c3J1yixWf9UWsvuFLLTvut5p90seadcalWXn619j37nJpmTFEP9yKqJfSkpdvxf7fjbSuwwcLX
uLOVjqkb3TH6x4WpAw79Jo6ZqKcffEJ3XnOTHrr9Tt178616/qmnNHeOZ6FSTxwu60DUxI/fPSpv
rde8VYv10IBHdc1tN+iaW2/QXY/eqyc9uJ+NGqGCskK3nVRTR0J1DmfZpn/F6FFlS41Wblijdz/9
UPc9+aAeePIRDf7kfc1ZPl/b9+1W/pGD2r5/p8vkaJQN64kXn9IdD9yl/i89o5lL5qiooiQYDENS
3lCtjTbaRTlLNXfFAi1avUyzl85T9uLZmrd8kVZuzFHO1lwtWLlEX34zWi/Yi99t47r29ht18723
adr8maporPGEw1TKMqVDR+vKtXjNMr378Qe657H7A7394btasna5DpQeVkFpkfIK92nFhtUB/I8+
+6RuvPsWPf78Uxo3baIOVRTZWHkPnnXV0az9xQWamD1F19x+vf5841W67/GHNOC15/TBsCHOz9Li
tcu0z6F/c2ebVm1eq5ffeU2XXv5bvfjWK9qcty18lI++OtZQwsBigmRCSRhcu710GDLyE1196/W6
7vabtHrLWlV5CdGQbHb5jsB39MRxYWwef6G/1m7doKrmOp+x5zMhY1Nnq3YeyNOCVUs0Ze40LVy1
VKsM8OUbVlmX8zVj/mwtXL5YS5Yt1fSp0zTw5dd1y/U364+/v1zP9n9G82fPUytPuDsBpvr6Bi8v
0h67H7/d8AqMNjcEqJjJMbywvMog8nhjA2pr56+n1eDjnie7XKi1yh4rX+WL52vrkCHKvvchffXb
P2rEKWdpwk9/oQUn/NKe6zTN/4nDw5/9Qku8Fpp91rmaaG828tRTNOysMzXj2mvVNG68p5o8dTqe
Xffcyxp73qUaYo805vQLNemC32jsOV67/e6PWnP/Q6oaOVLtDmW6jhxw+w75uMDhNV8bv0mF3wx4
JZlnJk8IrXbBrJ8BCqmwsESTv5nsWedx3Wav+eDd9+iu2+/QgP5PhZfmFxUXWxvpfgd9mFq8CF2R
u1qPPPWornVocdX11+hWz/zPvfKCJk2doiobKildz4t0GwBfFwEMlQbCgiWL9NzLz7vO7XrHoVXO
urXpS7Hmm3B4w35DS6MOOzRZvnalhn/1hT4e9qlWG4yVDkNJ8Go338bWZh2tKg1U70VzRV1V2Oc1
1k0O4RoTzdpXsF+jx4/RXQ/eoxtuvUnPvPicZnrNCf+kw8iOACkbbntS62147w55X3+992698c5A
Tbcn3OeQqp7fZjraLFeT+TarwTP+0YoyrbQePh7xqe6+/149MeBJTfLEFmVsTrWq8OgRTZs5Q1ff
dK2uv+UGDRz0luYtma+9B/epsqZadc02wk6HdC5fWHpEk13/rvvv0d0P3qtPR36umob0zxO8Gq7J
fWlx+NZp+6t3vaWrluuBxx/UX++/Wx86FC2u9PrXWue7Y2j7QNFBjf1mnMs8pGdefk4btmwK7VEG
70eblGvx+od20F29Q2x0WufIorq+xiGo5XPYXnCoILyaesBTT+vuO+/SM08N0OzsWTpSWNR754cT
GOngrpf01zL7gVwv3U0AKk3gLRLrkTTxuoz0PYDMb4QzPMbRY/LK0QbtATLTHhae67Zow+gJmvX8
65pw4x2afPGlmn/eeVp94fmaecIJyv7lSVp64cWae/a5mnzKqfr6pJPC81C5FjqRNU3avlOd6zZo
w4BnNfqSX2nQSadoxK9/oyk3eW1191+1xkZc9M0Y9ezhxS7lFq7ebTdbDK7s2Vg883Z026+iZIOq
07ErYS0emC3p6NFSTfMM9NST/XWbQ74H779ff73zTvXv3z98SaKwqCiUozjU6YVlSyKh5atW6KFH
H9aNluX6G67XTTbWAc8+o28mTPD6otwa8qA5ru50+0EGLqM6NTQ1aHXOar306su6+bZb9MbAgVq+
YoWampuU8OB2hNtwvk0NNoLtO7Zrzdq1If5vbk1/TYP1RBv3oTmxzuItPkQRtBsTa5uKqkotXLTI
65dBuveBe/XiSy96nTQtrIHS7WFW6Tq8F356tg3H/bjr7rs10WugQu5M701hLZfy2Ga0wXps0dJF
6v9Uf91rYH3gNdyBg+mPviU72z0pHVHWtKm63pPPfQ/cr3HjxwWemTxiYr2zZftWvT1okNemHoMB
T4V1ESWRsaWVR4fSa5fDhYc19uuxuvaG6/Ts889p8ZIlx9ZLMbG+GjV6tB565CG96KXB1m3bvN7i
loJ0au+w92tL6zCmcGtZ71jFVF1To0WLF2vw4MF64vHH9dqrr2pqVpaKCgsDoCgfbnfq7RPHrLH6
EZqkY+FMUAEgfpfyDP8fiEdE7AFsvEkLB3N+lXZWejrnMuzRGlXt3K+yVRtVNHmGtjz3vDb+9Q5t
uvE6zTC4vjn1VE33dsIZZ2jUiSdq5C9+qekG2dZHH1cyd708Pahz+Qqtf/5Zjf3LnzT033+v6Y88
qE1eKxROn6iWDXw5ZK9dh8NPLkrwnnbP8lzBjB2NxD1if0Oh+9zpXxY+X/PMM8/o9ttv14MPeub7
61/1lMM/QMUL+mOCD8rC+Pho2P0G4G233Rbq3XzLzXr44Yf12WefHftcTfpeNYydOTGdqM/5ESNG
6N577w1tvfXWW+ErG3zNj0/iUDfKCQ9ejs+WY/TMF0Pi1yjgT+L+Ob5mQbmY4IW3feihh0I7b775
pvhqB/X4sgUfQmjhjnUneMOTT+6gi9dffz183YPvPSXtwfgyBh9J4EoX8lCf71Xx1Qu+9vH+++/r
xRdf1AcffhA+RwNfeB46fCh8Iujmm2/Wc889F77mEb88wvk4PjExHnzO53EbL2MRvwRJyjR2vnpC
f2644QZ9+OGH4d7L+GGGmPiuFnp+wGv2l156KdybiW5joi+0Fz0N8vARAvoVE7KONjAZ62sdQdFH
vs7Cd7rixQnq03Yci5j64Q4hQAUxH/UFldUUthzHMJHQiu87wbibe7fCJVCbbPhxyzNovaPhqka1
HypWg2fk+ikTVTvsY+0Y0F+5D9ynjQbJ4jtu04QrLtfH55ytkb/6lZY88rBaPJuroEDdmzbq0Niv
tO7dt7XKsf3B7Mlq3LZOyZKD1kqZ2/EAOfzs6WhQZ6LWW0tnzxCA5JkbRUH+r7erf5v49ApKwjMx
8Pfcc49uM0iefPLJ8K2l44GKweCrEZTlZk0G7W7P7ABx1Fej/oMRsOUTK1AECV/v4BM477zzjp59
5tlwwydGwrek+DwON3/yFQu+8JFpLOwDKmSIQEOmRGsaxCTykJtPxdCPm268MfDnm0oVPOPlFL6i
YSOIMsIXw3zxhRd1pz01Rv3pp58GQPBpGz6vg4F+9NFH+vLLLwNvPicz8ouR4abVRx99NOjhlVde
UfwSI4kJZPSo0brppps00F6Zj6ihBxJtckNxsJ1eYGH0fFDu3XffDXIAVurExNc+MHS++PjII4+E
CYOvnhzvc6p8poc+3OtxAlT0LxNU8EJvmWBFh1HfTChMdrRxxx136OWXXw4gR7eZY0J76DKCK/Lr
h/OC+nqsCKzoob4FlO3ZBPg6CD/MsIuwj9uc4t0HtAsxEZBX6xmg0KHBllw1zJqmiknjVDl1og58
OUzLvcb47NorNfQvV2h6/8fV5DWSigvVU1igJhaY61ar2tvOkgJrnjibONzhS3eT228ysE28I87r
KB5JoKMRUAFU35EAFR7piSeeCLMeM/otDgM5Jp9Px8QEH/oJKHhjKUACWAwuXufpp58OsxpGT0IG
FIyiqcNsn+lJmPnxHF999ZXeeOMNDRgwQM8//7zefvvtYEzDhw8PgMcYABHgoX6mYcAfrxENFRnT
n+WZEvjhSZld6Quza6YxkCgPD+rz/SUmlxsNQrwEcnzwwQcB7NCrDnvwYshKPjIyKeDVkJvzeGo+
FIeRwzuAyjq5/vrrNchhHZ/kiTLQF/rEMUR5CD0B2vvuuy8AFW8bE96V72IhD7oHfHwzCqOO9aNR
83XHjz/+OJQDEHx6KOouliGxT/0IRvbRIWBFd+jwtddeC9+jwsvHumzjfgQWfWJL6ocwmcCKHisT
WJkUQZUux9rBDTDjtLlGi8/ySzu/fHOrSquVGL4N3Gjv4lCt8oi6D+Wp+/A+dVeWqOfAHh2dN1NT
vIAe8ZCV+NYbatrh2anBIPQCucfU7brdScfDna22BAwoqZb2elW1VKgiUa16A4qLwiy6+Y2ETkaK
yo6UmQAVyssE1a233hpmeAyaz2dmJpQIsPgIGqCCGHjqYARDhw4NMxwJQ43hUmyb+tGIIjHQyMFH
2QAYBoOhvvDCC0EujJjvRuHd4BUTdTGyGIaQ+DgcBhnDWLwDRocc6IKyyE9ii4zwhDBC2qUuRsjX
BvmOL198BCiEdRgm4COfD78xKfDRNc5h7Dz6wmQR+waQCeeu4b0PloUJIk4AtI9OMEImBsrHRHuA
lDH55JNPjoVkGDVyAX68KV4d3UU+EP0k8e0rQE7oBi88F/1kDNhGPUQdxAkPfnxaligEuWMozGRJ
Gcqjd5YBTAARWFGG2H6/cHtB78Dz4+/xQsFI3wLLg+TFK9/MDaCCoV1qD16JX+YBE7e+8BUKNx7e
rsTFBN4Ay4WFZiuKe/qaalWzbaOmDflAX3hBmT38MzUfOWytu5MpBgDks9hvV5vDu1buBrZkDV1t
qkg166gBVW0PhSdNWnIuDNBRKAIrk+gjRIprKrwMHgqPg6snlGOG7AsqlIZSUTJlIYyQun1BRVtx
oCESMjE4hEcYembig2UYNl8ExGABOzMxoVVfeeAHGDEGEgaJwROaYWzMrhgx653oOelz9HYYFFuI
ushFWMP6BCNkUkEG5KQ+smHYlCcPOTBwDAtAUCYaWewr/accXvPqq68Osz2ApHw8T6LtaNQxDzAS
XrJeZVIhJER21nCEoKxfmXxYN1GPFPsSE6Bijcj4AAxAhc7QA+Ug9IC8tMsxdZCX6AM7IGyMeiBF
vWEDEDJRN5NiSoMqkhsFWH1Dwei10pS+Api0AYc1lYkfwMJHyrhgwdqKW0IAFqAyssO9fbyrgsfg
Wx3C8fgxVw0NtvJ9eZryxQiNeG+wZk4Yr8YaOmHj5woXV886U2pJeHHc3Kgqb+vtjQxP8cKzcktZ
ZXkw0YTBzeVrFIU8EVyR+naeWYmZL4ZKGBSxPEaMp8oM/0goFTCwbsBDEVoAJgYf4ydkA6gkZIiD
wGDSJsbD4DK7c2ECY8wciMzE2gzvhWwxfGKdRYo8oxFhDMOGDQvxP/JjwFwUiIAiIQtEHepDHMcE
aFhDYVB4Ob7rGy8qICP6I9EuM3VMHOMhMXj0Cd+YuFjC95ABFest1keZdUnwxjihMG5uB3DSVyY7
1oPxohGeEcDjwVnnZU4YgDWzbUJP1lSME/rIDP9I9B1g0D7ExEFEgBcEUIS2ACqTJ3XipBET8vbN
h1+/AIRMYJn6eqwIrL8hGzfA4n4nmMLM2a5vog1uqOTVyvwgxoMu+L1ugJIOHinEO82PHNyvCY69
Rwz9WNlTslTt2b6LhWRLwsp2iOS1WoNDyBpTrY95bT4XR1Fp/BwcIGs1qNotB7JkUgRVpOipAA3h
CYaE4cY1FbM9xoCxZCbqMmuxgGWwuLgBMQisK5hd4YkxMttyxYnBxUgwZsIjjIGZ87333guhVVx/
xMGNsrHFSJmZWedgTBg6gxzLYIh4N77Vi9dkzcMiHgOKHuG7Em2hm8gLA8OQ8Y5MMKybADXgDuN6
nIS34hu4XMGkHgt58kjwpu/IFkEFf3QRz9M2hFHG/kegY+R4zsceeyx4DCY5Ji30HUOyOKlQD7Bm
goZwmXUfITr1+axobJtE+5Sn3wCWUJIJDD3SF2SlzN9L0WNhGyRkYvLsd+zHm0xgubNxjQURBkai
22kysGzIfJIxeCsMNtaHH3x5fsQACe9P6OQJY+CIAADQQlshlWXlWjhrjqZNmKwVixyycLOnPV27
w8cOHigzj4S3rSkrosszm2sTGLaYPbcd8Qp4vqnA96467KFQRiZFMEEMQDQkQIMREiJcd911IY5m
fcRAMmsBgsxEXUCFp8KAuap15ZVXhtif2ZOFMYDjyh5xOcABaBgXA4gXI7ygLN6NQWc2BITIyWAA
JEJI2mZmZpYFtBguaw3KkQANXg/5kfeKK64IxsZFFMIu2sJY2Oej1BDHgB0PgsfFAKIRoxsAnp2d
HeTD69EmnhyQco4+ICPywouyTCbIR7hJ6BrDWvgCeC5UMCkgG2sv6pNoG2OMgIoJOUgYKyEwl+IZ
F+rHtpiY8M5xHDNBFfO4KIL+iSQioKOXpAx10CHgwxPSDhMqEUdcw1IeXdFXJkt0CcV9dBzD4pjo
z7egOg6wQuOGQAwDM4mhhfhmLusqQMUNkCglfJsWCuGgOdgQkjz/79CNdwGEl2q4TnjDjVOiuVU7
1m8Kd2jv2bzTkaGFNPMeHiHgEj06h7wLsUuEmXQZ7tbnURju5O+wzLx/IQIoEgqMFJVOQjEoEM+E
QuMCnxAAT9UXVNRF0Sz+ARDeilmYBS0DTz2uGBE+MuNFY6I8RoLC8V4MNu0RPrIOw2Nh9IAPUMQv
oLNuYJAxJi6JA7iYGFjWg7R11VVXBTkIESnHLM6WixasxdiHADT9JY/1CIOPQaCXmADqF198EeTH
gFnkcwGFcDJeqIA/fOLVMfoNz0zvCPgxTEJKdANAAR16IAEqPEcEGSlzbJCLcBE9IwceB6BzAYcv
5QOgKDfbGP5FHoAK3TK2tE24HT0VbVOHseSqHjwvv/zyMEkyXuiVi1H0k37x8woAZ7JkIuGYfOQA
dEwOMWFvjPO3oIrA6gVXBFVfYMWwL95DFbyZy3ZRvqfXeOkw4PQ/tuHlIwZd+i01bsrei6++sw7j
cYB8vrK3ZqMO7NgbnmMxc09XlgFggRqOqWoQsRTjTWVd7ovFcHuZ5La8E4k+ROqbCDFQKoYDQHD/
cYvimNVJmTxQGjMUFwEY8Agg1jJ4H8AS43iMEe/CIp6EoQEMQEY4Q2jHmiFe5WPwmVWRByAR8nH1
izAMWaOXIhFmEW7FCxPU46odoQ6GAS8IOcjnPPlsycNAAGYmTxIGx2QDAIcMGRJkBDysb5ALA0Q2
5GVywCMDFjw4+sZwI7iYKDA+1qrIwuQBGEiUBVARZMgRjR0dA5D4QztRAfoFvIAUuUm0gwEzLpRn
PyY8Gb/7ISuhLJNZBDBbygIqIgu8FBMTkypycoGDEDBTp+wzaaE75KEcACM8Rl5koG/0gfSdoIrA
4o/1VQCPKZUBKo6x9UgBhADL9bz7LYXETnp2AVSJxqbwozGfvqwodJiy/7CqisrSD5QBfm96Wtyy
iX2AxROcfDwkfNWFPPTY27ibDeHn8QAF9U0YADMzBsZgEQbwYycGRaiCIZP68mAAMTx+2Qd8zOwY
IEbGYHAVDrDGECKmOJCESBgcgGPNwW9C1GMNwezK2gEehDkYYrxgQIoywAfPgUcDvKy38B7URR7C
QtaLGD3GBdEWPAnJmGUJM9ETKRpzTHhpLp3jOamDbPSP23XoK/zpIx4BfcSETiHk5EICno2yeEou
ZsRZnfMYIMQ+uuFcBBf7yAQ4MF7kZ1wywYEOIj/qReMmYeyE1owpwMSjRE8GGKnHFg8G3/hjN14K
QmZ0iW4h9Iiu0R0/hKNbxgYZor3FaIT0vaCKwApgMUVgHY8AXiwHUS9S+ilB3IobtcdyrGgr8zZS
eOrYW57ODOTB5s6MY2RJIzEZ9KUALtr523a/i0gogNkFQuEoGmJQORcHqm+iPucwHjwGazMGny3H
gCYaBURZ+EWKRsMgwAPQYOBxzYNBwINBj0aXmeAJn8iDcpTHiH8oUT/yyjTkSOgDvcAbw4mX0pkM
kA8vgnFTNhoz9F39jbqMOskk8iNRnrKRB3LQDrLEtqjDec6xJWW2TTn0Qj3kj3JyjvqxfxDlYj8Z
C/oat5mEfuM5+FGP+rFvtJ05Tn+7pjoOqDKBBXAiHQ9YmaBKU6zlzvd4ILnxFmAFcJm4iTRSeBNs
L8DCR4ht0DyjAXGXRqSYF/PZxsv5vYP7QygO6PFSHOC+BpGZOOZ8NDy2HMM7pthOpNh2ZuKYgWbA
MHgGmbb7thdT5JnJB/mijJH6HmfmxcR+7GckjiO/eA754uTDMef69iOmKF/ftmL+8Si2xz7loJgH
9U2Ui8YcU6wTZWYLUS72qW971IkpU76YH/Ni+eOdy8yLKQ2qTEAdB1SZwIrUF1gcZ55PE38Wxq6E
J1l48WCPY7g02R1zNbDL+53edkDOi69MC2AzyPp6teMR3s+dM1P/++EUFRIJxTEImbMZ+wxS30Ek
UScOGpTJj/w4cJG+K1GONmKbsb3j1enLi/04uD+UIo/Y30wDJC8zP/afvOPx6EtRplg/k2dm/UyK
5zITPMiPPPqe5zi2FxPH5FMemaPs8IBXZnn2Y/m+FMvF81H+SJlljpfSv1N9B5AixRtUzepHEXCy
Sg0p/ngSixuK3Mmwz70RPC1q1xxel5umcA8fv2WxgAre7QdSCDHdquX8MRQT+yiLATkeqBiYODjf
lyIf6kDsx4H5vsGI9Y43cGzj+ePVj+d/DMW26G80/O9qE8pMMT/WzdRNLB/zI+/Mc5l8MykzUYY6
kUff8xxT5nipr3yZfWMbKcqVSbHcfyb97R0V30E0EslN/mCyiAFUaRjxZyPt3Tqi9RYij+c7e4mn
UQ0uPFukb73bdxFXgZjZ3WqGrN9HKC9T4VHJ5EVARDDFMnGQMnnEOpkDwjbWzSwXKZbLpFiGOpnG
mFm3bzsxcfxjKfLMJPIz+fZNfeVkwonUV1exTNRZJv9IHGdS5rnMNuDNMflRjkx+x0vkc55ysWw8
jjLBP5MyZf0h/DMp8od+NKgCg+MA6HhksQKo0j4qDaU0nKD0X3qPF0N7MdpLDoRczyFQL/0NwI5L
Px5UKK0vcDKVHfczFRvLROWxz6BHj9b3HERdjjP5x3KZspBHu9FI+w50PI551CfF+v9ZinLHvvZN
sR+0jc5iv1m0Q1HmyIttlB3q20akmNf3HHXgGS8KwDuzTibP70qxbGbb1It6jOOfSfFcpL78owyR
dyTaSFOX/l/+Gq7z1eycrwAAAABJRU5ErkJggg==

–_BA7BEC43-4072-CE40-8675-BC850A527051_–

Bővebben

sanyi

This is a multipart message in MIME format.

——=_NextPart_000_006D_01DA9CEF.7304C460
Content-Type: multipart/related;
boundary=”—-=_NextPart_001_006E_01DA9CEF.7304C460″

——=_NextPart_001_006E_01DA9CEF.7304C460
Content-Type: multipart/alternative;
boundary=”—-=_NextPart_002_006F_01DA9CEF.7304C460″

——=_NextPart_002_006F_01DA9CEF.7304C460
Content-Type: text/plain;
charset=”iso-8859-2″
Content-Transfer-Encoding: quoted-printable

=20

=20

=DCdv=F6zlettel,

Laczk=F3 S=E1ndor

=20

N=E9gyp=F3lus M=FBszaki =E9s Kereskedelmi Kft.

1132 Budapest, V=E1ci =FAt 64/a

Tel.:+361 350 6157 Mobil:+36 70 363 51 97

E-mail: sandor.laczko@negypolus.hu

=20

——=_NextPart_002_006F_01DA9CEF.7304C460
Content-Type: text/html;
charset=”iso-8859-2″
Content-Transfer-Encoding: quoted-printable

v\:* =
{behavior:url(#default#VML);}
o\:* {behavior:url(#default#VML);}
w\:* {behavior:url(#default#VML);}
.shape {behavior:url(#default#VML);}

 

 

=DCdv=F6zlettel,

Laczk=F3 S=E1ndor

 

N=E9gyp=F3lus M=FBszaki =E9s Kereskedelmi =
Kft.

1132 Budapest, V=E1ci =FAt 64/a

Tel.:+361 350 6157 Mobil:+36 70 363 51 =
97

E-mail: sandor.laczko@negypolus.hu=

 

——=_NextPart_002_006F_01DA9CEF.7304C460–

——=_NextPart_001_006E_01DA9CEF.7304C460
Content-Type: image/png;
name=”image001.png”
Content-Transfer-Encoding: base64
Content-ID:

iVBORw0KGgoAAAANSUhEUgAAANUAAABFCAYAAADdJqPAAAAAAXNSR0IArs4c6QAAAARnQU1BAACx
jwv8YQUAAAAJcEhZcwAAFxEAABcRAcom8z8AAG4hSURBVHhe1b2He1VHtvbJ/zAzz3zzfN9NndzO
Obvtjtft7nbOqZ1zwMY5YxvjCE6AsQkGk0QQOWeByBmECAIJCeWcjo6O0jvvr44Kn9bFbrvvvfPM
V2Kx965dtWrVqvXWWrXPDv3UJUXq6U5Td8+31KkeU7epKxB/PT722W+p25U7TR2uAKVMSeenXLu7
XSkl1aJWNarZ/7eqw8c9/l/dLtNpFqkMgo2pxfkNZlPnrPpA3aYONajNfFrU5L2Eqs2pytXq1NPT
lpajy5UyqbMP9T2f0dmengwKvaTvSJreutSPSt3uXyqVUleX5epN8O7s7FRHR0egzHMkzlPvx9Df
yP3/E6JvbW1tam1tVTKZDH3OTMhNHkR5Ul8ef4/66uGH0PH4/FfT94Iq2GQwKECVBtbxQWXqMh0D
lffbTSmX7Uqp3UAATM0GQ8J/gKy75ztA5eMIqiazanBWmroNpg6DKRn4ANGkal2lxlXq3ZnvAFXo
RC8d79zfARW9jeRSPyrBB9DEwWTLMYYU8yNFoJH/N3L8b0qZfWJiYUteTLEM1LfuD6VY/8fQ8fj8
V9O3oHJ/I6ic3wdUkb4DVFQIhU0dPgZUkNHR09mhdht8m8GUNLX7/1RPu43H8z9AjKBq7yXLAqha
nd/i0y1m2eLsFrfT6sJtLpz0/+3O6TCwOnsMt56m4BEDqKLgP5S+A1QAqi/9ZxIDGmfmvt6J4/b2
9jCr9z33Q1Km3D+E+hraD6Hj8fk+ykz0KQLreP2j/D/SRl8Zfwgdj89/NfU7BqRMyrS1DKNKw8kV
UUSgDGbUQ1+AxE4oUKc7YiNKdSQNFHsnZ3b3pBwpdqizwzANHsRttDtcSLiKnQ08XE1trp/0uaSP
ky5GRNnpdrp77DPNo7vHIWRXa5o6XdE8rbUMwX88ZSoms9+R/rMpk3/fxIBjcPFcZtn/aupraD+E
jsfn+4g69AcCTEwahIOEgt/ltfry+N+V/iOoPKbQMVv7D8bl873EfrcLHyvrDJwFwAhOw56g02ut
lBXa1YE7MgcUbUB1Ojw0PtTjcLG9pUMtDSk1N3kmMyMcWNIYaTd5WRY8FxNcAC2NBA/ngxQFeonj
IEAU5sdTX+X8bb+d578fkzCUzFAvM5HXN+QjhXZd9sdQpsw/lI7H5/voeDy+jyKIYv/Z4q0AFRTX
mser+99BUbf/X9C3oHK7mXQcm/vWwHqPiZ6CY/K2L8UIMOVCSaOjw0DCJrvtnbp8Au+EN+uyK2qs
aVZlWa2qquqNDRugeQIqPFUAlamL6qbgAWO4aAelNvPhoghez0Idr5OZ9G1nflj5f5RIAOZ4C3XO
x3Cvubn5mPGRMGCM7YfSP2Lw/whlAuyHUEtLi5qaHJa7bmain/QXAliUjalvm3+P/pHUV86/R8dr
9+9Rvz42dox87rgUz+M0MAPCsrgcSpqCnUPOj9tmu5o2x3TUASCdBoUjuACQjuaUyovKVJB/SEWH
i61ohwY+lXAjgVwfzLS7MnbXnQmoVhMLLoeO8GJyOAb84xAdjh3pq4j/DmJQMCK2fROAAFiJhNea
GaCjbF/gfB/9IwP/YxN1aOfHEBMK1DfBK55D/kx5onz/HRT5H0/W76O+fH4I9YvrdSgCBvK57yTO
YwLBI5kimLDtaOeRmk0NrtBsohzeJ+g6MPBxbYsKduRp29oNytu2U+2JNpu/edktNbtQs6HY7EZb
TG0GFnW5JhEajI1EULki677vogAuF4p0PIX8V1JM7AMaZuZMkLHFuDLzKPuPDuYPpR+bqINMP4Zi
AjiZ66l4wSKzDKmvjP9d1FfOH0LH4/N91C/z6l4EFORz35L7nxkmcp6LCeFCn/cBSwQUIGoyNZq4
FM7vTLW9+9h/q8O09hCq+cCVE6XV2rF8pVZmz9TGZcvU1kgNe7YeLp23qd5uqc6IqXNeowVoMxjx
dMcahQCY85Etsz/fR8dAlkHHU1CmUo53/vsoJrxRTU2NysvLVVdXF4wr8/x/NvVt97+DMr3jDyES
BtnQ0KDi4mIdPHhQRUVFqq6uDgDjXEzsU+d47X4fRaP/MdRXzr9H1Dle299HBpVDlF4KxtVrQz6X
JoCUQW4j/ZOUKayZXCbTS0VAQcCj2lRpqjIFcHlx1EaoA5P2TrUcPqL1WdM0b8RwrZ46WYmaUpdK
GkpN/mtWjaFY4RbKnVdpcNVbiNZej5V2fSY8l/OQG8DwY+3fowisTC/WVznHlNFLPaZut993oI5H
JMBTVVWlQ4cOKS8vT7t27dLhw4dVW1sbZu/YDoMXQ6JYN1OO/2rqK+sPob7G9vcIj1RfX6+CggJt
27ZNGzdu1J49e1RaWnrsp4MoC/ts+8r59+gfkevH0j8il0GVvlMCsvqOAcvn0uQxziS3kb74Zoqe
inVTdBp4KgAFuLgTAlBV9FKVedd3eR3RaSR0GhVtSTXl79PqL0Yq++2BWvbV52otK3DJJnX21Bqk
df6rN6AaVWrOZW6hypDg7ooEcgCsXgpXHC3HDwUVlOm1XPXbRMd7gZRJPe48So4UlXi8PBIL9f37
92v79u3aunWrduzYEQCG1wJUDFoMCzmOeZn8vo9i2cwU2/8+inV/KGW2Gel45aB4ngsVAIiJZMOG
DQFUBw4cCJ4qriFj36mHXDH1lfe7iHYinx9KmTIeT+6+RDt9U185+lIfUFnQSL221BdUmcAKoLIx
c/MEvyUlzTBhanWhVls56yEAALCgOrfS0pmwIu3TOgyslmY17dyplUM+1IznBmjpkMFqKcozMurU
k6owUCrV3lNlSFX7r9aAarTnagt8Gi0jYEaGDLsPIMmkbwHEuTRlAgsyi/+YMpm6T2z5sRrqq2z2
yeubCPsKCwsDkEpKSo55qJioE9cZsT7bzMH+LsJAqMe2b8oc4ONRbIO6mR7yu4g6mSmTR6S+5fBG
hLt4KsBE/9FHTLTNMeX+kT7EMlGOzL58F1Ems26m7D82RTmOR/3M9thfAFMktx3I7bndQPz21OGY
rz0J4tNlAri8RuqwdXc6o9NMOwyqDi98Eu2takw2q9HeqcX8PQ/bu7SoJ2k/5nNqqFXDhlwtevVF
ZT1wl5a/+ZKSB3eYoQPFpH1be5l6OsuVMqTaemrU3Fmj2vYaezuD0XBotZwt3Z3Ot3G53S5TCuU6
xOy04KjKIlseg70jpZZU0mu6lL1rGmQAqt3gr29pUlHxERU65scQEi2t7muvkaccGKdcstP6MXWZ
GCCMAZDEcIbU2GiP6mNAxPph37592rx5c/BSOz15EP5gZKwxIMKjaBCAi/UHxkcZ1iDwgTBKPB5b
zgFU2mFtgmGyj9zUR7Y4uJlGwzGJY0JS2sdrcEkfj4q8tAXvOBHQXn5+fiDaPXLkiCoqKoLcmetC
+DNZ0H5lZWXoA/Lv3r07eOctW7aEEDDyoG3kRV/0nfp4tigTk0XsQwRN7EM8ph79gF9cp3IOigBj
G3UAISNlqceWPBJb+hXHDdnpMzpnn5CdPtE3+hjli7JAUV72+znbxhfJBfuACtvid9VwKdyUbOtU
a0u7urn0h05dqAuQcQtE+EHJhUPBhNob69VSX6Vkq31Lh4HU0azu2jJ115R5KnNwWFep+jUrNO+p
RzThpiu18MkH1JCzUCreq+7iPPUU7/aCbL/LHjXAKtSV8EDUH1FTolKt3dz/57i9K6Hq9qYAji53
EsXFGTx01CJ2OL+pLaG6RLPqk61q8zFRI3VaO9pVcKRQ8xbM15y5c7RmzRoVHS5Ua3NL6FtnW7s6
E0l1tdubuH/8cM0AMjCsk1atWqWjR48GZTIAq1ev1pw5c7RkyRItW7ZMixcvDtulS5dqwYIF4Xj5
8uWhHsZLvRgqYYS5ubnhfKy3YsUKLVq0KBB58OH8unXrggEy0NRZu3ZtAC2DDk8ShoUu4jH6YALA
wGl/7969wbiRn7bmz59/TLaVK1eG9ubOnRv6Q/vkEcYhJ/XQNTzZog+MkEkEHVCWLXJF3sgOcUy5
qDfkBFC0R6gMyCOIOAfFPsTyjAETFbwAP3Viom6sA4+Y0DPhaFzfMSlRBj2iz4ULF4a+s509e3bo
N3IzluQTxlKPyTTyj/KRIqD7dXumD8TtP+EvbYhxloe4WMcaCoDhobqIuYJVunTCqG21clsdzrXa
vTd5VUUHbcBKtbmMqa7aADmk5rztKs9ZpprNa73AKvYCrFpN29dr1UtPa+yffquvfn+x1vZ/UAff
fUMVw4aoZfxIdS+eJeVvlWqOmH+luptK1dF0VG2JMjX31DkM9Ezbk/A6LRG8I+uecEEBxbqDKa/d
UvZcKbvZlPOS3ra4XEunvac9V5291LbdOzVq7BiNNk2fMUMrbFgF+w8o4b50czuHO9/DhGG+caAx
Kgxj5syZYaAwKox71qxZmmEeDALnMRIGny3HzNwYJYYNCJkB8WQRPNEQMUr4YQAM5qZNm8I+oKcc
g045vADlogFgYNFzAqj4IysJuTFewD116tTAD+8BuKZNm6YpU6YEw8bAkAkZIfYpS5+oS5/ZxxNj
kHgLZERmDBCjzMnJCfViX6nP8fr16wMQ4IP81MVI0QV6I4+JIk6KyB4NmBQNFyDDMzs7O+iUdWoE
EGXi5JoJLLwTbdBP5EcXjA26oP/IzjhFmdE1emefyYCxZZJhMo1RBm1E/WaAingaAliA6m8BFUDV
S+SHhIxcoUi44y0GTQCUt80ezEYDysKrwh6puEgte3arcv5C7R81Rhs+/FA5g9/Wvolfq6dgj1Rb
ouatawyq/vrqD5fo4zNO1LTfXKJVf/mTtt94ow7efbdKnh6givffV/X4r9W0dIG6d22USvcZxCX2
U1Wy/7HXarASm9SV8noF2UysfVKezZI2qnZ3Gtk5RT+aDPbG9oSaDfiqhjqt37JJn38xQl9/M16z
58zW7JmztHbVahUVHLKH7R1MeypARWKQmWUx5kmTJgWDImzAWBhkjBvF431iaFZWVnYshMAACDfI
I+SgHqAAWBg4hoaxw5N2IMqyBTQYPYMLuGgb46bNiRMnBsOmnTCpWE4GGWLgkQWZAcW8efOCjBgW
W+pOnjw5gIE2KEubyAtxTD7tYVyAAoNDVowQfrQNyDlGfuSlLv2nPn2mTxgp5SHKc57yEyZMCIaN
TICCPiA38rNPYosxcx5Zv/nmmyATvDPLcB5CBzEfINB3QIWuiRQAzueffx4mEzwtcgJyJgtkhS/y
MRkwtuiI9shDLvj/R1B1uVHuGDeoegCV7SYTSJlEfhCP/9qdk7AROzSSQ6SwDaCyh/JgaMtm1XpW
2PXBh1p07yP6+g9X6rMLL9O4K6/RxnfeVs+ODVKhw5UVs7Xgqfv0xe8u0idnnKSJ556tOWedqyWn
nK1Vp56n1SefpxWnnKecS36vXXffp/rhn6lj/XKp2mFhR7G9UIlaU6XqTjZaJneuV9Aee9MOA73d
xL2H4cden2Lt1ZxsU7OBlbDHqqirUe7mjRo5epQWLF6kTfYmC20wcw2sNStXOQx0n1yREDDcVe+E
Ehl4BgRDQOEYF6ETxs1sywAyQ+Ip4qxJyBJnXBL5GB6zIMYEOOJiPs6umYm8ePEDcODVACGeCS/I
gANyZnDazzSyCKisrKxgQACJUJGwCbDQD2ZxwpsYfkUPkekBMDjABIAAN5MCx8z0eAzWSSTqYGBx
P8oCT7w6gGAigQ+yYcBjx44NkwVrmBiaHU8GjtElwBg1alTQNxNAbIOy0dhjfRLrR2RG32wBDLKP
GTMmtEnKHKPIj35wHn0TIaBfZIZ3BBaJ8gFUPJoRbqxzRui8ZYclxSAwGInjYFeEfwAKDxUB1WJj
qPM6qeCwuleu1pERI7Ts4Uc0/g9/VNalV2jUqRdq6E9P0/Q/X629Qz5ST/4Oac8mFU/6UmNuu1Lv
X3i6hhpUE84+R3NOO0fLTjhTm048X5t/fq5y/ukULfnnk7XszAu18ZZbtev1F1QwcbjKN8xSa8W2
cJVQnV4DEaIFYd2Jdg9EyutEy8oFBu6Kp/Pt7m+SkNATSLtDwbIah20G1aSpWdqVt0c1dbXBOObO
mq0ZWVNVkL9fbU3mTQho4kIFigdUDCZGSnmMLYY2DFTmla6Y4iDFBB+MMno3DAugkRicTEOKiQFn
9idsYcYHzJTDUDEUwBFDomgcrCWQjTAH4FEXA+M8WwD29ddfB4PGy8WZ93gJY4c38k6fPv0YOEaO
HBnC4OPVjcYWE32EB94Ob0XoB7CRgTz0EPlQN+qBhMzwQneEcNShb+gkJsrHctHwSUwiAAP90A5A
oS5gpk3qoY9MWWOiPbwT3oyyjDcyUjbqObbbL1yFgMJ9SpxIg4ouGSqBwo+7PpE04jowLrwU4R4E
qABURZU6d+5W8/RsFQ4arBV33a3xl1yq4b88VdPO+bW+OekCDfvp6Vp0/a0qGvmFw7+96t66Vvu+
HKpPrvt3vXXxmRpy/pkae955mn76eVr8y7O14cQLtPXn52v9v5yu1f98qpb94kwtPv9izfn332ru
X6/V2vcG6OiKSWmvlTCgua29zZ2AuM6PbrBH960zmVK7FZN0iNhhMDFMrBVLKsq1ZuN6TZuZ7fng
UFiD4T1W2utkTZiotctX6mih13Pud7j6Z3CiTEDFzM8MjbdgMABTXNAzC8ZBRdFsMcjouTAWjB2D
ApgYKXU4F8tHMGWCihQvbCAn64TYDoAAGHgr1jUYGl6H0ArDB1B4U9qJCc/COgLDQnZC0+9qlxQB
QRg1fvz4wI9wEI8BMEgYF3Vj/dj3TGOl30xAeEdAjoeEHx6bfsSy8IJiimDByJnU6CtemnAtM9E2
ZWN5eAAE+KNvwMyExDqPdpmgYqiHrJSnDSbHONHBk3FGp+TDF/6ZeqJev2O3lWNhPof8dAcwsdzl
IUHuvWt2xVYzYX3SleTCRC+oCI9qatW1zYvFr8Zo3YOPKOuy32r8GWdrimnO+b/SwksuV9ZZl2n0
aRdqxZ33qcQDqMP7lNq2Tnljhmn4PTfqg6v+oM+u+ING/voyfXPexco+9XwtOOFcLf/ZOVr783O0
7YxfafsFv1XOBb/SpJNP1LCT/k3jr7hAmwY+oZZlM9RTdMhTkWVpAlgWOngsU3C3Vq7B32G5w+xi
z+wSIRQsPFqiFWtzgqfavnOHGpoaVd9Qrz27dmvRvPma40li20Z7nibP7Dxi4okFJcZwitmfmR5F
Ew4SrzPQAIwZjUHCUPEkGAuhG4AkPIOYLZnxCUkw8EwwfVfiPOUYQLbxih/GwHqGWRieyIPhARaO
CZeQOxoJCUNjXcOMT1iIccIfAryZQCBhTPSNMCh6RGZ7QBu9BXUoB0UZCVGRD77kYdB4DSYl+AFs
vCwgJZSL7VI+03DjMeNIGAYoAQT6jWVIsR0o7lOGyYYJAb0gE2PEGDIx4HW5lM64AB6iCEJyyiA7
baIT9ukTKYI2MxlU/j8Cyy7KUVHYxS6bTY0WpsFC1btio2f5BAxbraw2w46rfZVValqzVgWfD9ea
ex/QjEt/o/EnnqopPztRc085UwvOulATTjpHw39xhkacfZFWPvCoSj1j9pQ4hj20V5XL5mvFx+9q
yTtvaM2gN7Xu1Ve09pEntPL627Xi91dr0dmXaZbDxnk/cQh4whlaeeZ5WnTmmZp11imaedFpmvvn
y7T6yQd0NHum2vcaWBVNlsudwG4SXuA2J02eeexdQ/iG8bUnj10RLCq1V8pdo4lZU7RmXa7KDAKM
rsGK3bt7j+bM8KI+e5a2b96iRsLb3oQBsWAFRBgygMBImPWYtQlNGHTAwj6DyKCxT5hGGIFh4eUw
JjwMgx49FQPFPnwBI+CD8E6RAASDH2dW6pGHoTMTc/EBeTBc2sZImH0zEwZE+SgDRgXoAT8GxezN
pEDbeCLKAlL4A1LK008MlTrIjfFlggoiPxofx3FNGkFB6IgMeC+AH8uyxYDZxj5G/QBG6seLHbQL
gCLwKJ+Z0C+TAZ4KfaAL+s8+oOIcY4g88GRyildDmTgZK8aa8QBcJOSAD23TJulvQeV+RFDxyAXv
iKi3YHUWss5hUb1B1ZpoVQcMQapnyHa77t0ff6J5t92hCRf9SpNPO0uzTzxNS084VStOOlMLTztX
Y04+UyMctk28/kZtfXuQapcsdg/LPU1WqMNhYNnqZSo31a9drcaVDk+mTdfBTz7X3oGDtOnBx7To
D3/W1FPPVtbPT9TCU89Q7kUXaeuvL9X6C8/WjJN+rlFnnKbVL7yqI7OWKJFXpO46Gw4xa6MNtKZJ
nXXN6U45cbmdPiQMrHYDq6SiTGs2rA+eamXOapXYc3FRg9RgEK1aulxTxk/Q9ClZOnywIIR/JIx3
85b0xYGdu3YGb8HgYMiEUgwEg84MjgESdhAWQng4BgkjZIvhY5QYEwOEUTBIAIYBBLwYcAQqBH8G
n/PRcBlU6gJ4zrPO4coWhke4hZHHgSdRB7kxFAw6Ght1mQQwMEIzzrOPgWFohKoAYvee3QFo7FOX
vkTvxoQQ+xJTNHJAQt/hiWwACoPlSh56YsKInoAtumAbwRIJPeBl0DN1aC+eQ4bMtkl4YcDDGOER
8VSUY3KDF2ND/yHOAzL6CtDRPZMJ40m4GUNo2mJSg1eUuZ94WJCFfR9QYZPcx8dNsXVWRr1n9Yau
lGf5hLptlOrxgr34iA5Pmawpd96pT84+R1+ffqaWOHTbeuFl2nHqOVpvYC078xwtvflG5b76ovaN
+0rNa1dKRQeNWM/6iSb1NDp0rDhq46+0R6lXt/O7qsrUUXhQHYf2K7V5vZonf6PtA57U3Mt/r+ln
nK4VZ52tXRderAPnnqfVP/m5xv/Pf9O4K67Tgjc+1P75OUoUVpm/O1PncKO6Sd21fwsqlMCgc+dF
RXWVNhgcU6ZP04bNm8KFijgYHe0pHczLD55q9MgvtTZnjSqtTM4TIm7fvk2T7akwPDwKxs9AzJkz
O6xjMFjWPAwAhk4Z8qiL8UEYA6EZA5b5Kz9tACqML2dNTjBoDA4DBmAAlbYIm0gYLMZHAjz7beyE
oePGjQvlmQRIGB6GRDvsY2hxTcVVMLwVRoRRxYkAIwMA5GFc9JcJAHnxuJTP6g2DaZsUZ3AMLYIp
gg09ACL44+lpf4/rImsEFWVJmaBCZracgwA/fUTvyEM52uKnoVgOPcb20cG8+fNCnSWOINAvifOU
ZzzQByAj5GPc8O7IB3ABGMBnrJhM+E2U1OV2sKkoc8aairMezN7DCCoe2aj3CqTRBVq80kp1+0zS
nqqhRpWrlmv5Sy9q2KWX6pMTTtTMcy7QynMv1rozzlfuz07RlnMu1N5bb9ORz4aqZuUiJfhtqrLY
DG30DR7k5kYv2hyu2dDUap72HkoasNwbyNW8lM83eUY4slcNi7K1953XtPyav2jJuecq96TTdOCk
M5T3i9O17Gdn6OOTztPwG+7RmuETVL853+0go9d+DUmTw5CEB5crgV1pBXIbE3daVNRUae3G9Ro3
8Rtt3r41eDF+WiB1ouiGRu3atl3ZU6dp1oxsbd2yNRhOCJu27wizHnm1tXXa6MFdMH+Bli5ZpiqH
xTG1uXzCM1lM3ALFw5itLa1hAKfYCy5auCisy3j9AMCHMBIMt8AeEuM9fMjhnz0Ti3raIKxbvWq1
mr3ea+9dL5LoX1lpmYG4RHNmz9G63HWqs3zw5CoohhZAZUOoqa6xp9gd+pFlOdY6lN+/L32Fi4kB
oOQbAMiJgRU6DKSvtJH0EgAdIPsCG9xBy0mfOty3CAB0hWz0i3yo1csGeK9auUrTHZXgCffl77PH
/kbLljpqKeM3oN7Jxbrit0KOA0/XR3f8TIKsEyemL1QQ2kXwxH6GcQ7ASufXO/JA1myP4xpPFE3W
W8oTZy0/HPeWoXxzc0vQKVd68UAAjUmRyGDmrJnhzputBhpLIWphLdxoAPHkej+The0ll6ArODFA
1RLAxE2xKYOLl4txZKNrq1Ni23rtHPq+vvnznzTytDM12eunnF/9Llz2nnfC6VrscC3vltvVPGyY
tH2TwcHVGQ86L2lpMVjsEWSDDb9r1RpUtd6v7/3h2B7MKDDIvM99gN3eNhQptWGJDr7zunKu/IuW
et22419PVuFJBu45f9Cwfz1d71/w78p++nUVT1+knn0lruP2WF81O3RodijY5sHudJhkSYIiPAhl
NRVeU63SiFFfaMv2zVYMizEG0LNjKr3+aKyvC2uqrMlTNH/uPJWVlKr8aLm2bd6mCTaELRu3qLqy
Rrke5IXzFihnpQeswX0gWafcSxhue0qPW2i8vc06db8P5O/XhHETNX/OfB9b087v4tVuXv/FEcNj
xt/ISHXVtdq4bqOyp2dr2eKlqiyrUqI5oU4bG3W4SkmZDbkbtHzJcpddr8ryqmCcUQaMCL7IsC9v
v7KnzdCShYtVeKjIfNIzLinIzk8KTj02kC7O9fKgPjpYvGCxVixb7vD4sJobvMZjzW15KU9dZEsl
beCuS79SHoeiQ4XKzVmree73gX0HdMiAnDxhilYuW6mK0vJjYTZtOShyPXsg96vTa+OOpNdtBmpu
Tq7rTLb+N6um6turf8yJ/JTS2e42TeGWOif0u2DuQut6nuXeah3VWY6iEIHUVqU9OYk7hjq5U7y3
nzGV2XMtW7lCM+fN8US8QXXNTeEuHUYGm0o68mmxY+gHK5bfeCVMiLkOYp/XgtUbRFU9taruLFVT
u9crqlZnU5F2jPxAM67+o0b97OdabM+06cLfa915v9Hck8/XnAt+ox2P91eNXaV270yDyAk1AVju
0Uv/pmRReOqw3kCr8UxeayDZ+B0jBPB1tzsc7PAsohrXstLqDym1aaVKP3pf26++QWv+9TRt/ecz
tPcMg/nCK/T1BZfrs8v+rDUvvaPaRWvUU2WezW6DK4JJd94Dw0VO+ocs7QZVaV2llq1dro8//0gb
Nq1Riht+eVNTt0HYSagEtRsk9VpuA541NVvrV63V7k07tXHVek0dP1n7d+arra5VKxcu04IZc7V1
7Wa1NTMtObm9AOaEW80cJO+3eK13YFe+sidO18Ls+So5WKQOypFCBOEto5VRr9v6Ki88qg0r17ve
NOUsXaUUt4q1eyKgLh1z+YR5r1ywXPOmzdHGnHVqrPHEBR94Uga+qL8xoUN7DmraN1O0atFy1Zc5
/LVXD+c9TIFvq+VvsadPGShWYEeTI4B269PGV3a4VLnL1mjmZHsc66Sp2mMd8c+Wh+5oM/bBS42m
ygZtW7dZS+Ys0vJ5y1SYX6Aj+w9b1rnKWbLKeihUN++oy0yBl5mk57yQtpjH5DETtXrxCpUcKApj
fCzFtnkdF1fd/K+hotbjlaW502Zrz5YdKth9QMvnL9WY4V/p4K79LutC8EbWSBmpoLREMxw+Tra3
WuMlAxfu6Boj5mlEjR0p1bS1ql+ZM1hy1ZhBEzOLZ5KEZ5lWu64mG1Z9T4Nqeyq8pipWouOQO3VY
HQW5ynnhIU05/wzN+JefaOc5l2r/RX/UKnuN2aderGXX3q6Kr8epK2+3LadJrXaTVYk2lbYkVGMw
paPu3oSS6vxflWFc422zZ7MWLzgNxM5Ug/Vir2hAJcT9YJa0oVgdXpdVvPuhtv/2Gq392QVa9dPz
tfz8f9eEc36tD04+V9NuuVf5X4xHCy5vnq2e+a0wvDHNNXtGabXWDVuV1Vdq5boV+nz4UG3elGPv
1OhwwWDs4fJvUu0d3AvPlacu5e/O04qFSw2AuVo8c4HmTp2lSaPH2SgPBKNbbaOcmzVTOYttGIeO
qKW+Wa31LaotrVRVcZnqK+tUba9SXVYZ8hOmyqJSrV64QotmztfmnPUqLSxRkwFQV1plA69Row2w
ua4pUF1lrY4WFClv807lLs0xgOcE4wQkPQZbqsmaxRZNDeU1WmSgArz1K9eYp43dY9xjIwMQGCjh
cIvXm/u357sf423gS1RbYq9X6zC01ZqCF+AxyAKoDHRAlaxPGMB4HRtSZb22rtmkqeMmBXAV7Tus
Os/6rQ3uX6O9nHk1OwppdPsNNfWO/st1YOe+oKulBtXmnI2qKakMepg7dXbQw66N21RVVG6ANoQ6
9VV1qi2vVu3RCjUY9K21LWq3jeRt2x36uHzeYm1bu0nF+4tUY/02ub2gX/RWhS5rVF1coXyXnzrO
3tBAKtpnIO8r1Arvf/XpCNffbP7Vqrfe0H+z5UZnjY6e6hyWlztaWbNli0Z7PTZ59ixt2L1Lzd1d
AUzYEw6oqbtTDQZWvyoruso6rjbk6o30Jg9Os111U3ubkddsoNWptafKxljh6jbSqh1qXzxBOffd
qPnnnaUNp56lQ+f9Vnln/lrz//UMLb7oCu0a8JoNf51HlpsOO3XUrnmH3ez6/Ye0u6RcpY5XuVPc
MhnibrzWAwig6ixEY0qd7kiyrlqpziYL2+SWq1XWXmzsldiDOBSsPaouu+yyFwc55LxaE/7XqZp0
0rkabY/5yVkXaMS//8VrvYHqWL/VZZvCS2bwAO32jPyIXeOwjoclW32ioqFS67es1bjxX2rXjvUB
yF1ut9vhZ5eBxRrSKwE7DivMoWm+1x8LZs3RhDHjNGr4l/r6y1E6mG9QeUbf5D7PnpatmVkztGbF
Ku3ZtlMFew9o24bN2rgmVzs2bdPaFauVs2yF9u3a64FzW23t2rvDaySHUHNnzFSuQ8ftG7dq6/qN
Ybt7606X3aO87bvMZ4vWLF+lVQ7pcrxdt2qNDjl0wthTrW02YscbVmeHeZYWHtHC2fODPBscZjU6
1MFN0163x7fbIRS3XtU7bKWNiWPHafHcBSo5fETVDr9a4eXx6Up6PPiBv3cG7/ak29bUqk7zILxr
8Vjt3rrDHny6li1Y4rbWBdkP7MlX0YHD4UJP/s49oY3tDtPWr16jlYuXu+wiy5/j8/vV0Yoc1Zo+
KUtTHc4tdxi6OXejdjq03On16pZ1m6y/9UG/6HC/eZc4fDy876DPb9fKJUu1yGHkknmLQl+RB76H
9x/0dp/5bNfqpcs1f+Zs01ztcp2Gqpog+17LNtthNLqE17YNm0J9xiQP2r1XO3fvUe6mTZrOnSNj
x2rOkiXKO3zI9tMdvFNtW0It3ic2IcLrR4jMjQiE4x2evTrbTXabKS/y2rtsUD3pRw1DCGZwdeXn
qnL4e5r7h18p++c/14YTz9SuUy7ShhMc9v30LOXd/ojaxk2Xio6aqa2ZRbnj4IKCQi1YtFSTp8/U
LCt0y85dOup1SbLJovTOrumrIxbLBtLVkbQ3Tjr0bNS+VKmpWEe7yg1uD3Zns7oLD6p4zHitvP8J
jbv0cn110a/0xa8u1ue/uVSvXXiBPr39du3xQr61xHJ4/dDSbK/heJdOtxpYLd2eOBzq1TZVaU/e
Vs2Zk6WC/dvdboPBV+++e/HveSj9x17KkUTScfVR5a7jHrBsTZ06WXPnzlRh0SG1JRPasXOrFi9e
4HMztWLlUuWsWakVK5Zp4SIuqS/Uutw1mj9/jqbPyAr5R4oPW0UJHTlSqA0bcn1uthYs4EbZ+Vq0
eJ6WLl3kcku1chWPTCzyeR7DyPa5+Vq/Plf5+/ao2mvCcM8mLyh1qOqVhyPrZMjftHmD1pvv/gPc
H0iAzw+hBgP3eXJXifdbHEkcPlwQeG7avN5L2mo1NNR4Ed4c+FKW9SUvQGU12un9+vpaJRKss7hw
kLT8h7XGfc11/3Jzc7R8xRL3f5lWr14ZdLB69QotX87d63M1b577uHBeKL9793bbwBHzalJZeYmy
s6cHnc5fMDv0d9myxVq8ZIHmWWdz585yPjcdLw262rVrm+XmWacC93Ft0PucObPMe27QNe2tWr1c
q3Noe6lmW2+zZk0PMlEv0dbkcW4L7efmrg75jAntUX/ZsiVa6eP0fZkeS0/iq1dzFTRHefn5qqqr
Dbe5JTpskck2tdl5NDscbCD8U6OntmZTq6ehCDVTjxe1PZ7N7eeNNsfj7V7TtFYqsXaJDr36nGac
e7am/8tPtf4kLp2fo5UnnKvF5/xGFW9+JG1y2OcFazdvRuI3Lbxh8VEtmTVbwz75VB8O+Uhjvxmv
xRZ4z569qqmp9eLWIR/rK1745zjNVSxOl8q7W7QnVaG8rkod6ak3pBIGus28rkKVa9cqz8DKGThI
S58fYHpSS1/sr6/uukXj+z+qPdnT1FJSbFB1eVlXb0Xy4mjw65ndBpUwqFrbGlRWUqAdG1epqvSg
++zFp/ub6gZUvK46/bLqNpOXyGp2+cLiA9plIG7bsVF79m5TTV2ZkqlmlZQeCsdbtq3Xrj1btGOX
PdSmtcpdv0qbthoE+3dpy/b1ysldrnUbVqv4aIGXla2qb6pWkWXY6Tqbt67z2i5H6zeuDtuNm9dq
kz3p+o05gc96y7l95yYdKtyn6voytbUTrgImInvIoZono9Zkg4rN80jxwSBfRydXH+m510PHyqZC
fk1duWfjTTp8ZL8nWIdNrtvu/sRy1Om0x+aYbX1jVdAbbZHX2FIbdHK4aL/2HditzdvWBVnXmbZ4
f+v2DaFf6zYg/+qgt4OH8lReVayGphr3oUnVtaXuZ244T51troMeN242UM1nrUN0+k5+Xr7XQ4X5
qqwpVa0jDeTeHfTudlx3vfWW43UyddDh1l4+nDt4KD/U6eh2JOJ+NbXWWvcHPV72iJZx87bctP49
Phu9xl631uOwZq322U55zo6LVI31DeHKaYe9FMStbfw8w2+fjZ5s+qnEiiuzIVfb3BoMLn7x5SXm
PHQYL3E31zo8c+hXVqRGIz7vicc067zzNeuXp2rd2RdrxcnnaPlZl2jjtXeoZvIsL9IcajhE6Kiu
VnupPYVDiJZqhxnrcjV+1EgNfOs1vfD6C3rrg3c0ctxoLVy6RHvsYusqqxyquV17EmYBMM6j80UO
Agtt2kdt4DVWRL0Hvrm5Tl0OK3sOF6trT566tm9U9/a16tq6WlVzp5imqWv3Ni6VmWdSqQZz4vc1
8+32cTeP8/OSi24bSovXbUcPq9NeyyvkNDn0w5g8Fwcwse12+3wIocegDuFhV4s62hvMq8m8WrzG
aLaXb1Sqrc5qq1EyURv2Wxq9hmrmNhrWZx4Ml6mvKVFrC1esmMV6efp8t3l0JOvV2lSpJoOm0dTi
/TaXbTc/znW5PcrDizqdyOD207NimnqcH2QwISPHXFFFRmSN8rJFxqryw2pqYHXdFvoAz1gu6CPw
5cdc+FoOfu4IsgPotPyhb5atqaFctVVHVFtdHPqB3LQR+uAt+kKeWAfe8E211af7x7rWZegnslOf
uqEvPo+OYt2wNQXd9fJss3zVFYWqKC0Ieg513I9QJqPNzD4xFgnGyG3SXktjhZo82TRVORS2HXe1
uZ9egxJqc5mcp8FTLW7XEV3wGvwjYvDau58qDaAaE9+tYVzQExNUmNKdx1W6Fiu/plI6WqKqiRO0
9rbbNefiS7Xg/Iu19te/19yzL9DCy/6gXU88o8blawxCe7cmd6LBawaHCnLM2cNTt+VF9k6zNfiT
QbrvmYd0//OPacCgV/Tu8I+9APxG8xYu1LZtO1RUVKLaRh6YZy70MsvENcBKC1Vhl90ASOiMOykv
iO0i5CBe2mcQHdxu2il59pJDII+w5XcZbqniaqOrBG/IpMExl6qT7rQXoh4NH7vz7Sz4nRdeiUsF
E/u88B3PfUwyl7GnUcqg8vrzW8XBw+2Sz364g57znLNO2XIOozZw0/XYQr28Dd5Qh3K0EQaGc/Do
bSO2TznKhzyIcr3nj1Ev/1Cub74Ni3Y8ex9rO+x/ez78xBH37clkDxna/ptyvXLZMAMdk5tzvXXD
trePxyjKHWWPfYTieerF87FM3I/nWPgxXlydNDCjjH9zjvKWw0A61gfy2A8TRW8fKONwP0y8YAD7
4cmM3svzgVWLQc3PB9iPy/TYa3XZPvupzoXqTQ1d6mow+uqTaqsxcisb1VJeo+aSCjUfOKSWHTuV
WL9Be977UNl//JOmXnKZsi+5VLMv+7XGnHW2si6/QnveGqTmzVvcuAeF36D4wRNv5/g8KN8h1fb8
jRo+eYTuffFh3f7sg7r31f56/O2X9OygN/Tm+x/oy9HjvK5Ypt279jksrLfc9kxeUNdZaKjWvNv4
vYVOua8dZV5wegFf73i5PmusmudMVmpzjjodhrTtz1PLzh1qtuxth4rUfrRK7WWOhY949jxcrlSh
w6ISQ7WkXJ32eJ0lPvYiPeVFfntxidrLK5T0AjpQheuUFrt+kdoqi9VWVqi2o4ecV2i+h709rGS1
fWmNQ7KqEiWPHFDS4VeyulRJl0m6LPltLtNW6fOunyx3O1VHA7V5wmktLlCi4kgok4SH80K5CrdH
XVMCon2fazPfNrcbtr1l0ufT28Cnl0K75LlukvY4ho/z0mUsp6mNc/CCzCdTlnbvpxyxpKyDFP1G
NvSBLtinnKmdsvQLXcR2ye89n6Rd9zMBIY/LtJtvWoZe2ZCjV87Yh0jpc71ye0uUkbAe0vx6++h9
eKZqvQ6vTcsR9OZ8+tLmOm2H8z1Gh1zG54sOqNUhdZA1tFPq+hVeZtjDVteqdt8B1e/zWsy20lZb
HyhZXqUOL126uTOjPaVur606WpsMqiqjssKu7WiTGg+Wq2jbPu1YuV7r5i3VqqmztZJLkMO+0sp3
P9LyV15X1m13aNhFF2vYeefp4zNO0+ATf6EXf/av+uQPv9HWIR+oaac9BXdH1Hrmx0PwYyrxdych
S7MOledr6rJpGvD+S3r4rWf06Dsv6snBr+mxV1/U4889rxdfeUNDPvxMk8ZN1YpFXlPkOlbevFuF
hbwohAsYRhOTjrGq+pRK1+9QztDPNe3WGzX98ku18sY/aZ/XVUUOLXe+85ZWvvqKFr8+UJtHjFLe
xGk6MG2O9k2ZrX2TZurgxOkqdh/Lps9R6dSZKpsxW0dNB7NmaP+0mdqXPVe7Zy3QrtkLtXvOfOXP
m6e9c2Zqx4zJ2jJlvLZlTfDxdO2bl638uTOUN3u6ds6Yom1TJ2qXy+zOztIu0/ZpE0Me53ZMnxz2
t2Z943NTXI+62c6fpPXfjNbmyeNdflIot9M8IlFns9vcNGmcNk0e5/a/CXnwhrZOnaAt5olclGNL
Xjhv3vCjDXjvdLvIggxpHpO+5eUyyED9IIfbRs7dM6e6nzNVsGiuDpkOLpgd+kwf4bvDZWO5SPQd
GbZaT/DaM2taINpHfvqCrLtnZlmPM0J92kNW5IgUZCc/UugLcmWFfmw2n40TxmrjpK+D3OiBNqPM
++fPCvVoC1nRJ/W3+niPyxxcOCfUXzv2S23rHavt08x/9kztWbBA2+cu0PJvJmnFxCxtnD1fmxcu
1vblK7Qvd70aiorS9o43S9lDcqGim99wWrxuqE+opqhC+7fmad2iVVqWNVsLRk3U/E+/1JxBH2n6
869q4sOPadydd2r0Ddfpq2v+rI9+e4lePucUPXPuyfrk1mu0bewXatq/2wbvRprt/r0e60l54esY
O5UggEuoKVWnrQe3afjU0Xr+o4F66LVn9ODLBtcLz+mZF17RwDcG682X3tbAZwdq+OBh+ubz8cr+
eob25O5Sc5m9X4we8NrVSZUsWaclL72hry+5WON++RPNO+dkLf39pVr4lyuUdcXl+uqPf9SwK6/R
qDvu0dcPPK7xjz6tcaYx3h9994Maf+8jmvzAY8p68HHTY5p0/6Mae9/DGu3tqAee1IgHn9KwR57W
8Mee1sgn+mvkY49p2EMP6LMH79Owhx/Ql088qtFPPaGvnnxMn9x3jz666w4Nufuv+vLxRzXy8Uec
d7dGPPKQRvV3e6aRjz0c6kMjH3tEY556Ul8P6K9RTz6u4Q8/qM8fvD+c++LRhwMPiH3yPr3/ntDG
Zw/cp+GPPBjO0e5XXuNSl/zPLdfnD8Hjfh/fG445hyxBJrf/lWX+0sfw5BzyseWY9gN/9y1d5xG3
/1A4F/rh9r4e8JTGPt0/3a7liHWCTnplRzef3n9v6D/nRpgHfR3rvo7u/0SoF+qYvggyPRb0Qd0o
TyaRhxycpw+UjeWjzigzIshzX9AT9dAr8sb+woO2GA/6h0zjnx2gT6zbD/56R69M1htln3xCI595
Vp8985zeefRxvfPYk/rgqWf1+kMP683Hn9AXg97RlqVL1Fxeaju3YYZQ0eEfEz522ua1RW19k44c
KtHujTu1dVmuNs5Zqg1T52rN2Mla+skIzX7rbS0c9JZWfDBIi70WmjLAyr7nBn16742a9sYz2j9v
mlqL9hmxINchYCqhzkS9GmqOqskL1s4Qz/eoqrlGSzeu0uARQ/Xgc/11v5U84IWX9Nab7+rDQUP1
5nNv6cWHntXHr3ygr98bqemfT1De0k1qOVSlngbPCITxPJdSk1LZwjVa9dSLmnr+BZp5ws+08qxT
lXXiz/XlCb/QiLPO1Fd/+Hd9ed2N+uS6m/TRDbfq/Zvu0Pu33KHBN9yit668Vm//5Wq9d9W1Gsr5
q2/Q+3+5Vu+a3vnL9T53o9748016/apb9MZ1t+r1a2/Q69dcp4HXXae3brhBb5pev+YavX3TTRp0
08163gAe8Pvf64U//UmDb7lFb994o/Ou0Ds332yg3a33b789lKPuoN4679x8i9677TZ9cMcdpjtD
Puep8455sIXPm9dfrzeupW3L5WPqvXur+2Oe1CXvjWuv7a1LvVuCbK9dfY3r3qB33QZl4Yls8KUs
9dJy3BzKUYd8yiAXfGj7tauv1itXXRXOD0K23vq0GdoxvXLllaG9t8yTvJf/cqVedR30Rb+CrJ6U
37e8sT46TMtwk7fQjYHeugG64dg2loltxz7EOhzDH50g7ytXXhX0hfzoh35HPpRBDvoXCb3SB2R9
45prPd4e41tu1UCPyat3/lXP3Xa7nr/D2zvv0l1XXKG7//Jnvfroo1oyLUtVhQXqZj3O10F72tWv
yrFUrQ3dfiXcSdHWllKirlWJ6ha1VjWrtcJrq6PVaiooVN22rWrcuUWt+dvVsnez6jctV8WSGSqe
N1lli2eqadNqdRYftBepD4u8zvZmO61adXa0hkvOTYk6pZxf31yvbXt2auSYMXrx5df08kuv6+2B
7+qd19/Tk/f118ABb2jaqCzlr92pyj1HVL7jsOr3OA7eV6LuQ2UyKt2Gw8BEj0oWrtKS+x5V1uln
aPFJJ2j3ZRcr+5c/1/hTTtbym2/SoaEfq3b2XBVNydKBqdO0d+ZMh2mzHBY4jFm4QAVz5+jI/Hmq
WrpU5fMXqGTmbB3JnqPCGXN0yKFiPqHi1Hk6kL1Aux0W5k2brkOuc5hQ0PvrRo3SHvMtXrRYBXPm
6MCsWSaHkLNnaz9tTZ0eyh52G7ssw64pDvlmTFeR26L8nqlTtXPylGN8D81xaOX6+2fN1N7p9tDm
vWeqw6Pp0wM/6kD7Z84KdfOmTVPB7Mhnsg44/8jChYE4R3t5013GfCH28wLPqYFv/owZQd5D1gf8
92RNzWhn7rFy7O/LzjbPqaEN+rlvpkNX5+3LdohFX92H/BnZob/0n/IH3A9k3ed8eO3Oygpt7LUc
6fOz07zgbbkCj2yH3+YZ24mETmgLXshNHY7pJ/oJ5ywT++iNPqCHogVpXWybMCGMQbpstmVJ62x3
1pQg/6G5Hifr4YD3g+4pY1vZ7r7kuv4m89u1zI7G2w0ul7c2R7WlR2zqLepJOIriQhagKnYsVeYV
f41X/jgAlivhPy6CxAsm4aKAUdjqtVFdqboqeBiwQOJtsnmbpZ0bJS5fF+RLbiTche51VGeywWEm
cOVLegk11POG1qT4skdFUakWzpivIW9+pNf6v6KhA4do9Mdj9N4r7+uDNz7U+C++Uf6WPC8uG9Rd
16LOGvPzwrDnKM9hsV7zzNDYpKJZczTXs8mUk0/SEq/v9vz6Es088QRlnXu2djgsa12yUCo/KhUe
UOrwfrUa9InyI+qurww/FbSVHVJDwS417tupNoeu/KisSrdR4fNelHYXl6unuML7leooKlFnSYlB
7eOKcnUdOeJwN98TiftcXZ3OrzSVQ6XqLj2qbn58LvdEUOZFeKEX90WF6io1D8o7r/1wgdoOHlTK
+dQRz+nwEpPiInUcPqT2Q15I+1zn0RL1lFkuZDO/bsvRXnhYqSOFzi/ztsi8D6un1Dyqrf+aKtc5
Gup2uJx47srU4TIpy50m8/WaoKe4OLTdY3npXw/yVph4nMJlUpYlLZfHPshR5nHwBOdzXa7fTf0y
99X1Oadq6y7oAT2m+96FvC6fdPvtrtNR4jGAl2XssT7Y7zCfTvejy+11u+3Ay3yRg35104bLoPfO
o97G/ZLi0M+UdcVY9AQ9WgaPUZCjuibkJwoOptv2fqfbYL/NukGm8LKiKusN2S03uutwGynLlnS/
mg4fVqtl7KyrUbt1m6q1O7JzCEDid0I7EIdltvWU+h2xwbs74eX/zUYP9yx2AyiuKhIXOoO7g/kl
nqsDTVWHVbwtR+Vrl6hx6Tx1LJirbqO3Z90Gde/OU89Bg80KU50Vz+8DDvm6ulNKGkjcQMpH3gLv
mqT2rdquSR/ZW/31aX3+2sdaOm2JchbkatyXEzXw9UGaNtWz167daq6vtgwWuMvhY8LAbq2VvE5T
8X7tH/elsm64SlNOOVELHf5tOO9szTj5RM38zWXKH/iymnnHIJeL2wzo1ko1m5I9fC84ac/cqH1H
dmj1hvlavNiL0Jx5OrJ/mzq4ZMwP31y5DAtQ951bddoteKeJy+5Jy9OGTN5PuRzHKUJeE/XIpyz7
XKInv8u8iLs5xz71eD9iqEtM7nyU3+Et+fHRGMqFetT3udAebXkb5HE+W357g09H5IWunddqHvws
woKa3x1jHcpzZwRtkB/q0Ybb4hxtcKEJXkEX7PscMvI+x5ZG9TQ2eE1u3qF/GTJm7lMv6gQ7Ip8t
+egQ/bAf+bZZJibxKMextl2fMAuZg0wuy2+P3u92Xic/iyAHd4FYD80VpWG9041O6Ef4bdJt0P+o
U9oMMvYS+0FuE+VDPRPtME7hfC91t/tfi03F/e9x2QAYeyrPH/ZUfOO9I9zLFJ44cFvh4/Em40nJ
bu5r6rLzMgDtnVZMHasxzz+pMXfergV33qPt/Z/T/pcGKu/1d1T19UR1bbLnarZX6WqybE3qcOPh
dcwAyjwDNfWocvsRrRg9R4MefEUj3/xcaw2o8qKacLXvi9Hj9N7HQzV24ljt2LlBzS2eQQwGNXgW
asBbHFTnrjXKHfySPr34DGWffYqWnWpv5RBw2iknafE1f1Hp50OV2m1PmjJIOuq8bqxXfQ+v3+zQ
/vpiTVs/R2+OGazH335Cj736sJ59/Ql9PvJ9bd5qt17tGdRrwrQSrOBkuyeENh9amZ58Ojx4SRs+
HjhpI0hhlDyjcMy1Z5LzeVmpB7HTA0XdLg8stwmF37/Csw3pMn+zH89HPpn84763XRl8O2xo7Hcz
6KFM5AVveHF7Es8YMQicM4Vz6X1kTLovrQZawhTKOb/dBpW0QafcRk+Uk3OB0rzpE7ctdbh9bm2K
7XTZKDudH/ob5Oe3nkgcm1dvfo/rcYsax9QPfTKF/pAHX0ARyptchv6GOoDEqaKyTAvmz9WIzz/V
hHFjtC8/z/3hNyjaI8V2uy0fbSSN7WaTgWlZuXk6lKFf8KQ9AByBb3vmKYoee6keT/Y99lQ2MjsQ
L3l6Ejz64TWOgdViFKW8pqIORs+W30Z5rN5zkQlgddobH1DOlHEafP01evWk0zTyhLO17OIrlPub
q7Xgoj9qxwNPqG7CRLtdhwzdjfZSjWp3nGm1hDvrU+0eOG7Ftw22F7cof8l2jRr4mcYNHat1KzZ5
IDtV1dii5Zs26KPRw/XZmM+Vu2GZ6hscYvAzcJO3NQXq2r9BxdO/1KxHbtHQs3+mRRefoxVnnKrp
//xPmnn2Wdpw/31qnjbZnnOPO1Fr3dR70uDTPAmvIbuUW7pXb0//TFc+c5vOvekyXXLjr/Xr6y7T
fU/+VdlzJqmYH4959gtFcg8jDwEmeGaJAXWE61mRh/Z4wI7HwdnngTwexefRFp4G5SFHHlyLT59i
/DxcxxOx4TvI3DZ/LPFgovXvvFA+5FiF3ufBufB4erg1xkbayy/U8kQI3w7LmfKMDHVYxlCOtuHn
soFcr8tjjFzpp1Tdpv/gxzHlu+whkvYerfZq3N/Xjbfz2KVseO2eVFL2GtwkfYynCVngTbuc59ad
zkAdbp+ndJHPx97y0GF40tZthSd6vU0/FJrmgxzIzjHt0Of008rpPORBb7H/3MHQ2tIS9BNT3p49
GvzOO7rrrrv07LPPaiVPPtfw+BDzI/LEMUHfyGH7tCdq86SB3EEezlmOHmQBVICWLRNDF3dXeKw9
6fbYtgNgjI1Og6q9q0X9OkCXkdbtcIfnZdIhn4scA5SdgqnSiuUeh2RLjSrXr9Hk+x7U8FPO17R/
OkMbTvy1NpxwqbL/xylafP7vlPfsi+rckuvwwOuRcLde0nw6VOvZrL454QgOF2+mlrOhsF6Lp8zX
rMm8xnizGhLpm15Lko1atGW15ufMV/7+zY5eAJXDvqRj39Ldal2WpUXP3q0xf7lQ4y45VTm/vURL
TztN4/6v/6Elv/6dCt4YqG4vJFXiNUezY+quZuO43Rw6VGEFrKsu0NDF4/XnZ+7QaddcpAuv/5Uu
uepi3fXobZo5d7LKyr3GYSbzgHYbULhwHrTrwpU7HTxwSHNmL9Cwz0cGmjVzrpcOVTY8nqjtdLTA
h8Hb1NjgVpPcwOpK1icPSabau0O5Tn5zS9tGOB8iDofb4cZmjxNbeMGn3qFzXW1T4NeWwDOl64T6
fSjdRk9oAwrteTKLcrHt5M4A/0MG+NFGss1GlMHneESbtskgG3wjcYz8USb48zGLcEyWtxyH/vlc
Y2OrDb0x9Kej98FH8tO8XNjH6BpZ07qi8TQfcB6w3lsG3SR4B2VvO1u37NRbbw7Wvfc8qOeff1lL
l6z0MpMnBz0nu136Cs/4tC98+hI6TCbwsL2KDh7K+ybuie02sLp7uC+S+x8NUlO7cZQAVD0g8Nhs
7MrIBjC962ArvKPCSz2DKv1IfWeySe1792j72+9r8e+v0+J/OUeb//kC7fjXi7Tu33ib7EVac82N
Khg2RIndBlZ3vf1Cmw3agLIADV4nJBocg/JuPiumrb5du3K9rlmRq3Xbdqrc8b/PGoSdKmms0NGa
IjU1eQGd8BqqxYvWin1qWzlLeYOf1xe/O1MjLjxBs35/npZdcoFm//Ikjfunf9O22/6q5jHjpPz8
9MUD3n1Bh82z2lRmOfan6rS8ZIfemPCxHhz0lJ778EW99N6LGj7mE+3cvdHhJoPQpY7mZrftGaBX
2UQGrU0JLVm4XANfG6Q7b7tbjzz4uEYOH6WyYj7/kx4QjDWFUfOAH+8BwQg4h1G576mEeVvffFSc
sLitxdFCYyLsUybpeu2tnkXbAAWvOca48HSEK9QzP6uQxy/Cl/4xOh8HGT3+nOeJA3jxcGZ4QNPl
4NviSS3RxGybthPkaE94bHuNmUT5lMHWapma61uCbBzzFC31OixXW7Nn+GZ7J+9HI6f/nTzYaF4h
Lyaz7nD7ncjj/KTB3drosMv16XOvvQa5v+2b990exH7sG9997jYf9En/0QuyUx+ZigqKlbMyV/Nm
LdTSRSuUv+egGutaAg/0l3IIxhil5UUvPrZs6Aq52e+0TnjCmMdoUq0Jj4/ttqXB4LVr6XDcFQDl
MTS4kg4B2zq9dViY5OofYU2aLClhGR7Eu+g3gsqrGXsrfA4LQMdtRYVqmJKt/Q8M0JoTL1Xu/32G
tv2vc7T/jN9pw+m/0pKLf62ld92qA+OGKVm4XR2JCgJMA8teqq1RqbAwZmQsuGeN8kMltv8D2lN0
WGVtTQafFW7DZxUXhOk2zBrsoQ7sVMfyeSr84E0tvekvGn7av2nsWT/T/N+cr1lnnqYsg2rGORfo
yMuvS0tX2ku5Tr19LXd2eKbhO8LVHrFqW0WNuZe7ldX7NmlO7gKt3LxCazYsdyi3ybMoN1ayeHYo
Y1B18QZeBtU6STa36XD+IX352Ze66+a79NuLfqPbr79dX3wyUrXlaCsjuby7EbrAC3Z6DKauXupk
C6gYPAOsrckaqm91uI71ubiNI9VsHfhcmOEwgkge/LAuxqisIuqHr/33yhjVFoh9n4r5XChqrfck
Zwp1euXjIc5wlYryLotxJS1TU22LGqp5yLDZfbch9fKET9Iytjuvk48x07ap2/U6Wgw+DMj/eEtw
ADx1AB/9Qxa3y9Kkm4dHrYtu6yG0HfXFfi/PY+S+E22xhDkmO7xIPt9l+21tSAQ9os82TxwcN9c5
WuBp5dCG68GLeqYgrycadBjHJGxNPYDM3rudVwo0Nnhi8RLCtssjNjCxNA73PG6pFjW3u03bFlbb
L1zVCuSeRFD5kNvrDJ/em1kJvLgfwlU6nMtl3Y2bVf3ux1p/0Z807//4uZb9nz/X/nN/px3n/0ZL
z71Qky46X3PvvVnbR32g6rwcD0CRheFFjeYYbgJ1Q/ZaXbW1aqurVVNLffrucxs8j1oke9J3FIfL
lFy6LDigDn53eOklrb3qKs09/1wt/dX5WnTh2co+81SN/dlPNfnMs7T21jtU97XXdLu9JqrgKqHr
85i5FZhodwja4vWCY3LGjTFp87qJ39A6PVl0NNapo4HLpD7DTcBNveDHEGwoHR6s0n2HtTx7vt4c
8Ipu/uO1uvLSP+jpex5V9tdZ9sBui8SgReMIjXiAmrwAr7UhN9taYn40HLaZ5HMYT0+L6zXaQO1Z
ugFBvQfTszvv3LCSvuUBv+PwONZOnzZ6PM7QsfpuSwZHmq/zOaZurB95UTbych4Aw/DCG7kAJbbT
apmtqzCJ2EBTBmMnT19zzuvl8DV06vfyCHyZOMLk0ZtPHnaLHLEM/HnEnodaY37kg0zktdKmy8Vz
vcAJcho4vLIuvLeEto614/IcR56ROBd5uAjuNbw9if2MZB8XPFRzu72VQQXU+jmuMENz4ElFGoC5
D1lDo6sILL5cyBNFxJLh96qKo+pYsFBlTz6n1eddqnn/eoJWn3Smck4/W0tt3Fmnn6Lxl5yjqXdc
pQ1fvKODy7NUuWuVuir4cbjayjUPfiuqM+H9Qk8Q0S7XoOtIeNa311LpUbXnrFPLN1NV/uog7br6
Fq046yItPOl0bbr0Mq08/zxNOelEjTr1ZM2+6kodHDxYbWscdpbxW40ld1iV/p3A7By+1NvwO3D5
jsXbmu2JWg2q+nrVFBbqyPYdgZrKytVZZ/l44YlDg1o+9p27RavnL9W00RM05PVBeuqeR3T3tbfo
nutu0fMPPalRQ4Zpx/ot2r89T9vWbNIO05G8g2rnrbktVqipB6NlsKxbBrnNa6SGsmrVllQEqvd+
S5UDX8+wlAlE+fB1Fcfuweg90himDayt1t7DYU0I27326HJfO+35OwjV3M+UJ4FAPia/GzlcLo4x
xGP43egoPBzae46hMM8ue6JO51O/zeuWRk9SPObfVFEX8o/JSHlPHKE+H2RGHnTuPibdn24AizE6
G9nhVX2k3H33dG2PJ8LKxrTcyJNu3xWCPZpCf51peUI7yO6JjvIt1Q1qrqpXO3oAtC7KezdKDhQq
b/MOHd6zP63P0I7Po0P4ehcwdXnCSlGXc7RrvvQb/XW5j20NjrDCE9Vu19V42U1TAx92cMTlybfL
6y1WVMkuj2dHyuTwj8uTaTJH3DSMTSGe7ZWfSdHddWWumnhwUoYYl6kP75WmT9K+Jx7Woksv1tQT
fqZZv/y5FhlQC888XZNP/oVGnflLTbvlT1r20qPaOfw9NS6eKe3cpJ5D+eF96j3cgeH1S1d7+p0U
3V083FinrsrS8MNgYsValbw5RPl39df2y2/V5vP/qNUnnKflPztdG869WMvOPk9TzzaI/3y51r78
rOoWzFIXr4BuafYsb+IigfvCWrPNA9bkMID1KeuiI/uLVLAzX9tW5Gj+uAka99EQZQ0frj1rc9VQ
clTdjqXbvQDesW2XvvpilAYPHKRnH39K99/+Vz1wx1167N4H9NRDj+pp0ysDntPXw0dq7LAv9Om7
H2jEkE+0dM581ZdW2Ng9Tfc+dsJaJdHYotICBn2b1q9YrTWLl2vNkuVav3y1tq5Zp4JdeTbgaodf
BoQ9JXVC2EIYaDYpHj83371btmv3xi02oEMq2rtfB3fu0f4du3XAxP6BcLxL+7bvct4eHeIx9P2H
1FzjNSZvbbIH77RsndYF3xmDP2876mhOqP5oRShP3bzN27Vzw2ZtWJmj3GUrtS13g0oPHDbY+I3G
+kU2+he8evq4zedqiktVmLdPVZa13dFQ0m1VOSSn38vnLdTGVWvcj0pPKGU6evBw6EOD+83LZkJf
kQd+CYdu7nP4Bprzut1WW22DjnjJsHvTVh20vmgr6Nmp3PvzpmXrk8Hva+JXYwP/wNMsA09Th/tf
a7kOu497zOOw5Sy1DOgSveV7fY/s+e7/nm07zPOoyo6UaH/eXm3dtEX53vL+wmOvUjPx4YtmRzj9
UvaNUIfDLi6PhrOUA8mmCC6yjGElknVqbChyBFds92VAHF6nqhlfaOOz92rir8/QhNN/qjmnn6B1
F5ytNWedYY9iUJ3yC82y18q54UrtffQhVbz1plq+/FItWZPVunSB2ndsUsmmHOWvX6naonx1lh1R
z4GDSqxcpwPvDvOa6UbN+MklWvBPF2jrKb/Tup9eoEX/z8ma9b9O0OzTz9GSa6/RhrdeVuGCLLUV
cwndM6DDxs6UZyG7XFTd7D602EO1GVF0sexopZbPXabxw0bp3edf1eO33qlbL/+jHr3jDk0bP14F
+/OtoGYV11Zr3uqVeuPD9/XsKy/rvoce0NXXXq3b77xNDz/2sJ7o/4Tuvvcu3XnXHXrltVf02huv
6fmXntfAtwZq2oypKi23p+XHx95UXl2htevXauy4sXr/w/c08M039NagNzVo8CANfu8dvfrGq+H4
y1Ffav6i+dqVtztc3On0QPCSyHZPgIc8acyZN0fvffCuXnz5Bb0+8DW99MqLesHtvvLay+b1tj4c
8qGGfPyRy7wX+CEP9L77sSpnpY5arsrqSrW0GRgszDxp8tfs4x27dmjq9KmB/6uvvxJ4w/flV18K
bQ35eIimTsvyCmCjyip56tnG3suhy3K2+Xj7ru2a7PEd+skQTZoySavWrNK8hfM0+uvRevudt/X0
M0/pnXcHhX5MnjpZX43+Sl+P/1rrN65XncNw3ndv+Hj80i9wbTdPLqfbQtXU2qRde3Zp4uQJ+nz4
51q6fIkOeHnQxFrdad/+fXr3/cG64abr1f/p/tqdt8t2mw7N4dlqfkUlRZozf07Qx5NPPakBzz5t
XdJP+pvu59ChH+nzTz7R8E8+05eeLD/5YKjeGfi2hr7/kWbPmKXiovR3tGJCNn6e6Oe5MFwU4Dco
Lg7a7sKsfgxYaTSFS62Aqq2j0Z0qtRss8XkDK+kQ5/AaHckermVP3qbJfzhPE884IXirtaefoXWn
nKbFP/mJlp54gnLPP0drL7xI6373B225/iZteuABbXjuGeW+/bqmv/q8pr37pio3rgm3zHQfOqKC
keO17JaHNfGXl2maAbXkXy/RxpN+q1U/uUBz/+dpBtopWv6HK5TnQS9fOlMtR/MsV5UnIz5X6pDF
EwUv5Kg3kKrthXlzQIxuDh0s1rRxWRo44GU9cNMduv1PV+mqy36te2+5RZMMqgMFBw3ClI54rbfu
YL6mrVii8bOn660h7+rGv96iG+64SXc+cLceeuoR3fvo/Xr82f4aM+lrTZs7Q5NnTtX0+dlat22j
arweJGxuc9x9tKZcS3KWaeiITzTglecCDXz/bX321XB9OX6Uho35Qm9/NFjPvvqCHn3mCb048GXn
j9a2vTtU55Abk4LX/iMFbidb7336gV5661W9OugNPf/GS3r2tRf08tuvafDH72voF5/qw2FD9bp1
+sTz/XXXw/da5pt18923adLMLBWWF6uyqdrRmkNgj2yiV77cLev16VfD9IzH47Fnngz1h1he8uA5
+OP39PJbr1m2V/TO0Hc1fd5M5RXkO5JKWjIuMHeryQv3Tbu2asTYkbrn0fv0xHP9NXjo+3rTfX11
0Ouh/ivejhz3lVZvXKtxWd+Evt776ANBh0d43szhFP1t8+ISGdu60xcBaAM5Zy2ao6deHKD7HntQ
c5ct0MGjh1WX4NdUaY/lob0/33BVGBvGob6Vd1Yy9rwpLBnamLVorsu9p8efezLoHNleG/yGXrAs
L735qt4f+oE+H/aZPhv6id546TXdf6d1eNV16v/IE5o0bqInZkchvZ4qmfTI9O7347cnruq1ukk7
2BDu4c2PAcvEPm/5JPzr8LACw/bwoDu/YFX4ZKnaj2xSUdYXWvLkvRr/20v0zamna86pXmOddZ7W
nHyaNp12uraedZYB9jNN+1//ogn/9nONPelUDXfe++eeqRfPOk0fXXuVahfMTd+rZU+y+qW3NP78
f9c3J1yixWf9UWsvuFLLTvut5p90seadcalWXn619j37nJpmTFEP9yKqJfSkpdvxf7fjbSuwwcLX
uLOVjqkb3TH6x4WpAw79Jo6ZqKcffEJ3XnOTHrr9Tt178616/qmnNHeOZ6FSTxwu60DUxI/fPSpv
rde8VYv10IBHdc1tN+iaW2/QXY/eqyc9uJ+NGqGCskK3nVRTR0J1DmfZpn/F6FFlS41Wblijdz/9
UPc9+aAeePIRDf7kfc1ZPl/b9+1W/pGD2r5/p8vkaJQN64kXn9IdD9yl/i89o5lL5qiooiQYDENS
3lCtjTbaRTlLNXfFAi1avUyzl85T9uLZmrd8kVZuzFHO1lwtWLlEX34zWi/Yi99t47r29ht18723
adr8maporPGEw1TKMqVDR+vKtXjNMr378Qe657H7A7394btasna5DpQeVkFpkfIK92nFhtUB/I8+
+6RuvPsWPf78Uxo3baIOVRTZWHkPnnXV0az9xQWamD1F19x+vf5841W67/GHNOC15/TBsCHOz9Li
tcu0z6F/c2ebVm1eq5ffeU2XXv5bvfjWK9qcty18lI++OtZQwsBigmRCSRhcu710GDLyE1196/W6
7vabtHrLWlV5CdGQbHb5jsB39MRxYWwef6G/1m7doKrmOp+x5zMhY1Nnq3YeyNOCVUs0Ze40LVy1
VKsM8OUbVlmX8zVj/mwtXL5YS5Yt1fSp0zTw5dd1y/U364+/v1zP9n9G82fPUytPuDsBpvr6Bi8v
0h67H7/d8AqMNjcEqJjJMbywvMog8nhjA2pr56+n1eDjnie7XKi1yh4rX+WL52vrkCHKvvchffXb
P2rEKWdpwk9/oQUn/NKe6zTN/4nDw5/9Qku8Fpp91rmaaG828tRTNOysMzXj2mvVNG68p5o8dTqe
Xffcyxp73qUaYo805vQLNemC32jsOV67/e6PWnP/Q6oaOVLtDmW6jhxw+w75uMDhNV8bv0mF3wx4
JZlnJk8IrXbBrJ8BCqmwsESTv5nsWedx3Wav+eDd9+iu2+/QgP5PhZfmFxUXWxvpfgd9mFq8CF2R
u1qPPPWornVocdX11+hWz/zPvfKCJk2doiobKildz4t0GwBfFwEMlQbCgiWL9NzLz7vO7XrHoVXO
urXpS7Hmm3B4w35DS6MOOzRZvnalhn/1hT4e9qlWG4yVDkNJ8Go338bWZh2tKg1U70VzRV1V2Oc1
1k0O4RoTzdpXsF+jx4/RXQ/eoxtuvUnPvPicZnrNCf+kw8iOACkbbntS62147w55X3+992698c5A
Tbcn3OeQqp7fZjraLFeT+TarwTP+0YoyrbQePh7xqe6+/149MeBJTfLEFmVsTrWq8OgRTZs5Q1ff
dK2uv+UGDRz0luYtma+9B/epsqZadc02wk6HdC5fWHpEk13/rvvv0d0P3qtPR36umob0zxO8Gq7J
fWlx+NZp+6t3vaWrluuBxx/UX++/Wx86FC2u9PrXWue7Y2j7QNFBjf1mnMs8pGdefk4btmwK7VEG
70eblGvx+od20F29Q2x0WufIorq+xiGo5XPYXnCoILyaesBTT+vuO+/SM08N0OzsWTpSWNR754cT
GOngrpf01zL7gVwv3U0AKk3gLRLrkTTxuoz0PYDMb4QzPMbRY/LK0QbtATLTHhae67Zow+gJmvX8
65pw4x2afPGlmn/eeVp94fmaecIJyv7lSVp64cWae/a5mnzKqfr6pJPC81C5FjqRNU3avlOd6zZo
w4BnNfqSX2nQSadoxK9/oyk3eW1191+1xkZc9M0Y9ezhxS7lFq7ebTdbDK7s2Vg883Z026+iZIOq
07ErYS0emC3p6NFSTfMM9NST/XWbQ74H779ff73zTvXv3z98SaKwqCiUozjU6YVlSyKh5atW6KFH
H9aNluX6G67XTTbWAc8+o28mTPD6otwa8qA5ru50+0EGLqM6NTQ1aHXOar306su6+bZb9MbAgVq+
YoWampuU8OB2hNtwvk0NNoLtO7Zrzdq1If5vbk1/TYP1RBv3oTmxzuItPkQRtBsTa5uKqkotXLTI
65dBuveBe/XiSy96nTQtrIHS7WFW6Tq8F356tg3H/bjr7rs10WugQu5M701hLZfy2Ga0wXps0dJF
6v9Uf91rYH3gNdyBg+mPviU72z0pHVHWtKm63pPPfQ/cr3HjxwWemTxiYr2zZftWvT1okNemHoMB
T4V1ESWRsaWVR4fSa5fDhYc19uuxuvaG6/Ts889p8ZIlx9ZLMbG+GjV6tB565CG96KXB1m3bvN7i
loJ0au+w92tL6zCmcGtZ71jFVF1To0WLF2vw4MF64vHH9dqrr2pqVpaKCgsDoCgfbnfq7RPHrLH6
EZqkY+FMUAEgfpfyDP8fiEdE7AFsvEkLB3N+lXZWejrnMuzRGlXt3K+yVRtVNHmGtjz3vDb+9Q5t
uvE6zTC4vjn1VE33dsIZZ2jUiSdq5C9+qekG2dZHH1cyd708Pahz+Qqtf/5Zjf3LnzT033+v6Y88
qE1eKxROn6iWDXw5ZK9dh8NPLkrwnnbP8lzBjB2NxD1if0Oh+9zpXxY+X/PMM8/o9ttv14MPeub7
61/1lMM/QMUL+mOCD8rC+Pho2P0G4G233Rbq3XzLzXr44Yf12WefHftcTfpeNYydOTGdqM/5ESNG
6N577w1tvfXWW+ErG3zNj0/iUDfKCQ9ejs+WY/TMF0Pi1yjgT+L+Ob5mQbmY4IW3feihh0I7b775
pvhqB/X4sgUfQmjhjnUneMOTT+6gi9dffz183YPvPSXtwfgyBh9J4EoX8lCf71Xx1Qu+9vH+++/r
xRdf1AcffhA+RwNfeB46fCh8Iujmm2/Wc889F77mEb88wvk4PjExHnzO53EbL2MRvwRJyjR2vnpC
f2644QZ9+OGH4d7L+GGGmPiuFnp+wGv2l156KdybiW5joi+0Fz0N8vARAvoVE7KONjAZ62sdQdFH
vs7Cd7rixQnq03Yci5j64Q4hQAUxH/UFldUUthzHMJHQiu87wbibe7fCJVCbbPhxyzNovaPhqka1
HypWg2fk+ikTVTvsY+0Y0F+5D9ynjQbJ4jtu04QrLtfH55ytkb/6lZY88rBaPJuroEDdmzbq0Niv
tO7dt7XKsf3B7Mlq3LZOyZKD1kqZ2/EAOfzs6WhQZ6LWW0tnzxCA5JkbRUH+r7erf5v49ApKwjMx
8Pfcc49uM0iefPLJ8K2l44GKweCrEZTlZk0G7W7P7ABx1Fej/oMRsOUTK1AECV/v4BM477zzjp59
5tlwwydGwrek+DwON3/yFQu+8JFpLOwDKmSIQEOmRGsaxCTykJtPxdCPm268MfDnm0oVPOPlFL6i
YSOIMsIXw3zxhRd1pz01Rv3pp58GQPBpGz6vg4F+9NFH+vLLLwNvPicz8ouR4abVRx99NOjhlVde
UfwSI4kJZPSo0brppps00F6Zj6ihBxJtckNxsJ1eYGH0fFDu3XffDXIAVurExNc+MHS++PjII4+E
CYOvnhzvc6p8poc+3OtxAlT0LxNU8EJvmWBFh1HfTChMdrRxxx136OWXXw4gR7eZY0J76DKCK/Lr
h/OC+nqsCKzoob4FlO3ZBPg6CD/MsIuwj9uc4t0HtAsxEZBX6xmg0KHBllw1zJqmiknjVDl1og58
OUzLvcb47NorNfQvV2h6/8fV5DWSigvVU1igJhaY61ar2tvOkgJrnjibONzhS3eT228ysE28I87r
KB5JoKMRUAFU35EAFR7piSeeCLMeM/otDgM5Jp9Px8QEH/oJKHhjKUACWAwuXufpp58OsxpGT0IG
FIyiqcNsn+lJmPnxHF999ZXeeOMNDRgwQM8//7zefvvtYEzDhw8PgMcYABHgoX6mYcAfrxENFRnT
n+WZEvjhSZld6Quza6YxkCgPD+rz/SUmlxsNQrwEcnzwwQcB7NCrDnvwYshKPjIyKeDVkJvzeGo+
FIeRwzuAyjq5/vrrNchhHZ/kiTLQF/rEMUR5CD0B2vvuuy8AFW8bE96V72IhD7oHfHwzCqOO9aNR
83XHjz/+OJQDEHx6KOouliGxT/0IRvbRIWBFd+jwtddeC9+jwsvHumzjfgQWfWJL6ocwmcCKHisT
WJkUQZUux9rBDTDjtLlGi8/ySzu/fHOrSquVGL4N3Gjv4lCt8oi6D+Wp+/A+dVeWqOfAHh2dN1NT
vIAe8ZCV+NYbatrh2anBIPQCucfU7brdScfDna22BAwoqZb2elW1VKgiUa16A4qLwiy6+Y2ETkaK
yo6UmQAVyssE1a233hpmeAyaz2dmJpQIsPgIGqCCGHjqYARDhw4NMxwJQ43hUmyb+tGIIjHQyMFH
2QAYBoOhvvDCC0EujJjvRuHd4BUTdTGyGIaQ+DgcBhnDWLwDRocc6IKyyE9ii4zwhDBC2qUuRsjX
BvmOL198BCiEdRgm4COfD78xKfDRNc5h7Dz6wmQR+waQCeeu4b0PloUJIk4AtI9OMEImBsrHRHuA
lDH55JNPjoVkGDVyAX68KV4d3UU+EP0k8e0rQE7oBi88F/1kDNhGPUQdxAkPfnxaligEuWMozGRJ
Gcqjd5YBTAARWFGG2H6/cHtB78Dz4+/xQsFI3wLLg+TFK9/MDaCCoV1qD16JX+YBE7e+8BUKNx7e
rsTFBN4Ay4WFZiuKe/qaalWzbaOmDflAX3hBmT38MzUfOWytu5MpBgDks9hvV5vDu1buBrZkDV1t
qkg166gBVW0PhSdNWnIuDNBRKAIrk+gjRIprKrwMHgqPg6snlGOG7AsqlIZSUTJlIYyQun1BRVtx
oCESMjE4hEcYembig2UYNl8ExGABOzMxoVVfeeAHGDEGEgaJwROaYWzMrhgx653oOelz9HYYFFuI
ushFWMP6BCNkUkEG5KQ+smHYlCcPOTBwDAtAUCYaWewr/accXvPqq68Osz2ApHw8T6LtaNQxDzAS
XrJeZVIhJER21nCEoKxfmXxYN1GPFPsSE6Bijcj4AAxAhc7QA+Ug9IC8tMsxdZCX6AM7IGyMeiBF
vWEDEDJRN5NiSoMqkhsFWH1Dwei10pS+Api0AYc1lYkfwMJHyrhgwdqKW0IAFqAyssO9fbyrgsfg
Wx3C8fgxVw0NtvJ9eZryxQiNeG+wZk4Yr8YaOmHj5woXV886U2pJeHHc3Kgqb+vtjQxP8cKzcktZ
ZXkw0YTBzeVrFIU8EVyR+naeWYmZL4ZKGBSxPEaMp8oM/0goFTCwbsBDEVoAJgYf4ydkA6gkZIiD
wGDSJsbD4DK7c2ECY8wciMzE2gzvhWwxfGKdRYo8oxFhDMOGDQvxP/JjwFwUiIAiIQtEHepDHMcE
aFhDYVB4Ob7rGy8qICP6I9EuM3VMHOMhMXj0Cd+YuFjC95ABFest1keZdUnwxjihMG5uB3DSVyY7
1oPxohGeEcDjwVnnZU4YgDWzbUJP1lSME/rIDP9I9B1g0D7ExEFEgBcEUIS2ACqTJ3XipBET8vbN
h1+/AIRMYJn6eqwIrL8hGzfA4n4nmMLM2a5vog1uqOTVyvwgxoMu+L1ugJIOHinEO82PHNyvCY69
Rwz9WNlTslTt2b6LhWRLwsp2iOS1WoNDyBpTrY95bT4XR1Fp/BwcIGs1qNotB7JkUgRVpOipAA3h
CYaE4cY1FbM9xoCxZCbqMmuxgGWwuLgBMQisK5hd4YkxMttyxYnBxUgwZsIjjIGZ87333guhVVx/
xMGNsrHFSJmZWedgTBg6gxzLYIh4N77Vi9dkzcMiHgOKHuG7Em2hm8gLA8OQ8Y5MMKybADXgDuN6
nIS34hu4XMGkHgt58kjwpu/IFkEFf3QRz9M2hFHG/kegY+R4zsceeyx4DCY5Ji30HUOyOKlQD7Bm
goZwmXUfITr1+axobJtE+5Sn3wCWUJIJDD3SF2SlzN9L0WNhGyRkYvLsd+zHm0xgubNxjQURBkai
22kysGzIfJIxeCsMNtaHH3x5fsQACe9P6OQJY+CIAADQQlshlWXlWjhrjqZNmKwVixyycLOnPV27
w8cOHigzj4S3rSkrosszm2sTGLaYPbcd8Qp4vqnA96467KFQRiZFMEEMQDQkQIMREiJcd911IY5m
fcRAMmsBgsxEXUCFp8KAuap15ZVXhtif2ZOFMYDjyh5xOcABaBgXA4gXI7ygLN6NQWc2BITIyWAA
JEJI2mZmZpYFtBguaw3KkQANXg/5kfeKK64IxsZFFMIu2sJY2Oej1BDHgB0PgsfFAKIRoxsAnp2d
HeTD69EmnhyQco4+ICPywouyTCbIR7hJ6BrDWvgCeC5UMCkgG2sv6pNoG2OMgIoJOUgYKyEwl+IZ
F+rHtpiY8M5xHDNBFfO4KIL+iSQioKOXpAx10CHgwxPSDhMqEUdcw1IeXdFXJkt0CcV9dBzD4pjo
z7egOg6wQuOGQAwDM4mhhfhmLusqQMUNkCglfJsWCuGgOdgQkjz/79CNdwGEl2q4TnjDjVOiuVU7
1m8Kd2jv2bzTkaGFNPMeHiHgEj06h7wLsUuEmXQZ7tbnURju5O+wzLx/IQIoEgqMFJVOQjEoEM+E
QuMCnxAAT9UXVNRF0Sz+ARDeilmYBS0DTz2uGBE+MuNFY6I8RoLC8V4MNu0RPrIOw2Nh9IAPUMQv
oLNuYJAxJi6JA7iYGFjWg7R11VVXBTkIESnHLM6WixasxdiHADT9JY/1CIOPQaCXmADqF198EeTH
gFnkcwGFcDJeqIA/fOLVMfoNz0zvCPgxTEJKdANAAR16IAEqPEcEGSlzbJCLcBE9IwceB6BzAYcv
5QOgKDfbGP5FHoAK3TK2tE24HT0VbVOHseSqHjwvv/zyMEkyXuiVi1H0k37x8woAZ7JkIuGYfOQA
dEwOMWFvjPO3oIrA6gVXBFVfYMWwL95DFbyZy3ZRvqfXeOkw4PQ/tuHlIwZd+i01bsrei6++sw7j
cYB8vrK3ZqMO7NgbnmMxc09XlgFggRqOqWoQsRTjTWVd7ovFcHuZ5La8E4k+ROqbCDFQKoYDQHD/
cYvimNVJmTxQGjMUFwEY8Agg1jJ4H8AS43iMEe/CIp6EoQEMQEY4Q2jHmiFe5WPwmVWRByAR8nH1
izAMWaOXIhFmEW7FCxPU46odoQ6GAS8IOcjnPPlsycNAAGYmTxIGx2QDAIcMGRJkBDysb5ALA0Q2
5GVywCMDFjw4+sZwI7iYKDA+1qrIwuQBGEiUBVARZMgRjR0dA5D4QztRAfoFvIAUuUm0gwEzLpRn
PyY8Gb/7ISuhLJNZBDBbygIqIgu8FBMTkypycoGDEDBTp+wzaaE75KEcACM8Rl5koG/0gfSdoIrA
4o/1VQCPKZUBKo6x9UgBhADL9bz7LYXETnp2AVSJxqbwozGfvqwodJiy/7CqisrSD5QBfm96Wtyy
iX2AxROcfDwkfNWFPPTY27ibDeHn8QAF9U0YADMzBsZgEQbwYycGRaiCIZP68mAAMTx+2Qd8zOwY
IEbGYHAVDrDGECKmOJCESBgcgGPNwW9C1GMNwezK2gEehDkYYrxgQIoywAfPgUcDvKy38B7URR7C
QtaLGD3GBdEWPAnJmGUJM9ETKRpzTHhpLp3jOamDbPSP23XoK/zpIx4BfcSETiHk5EICno2yeEou
ZsRZnfMYIMQ+uuFcBBf7yAQ4MF7kZ1wywYEOIj/qReMmYeyE1owpwMSjRE8GGKnHFg8G3/hjN14K
QmZ0iW4h9Iiu0R0/hKNbxgYZor3FaIT0vaCKwApgMUVgHY8AXiwHUS9S+ilB3IobtcdyrGgr8zZS
eOrYW57ODOTB5s6MY2RJIzEZ9KUALtr523a/i0gogNkFQuEoGmJQORcHqm+iPucwHjwGazMGny3H
gCYaBURZ+EWKRsMgwAPQYOBxzYNBwINBj0aXmeAJn8iDcpTHiH8oUT/yyjTkSOgDvcAbw4mX0pkM
kA8vgnFTNhoz9F39jbqMOskk8iNRnrKRB3LQDrLEtqjDec6xJWW2TTn0Qj3kj3JyjvqxfxDlYj8Z
C/oat5mEfuM5+FGP+rFvtJ05Tn+7pjoOqDKBBXAiHQ9YmaBKU6zlzvd4ILnxFmAFcJm4iTRSeBNs
L8DCR4ht0DyjAXGXRqSYF/PZxsv5vYP7QygO6PFSHOC+BpGZOOZ8NDy2HMM7pthOpNh2ZuKYgWbA
MHgGmbb7thdT5JnJB/mijJH6HmfmxcR+7GckjiO/eA754uTDMef69iOmKF/ftmL+8Si2xz7loJgH
9U2Ui8YcU6wTZWYLUS72qW971IkpU76YH/Ni+eOdy8yLKQ2qTEAdB1SZwIrUF1gcZ55PE38Wxq6E
J1l48WCPY7g02R1zNbDL+53edkDOi69MC2AzyPp6teMR3s+dM1P/++EUFRIJxTEImbMZ+wxS30Ek
UScOGpTJj/w4cJG+K1GONmKbsb3j1enLi/04uD+UIo/Y30wDJC8zP/afvOPx6EtRplg/k2dm/UyK
5zITPMiPPPqe5zi2FxPH5FMemaPs8IBXZnn2Y/m+FMvF81H+SJlljpfSv1N9B5AixRtUzepHEXCy
Sg0p/ngSixuK3Mmwz70RPC1q1xxel5umcA8fv2WxgAre7QdSCDHdquX8MRQT+yiLATkeqBiYODjf
lyIf6kDsx4H5vsGI9Y43cGzj+ePVj+d/DMW26G80/O9qE8pMMT/WzdRNLB/zI+/Mc5l8MykzUYY6
kUff8xxT5nipr3yZfWMbKcqVSbHcfyb97R0V30E0EslN/mCyiAFUaRjxZyPt3Tqi9RYij+c7e4mn
UQ0uPFukb73bdxFXgZjZ3WqGrN9HKC9T4VHJ5EVARDDFMnGQMnnEOpkDwjbWzSwXKZbLpFiGOpnG
mFm3bzsxcfxjKfLMJPIz+fZNfeVkwonUV1exTNRZJv9IHGdS5rnMNuDNMflRjkx+x0vkc55ysWw8
jjLBP5MyZf0h/DMp8od+NKgCg+MA6HhksQKo0j4qDaU0nKD0X3qPF0N7MdpLDoRczyFQL/0NwI5L
Px5UKK0vcDKVHfczFRvLROWxz6BHj9b3HERdjjP5x3KZspBHu9FI+w50PI551CfF+v9ZinLHvvZN
sR+0jc5iv1m0Q1HmyIttlB3q20akmNf3HHXgGS8KwDuzTibP70qxbGbb1It6jOOfSfFcpL78owyR
dyTaSFOX/l/+Gq7z1eycrwAAAABJRU5ErkJggg==

——=_NextPart_001_006E_01DA9CEF.7304C460–

——=_NextPart_000_006D_01DA9CEF.7304C460
Content-Type: application/octet-stream;
name=”app-debug.apk”
Content-Transfer-Encoding: base64
Content-Disposition: attachment;
filename=”app-debug.apk”

UEsDBAAAAAAIACEIIQLf1N58DgMAAMoGAAARAAAARGVidWdQcm9iZXNLdC5iaW6VU8tSE0EUPT0J
eYwRYhSBgFEBFZAwPH0FsTBqOWWMlkmxYWF1Jm0cSGao6RmKJZ/jUl1YlguLculHWd4Og0AAo4uZ
vn3u6XP7Pvrnr2/fASziEcP0pus3bcewXM8NfNsR0tjYbhm24wvP4U3jiagFjdeeWxPyhR8HY0hv
8G1uNLnTMF7VNoRFaIShf0txigcqRU9wX9QZHk+UTkYoug4ZAfdt1ylMdiMwWMvVB6XOsIWVbtLL
+Wq1sNI1wHKbxTBWcr2GsSH8msdtRxrccVy/zZBG2fXLQbNJLN1yW1tNoeAEkgy5UPxY1UzH90jC
tmQc56g41nthbYYar7nHW4KIDLcmTmZ1BKkokUZhci2F8+jVkUIfw9x+vJ2j2dRVk07tmUl3jeMC
Q8IsV6qr5eJThoXSf0sUUriIS0lk0M+QP7XV46Ho20NRZYoUBhDT6eQgw7Xure6YozdCBi01R2Pd
52iN4WbXkZhaaRN73qkmJJA7kU4Y8ex0rmFEpXOdYeD4yUogt4RTV7c1zvCcrTq+r3qD4cJBCi+F
z+vc51QVrbUdoRfL1C+mfmBgm8rQyLljK2uWrPocg7u3m9H3dnVtUNO1RETX0u01O5re280mMtGM
9lybZaPRxN5uWptPpSOH4HNiXEpHs9psz7yejmVjGTp4AMdPgX98iCVU2Hm6TpWpWy2FGeYPM8yr
qWp47frnfSEJbLxtz9tqQzh+lRCG3iMTN7NJQLTo1gVDX4kkykGrJrwqrzUJyZRcizfXuGerfQgm
K3bD4X7gkT38JqCGt4TpbNvSJvfq4UNmGO/0/nmPx2h6xQ08SzyzlfpQeGbthB7moCGqGoIIhtCD
GO3u0u4e4VQQ9E5l9K9If8blqS8Y+qg6Rj7qInlj0HGf7NQ+E0lkaX3Q5sRRCFkJWpfpi7NwM4Rh
jFC4jjBX/4QZ/dQRJnUsTO5ImCud0mN/l77ZKd37r9IaHrb/d7BC6zNCb1G5JtYRMTFpYsrEbUyb
yGPGhIHZdTBV3Pl1JCV6JLISC1LZwxKLEjmJMYml31BLAwQAAAAAAAAhCCECh4DKOAYAAAAGAAAA
MwACAE1FVEEtSU5GL2FuZHJvaWR4LmFjdGl2aXR5X2FjdGl2aXR5LWNvbXBvc2UudmVyc2lvbgAA
MS44LjAKUEsDBAAAAAAAACEIIQKHgMo4BgAAAAYAAAAvAAEATUVUQS1JTkYvYW5kcm9pZHguYWN0
aXZpdHlfYWN0aXZpdHkta3R4LnZlcnNpb24AMS44LjAKUEsDBAAAAAAAACEIIQKHgMo4BgAAAAYA
AAArAAEATUVUQS1JTkYvYW5kcm9pZHguYWN0aXZpdHlfYWN0aXZpdHkudmVyc2lvbgAxLjguMApQ
SwMEAAAAAAAAIQghAoYHy+8GAAAABgAAADwAAABNRVRBLUlORi9hbmRyb2lkeC5hbm5vdGF0aW9u
X2Fubm90YXRpb24tZXhwZXJpbWVudGFsLnZlcnNpb24xLjMuMApQSwMEAAAAAAAAIQghAoYHy+8G
AAAABgAAADcAAQBNRVRBLUlORi9hbmRyb2lkeC5hcHBjb21wYXRfYXBwY29tcGF0LXJlc291cmNl
cy52ZXJzaW9uADEuMy4wClBLAwQAAAAAAAAhCCEChgfL7wYAAAAGAAAALQADAE1FVEEtSU5GL2Fu
ZHJvaWR4LmFwcGNvbXBhdF9hcHBjb21wYXQudmVyc2lvbgAAADEuMy4wClBLAwQAAAAACAAhCCEC
rDPoTT0AAABDAAAAMAAAAE1FVEEtSU5GL2FuZHJvaWR4LmFyY2guY29yZV9jb3JlLXJ1bnRpbWUu
dmVyc2lvbitJLM5WULdKLErOsErOL0oFE7pFpXklmbmpVuVFmSWpYalFxZn5eW6ZOanqCgVF+QWp
RSWVCuplEGF1LgBQSwMEAAAAAAAAIQghAmiofv0GAAAABgAAACsAAgBNRVRBLUlORi9hbmRyb2lk
eC5hdXRvZmlsbF9hdXRvZmlsbC52ZXJzaW9uAAAxLjAuMApQSwMEAAAAAAAAIQghAlpYoMoGAAAA
BgAAADoAAgBNRVRBLUlORi9hbmRyb2lkeC5jb21wb3NlLmFuaW1hdGlvbl9hbmltYXRpb24tY29y
ZS52ZXJzaW9uAAAxLjUuMApQSwMEAAAAAAAAIQghAlpYoMoGAAAABgAAADUAAwBNRVRBLUlORi9h
bmRyb2lkeC5jb21wb3NlLmFuaW1hdGlvbl9hbmltYXRpb24udmVyc2lvbgAAADEuNS4wClBLAwQA
AAAAAAAhCCECWligygYAAAAGAAAAPgACAE1FVEEtSU5GL2FuZHJvaWR4LmNvbXBvc2UuZm91bmRh
dGlvbl9mb3VuZGF0aW9uLWxheW91dC52ZXJzaW9uAAAxLjUuMApQSwMEAAAAAAAAIQghAlpYoMoG
AAAABgAAADcAAQBNRVRBLUlORi9hbmRyb2lkeC5jb21wb3NlLmZvdW5kYXRpb25fZm91bmRhdGlv
bi52ZXJzaW9uADEuNS4wClBLAwQAAAAAAAAhCCECTP7ZXAYAAAAGAAAANQADAE1FVEEtSU5GL2Fu
ZHJvaWR4LmNvbXBvc2UubWF0ZXJpYWwzX21hdGVyaWFsMy52ZXJzaW9uAAAAMS4xLjEKUEsDBAAA
AAAAACEIIQJaWKDKBgAAAAYAAAA+AAIATUVUQS1JTkYvYW5kcm9pZHguY29tcG9zZS5tYXRlcmlh
bF9tYXRlcmlhbC1pY29ucy1jb3JlLnZlcnNpb24AADEuNS4wClBLAwQAAAAAAAAhCCECWligygYA
AAAGAAAAOgACAE1FVEEtSU5GL2FuZHJvaWR4LmNvbXBvc2UubWF0ZXJpYWxfbWF0ZXJpYWwtcmlw
cGxlLnZlcnNpb24AADEuNS4wClBLAwQAAAAAAAAhCCECWligygYAAAAGAAAAMwABAE1FVEEtSU5G
L2FuZHJvaWR4LmNvbXBvc2UubWF0ZXJpYWxfbWF0ZXJpYWwudmVyc2lvbgAxLjUuMApQSwMEAAAA
AAAAIQghAlpYoMoGAAAABgAAADoAAgBNRVRBLUlORi9hbmRyb2lkeC5jb21wb3NlLnJ1bnRpbWVf
cnVudGltZS1zYXZlYWJsZS52ZXJzaW9uAAAxLjUuMApQSwMEAAAAAAAAIQghAlpYoMoGAAAABgAA
ADEAAwBNRVRBLUlORi9hbmRyb2lkeC5jb21wb3NlLnJ1bnRpbWVfcnVudGltZS52ZXJzaW9uAAAA
MS41LjAKUEsDBAAAAAAAACEIIQJaWKDKBgAAAAYAAAAwAAAATUVUQS1JTkYvYW5kcm9pZHguY29t
cG9zZS51aV91aS1nZW9tZXRyeS52ZXJzaW9uMS41LjAKUEsDBAAAAAAAACEIIQJaWKDKBgAAAAYA
AAAwAAAATUVUQS1JTkYvYW5kcm9pZHguY29tcG9zZS51aV91aS1ncmFwaGljcy52ZXJzaW9uMS41
LjAKUEsDBAAAAAAAACEIIQJaWKDKBgAAAAYAAAA1AAMATUVUQS1JTkYvYW5kcm9pZHguY29tcG9z
ZS51aV91aS10ZXN0LW1hbmlmZXN0LnZlcnNpb24AAAAxLjUuMApQSwMEAAAAAAAAIQghAlpYoMoG
AAAABgAAACwAAABNRVRBLUlORi9hbmRyb2lkeC5jb21wb3NlLnVpX3VpLXRleHQudmVyc2lvbjEu
NS4wClBLAwQAAAAAAAAhCCECWligygYAAAAGAAAANAAAAE1FVEEtSU5GL2FuZHJvaWR4LmNvbXBv
c2UudWlfdWktdG9vbGluZy1kYXRhLnZlcnNpb24xLjUuMApQSwMEAAAAAAAAIQghAlpYoMoGAAAA
BgAAADcAAQBNRVRBLUlORi9hbmRyb2lkeC5jb21wb3NlLnVpX3VpLXRvb2xpbmctcHJldmlldy52
ZXJzaW9uADEuNS4wClBLAwQAAAAAAAAhCCECWligygYAAAAGAAAALwABAE1FVEEtSU5GL2FuZHJv
aWR4LmNvbXBvc2UudWlfdWktdG9vbGluZy52ZXJzaW9uADEuNS4wClBLAwQAAAAAAAAhCCECWlig
ygYAAAAGAAAALAAAAE1FVEEtSU5GL2FuZHJvaWR4LmNvbXBvc2UudWlfdWktdW5pdC52ZXJzaW9u
MS41LjAKUEsDBAAAAAAAACEIIQJaWKDKBgAAAAYAAAAsAAAATUVUQS1JTkYvYW5kcm9pZHguY29t
cG9zZS51aV91aS11dGlsLnZlcnNpb24xLjUuMApQSwMEAAAAAAAAIQghAlpYoMoGAAAABgAAACcA
AQBNRVRBLUlORi9hbmRyb2lkeC5jb21wb3NlLnVpX3VpLnZlcnNpb24AMS41LjAKUEsDBAAAAAAA
ACEIIQIP+e/WBwAAAAcAAAAnAAEATUVUQS1JTkYvYW5kcm9pZHguY29yZV9jb3JlLWt0eC52ZXJz
aW9uADEuMTAuMQpQSwMEAAAAAAAAIQghAg/579YHAAAABwAAACMAAABNRVRBLUlORi9hbmRyb2lk
eC5jb3JlX2NvcmUudmVyc2lvbjEuMTAuMQpQSwMEAAAAAAAAIQghAmiofv0GAAAABgAAADUAAgBN
RVRBLUlORi9hbmRyb2lkeC5jdXJzb3JhZGFwdGVyX2N1cnNvcmFkYXB0ZXIudmVyc2lvbgAAMS4w
LjAKUEsDBAAAAAAAACEIIQJoqH79BgAAAAYAAABAAAAATUVUQS1JTkYvYW5kcm9pZHguY3VzdG9t
dmlld19jdXN0b212aWV3LXBvb2xpbmdjb250YWluZXIudmVyc2lvbjEuMC4wClBLAwQAAAAAAAAh
CCECaKh+/QYAAAAGAAAALwABAE1FVEEtSU5GL2FuZHJvaWR4LmN1c3RvbXZpZXdfY3VzdG9tdmll
dy52ZXJzaW9uADEuMC4wClBLAwQAAAAAAAAhCCECaKh+/QYAAAAGAAAAMwABAE1FVEEtSU5GL2Fu
ZHJvaWR4LmRyYXdlcmxheW91dF9kcmF3ZXJsYXlvdXQudmVyc2lvbgAxLjAuMApQSwMEAAAAAAAA
IQghAj8/HHIGAAAABgAAACcAAQBNRVRBLUlORi9hbmRyb2lkeC5lbW9qaTJfZW1vamkyLnZlcnNp
b24AMS40LjAKUEsDBAAAAAAAACEIIQKCwqeLBgAAAAYAAAArAAEATUVUQS1JTkYvYW5kcm9pZHgu
ZnJhZ21lbnRfZnJhZ21lbnQudmVyc2lvbgAxLjMuNApQSwMEAAAAAAAAIQghAmiofv0GAAAABgAA
ADMAAQBNRVRBLUlORi9hbmRyb2lkeC5pbnRlcnBvbGF0b3JfaW50ZXJwb2xhdG9yLnZlcnNpb24A
MS4wLjAKUEsDBAAAAAAIACEIIQIGTqppQwAAAE4AAAA7AAAATUVUQS1JTkYvYW5kcm9pZHgubGlm
ZWN5Y2xlX2xpZmVjeWNsZS1saXZlZGF0YS1jb3JlLnZlcnNpb24rSSzOVlC3yslMS02uTM5JRbB0
czLLUlMSSxJ1k/OLUq3KizJLUsNSi4oz8/PcMnNS1RUKivILUotKKhXUyyDC6lwAUEsDBAAAAAAI
ACEIIQIIicy8PgAAAEkAAAA2AAAATUVUQS1JTkYvYW5kcm9pZHgubGlmZWN5Y2xlX2xpZmVjeWNs
ZS1saXZlZGF0YS52ZXJzaW9uK0kszlZQt8rJTEtNrkzOSUWwdHMyy1JTEksSrcqLMktSw1KLijPz
89wyc1LVFQqK8gtSi0oqFdTLIMLqXABQSwMEAAAAAAgAIQghAo9rvj48AAAASAAAADUAAABNRVRB
LUlORi9hbmRyb2lkeC5saWZlY3ljbGVfbGlmZWN5Y2xlLXByb2Nlc3MudmVyc2lvbitJLM5WULfK
yUxLTa5MzklFsHQLivKTU4uLrcqLMktSw1KLijPz89wyc1LVFYAyBalFJZUK6mUQYXUuAFBLAwQA
AAAACAAhCCECY8JIuEEAAABMAAAAOQAAAE1FVEEtSU5GL2FuZHJvaWR4LmxpZmVjeWNsZV9saWZl
Y3ljbGUtcnVudGltZS1rdHgudmVyc2lvbitJLM5WULfKyUxLTa5MzklFsHSLSvNKMnNTdbNLKqzK
izJLUsNSi4oz8/PcMnNS1RUKivILUotKKhXUyyDC6lwAUEsDBAAAAAAIACEIIQJfOIhePQAAAEgA
AAA1AAAATUVUQS1JTkYvYW5kcm9pZHgubGlmZWN5Y2xlX2xpZmVjeWNsZS1ydW50aW1lLnZlcnNp
b24rSSzOVlC3yslMS02uTM5JRbB0i0rzSjJzU63KizJLUsNSi4oz8/PcMnNS1RUKivILUotKKhXU
yyDC6lwAUEsDBAAAAAAIACEIIQJCaFj3QwAAAE4AAAA7AAAATUVUQS1JTkYvYW5kcm9pZHgubGlm
ZWN5Y2xlX2xpZmVjeWNsZS12aWV3bW9kZWwta3R4LnZlcnNpb24rSSzOVlC3yslMS02uTM5JRbB0
yzJTy3PzU1JzdLNLKqzKizJLUsNSi4oz8/PcMnNS1RUKivILUotKKhXUyyDC6lwAUEsDBAAAAAAI
ACEIIQIjDU+uSgAAAFUAAABCAAAATUVUQS1JTkYvYW5kcm9pZHgubGlmZWN5Y2xlX2xpZmVjeWNs
ZS12aWV3bW9kZWwtc2F2ZWRzdGF0ZS52ZXJzaW9uK0kszlZQt8rJTEtNrkzOSUWwdMsyU8tz81NS
c3SLE8tSU4pLEktSrcqLMktSw1KLijPz89wyc1LVFQqK8gtSi0oqFdTLIMLqXABQSwMEAAAAAAgA
IQghAif/U8A/AAAASgAAADcAAABNRVRBLUlORi9hbmRyb2lkeC5saWZlY3ljbGVfbGlmZWN5Y2xl
LXZpZXdtb2RlbC52ZXJzaW9uK0kszlZQt8rJTEtNrkzOSUWwdMsyU8tz81NSc6zKizJLUsNSi4oz
8/PcMnNS1RUKivILUotKKhXUyyDC6lwAUEsDBAAAAAAAACEIIQJoqH79BgAAAAYAAAAnAAIATUVU
QS1JTkYvYW5kcm9pZHgubG9hZGVyX2xvYWRlci52ZXJzaW9uAAAxLjAuMApQSwMEAAAAAAAAIQgh
AoYHy+8GAAAABgAAADsAAQBNRVRBLUlORi9hbmRyb2lkeC5wcm9maWxlaW5zdGFsbGVyX3Byb2Zp
bGVpbnN0YWxsZXIudmVyc2lvbgAxLjMuMApQSwMEAAAAAAAAIQghAqJRbE4GAAAABgAAADMAAQBN
RVRBLUlORi9hbmRyb2lkeC5zYXZlZHN0YXRlX3NhdmVkc3RhdGUta3R4LnZlcnNpb24AMS4yLjEK
UEsDBAAAAAAAACEIIQKiUWxOBgAAAAYAAAAvAAEATUVUQS1JTkYvYW5kcm9pZHguc2F2ZWRzdGF0
ZV9zYXZlZHN0YXRlLnZlcnNpb24AMS4yLjEKUEsDBAAAAAAAACEIIQJM/tlcBgAAAAYAAAAxAAMA
TUVUQS1JTkYvYW5kcm9pZHguc3RhcnR1cF9zdGFydHVwLXJ1bnRpbWUudmVyc2lvbgAAADEuMS4x
ClBLAwQAAAAAAAAhCCECaKh+/QYAAAAGAAAAKQADAE1FVEEtSU5GL2FuZHJvaWR4LnRyYWNpbmdf
dHJhY2luZy52ZXJzaW9uAAAAMS4wLjAKUEsDBAAAAAAAACEIIQINz8JFBgAAAAYAAABAAAAATUVU
QS1JTkYvYW5kcm9pZHgudmVjdG9yZHJhd2FibGVfdmVjdG9yZHJhd2FibGUtYW5pbWF0ZWQudmVy
c2lvbjEuMS4wClBLAwQAAAAAAAAhCCECDc/CRQYAAAAGAAAANwABAE1FVEEtSU5GL2FuZHJvaWR4
LnZlY3RvcmRyYXdhYmxlX3ZlY3RvcmRyYXdhYmxlLnZlcnNpb24AMS4xLjAKUEsDBAAAAAAAACEI
IQJM/tlcBgAAAAYAAABBAAMATUVUQS1JTkYvYW5kcm9pZHgudmVyc2lvbmVkcGFyY2VsYWJsZV92
ZXJzaW9uZWRwYXJjZWxhYmxlLnZlcnNpb24AAAAxLjEuMQpQSwMEAAAAAAAAIQghAmiofv0GAAAA
BgAAAC0AAwBNRVRBLUlORi9hbmRyb2lkeC52aWV3cGFnZXJfdmlld3BhZ2VyLnZlcnNpb24AAAAx
LjAuMApQSwMEAAAAAAAAIQghAp3a2xAFAAAABQAAACsAAQBNRVRBLUlORi9rb3RsaW54X2Nvcm91
dGluZXNfYW5kcm9pZC52ZXJzaW9uADEuNi40UEsDBAAAAAAAACEIIQKd2tsQBQAAAAUAAAAoAAEA
TUVUQS1JTkYva290bGlueF9jb3JvdXRpbmVzX2NvcmUudmVyc2lvbgAxLjYuNFBLAwQAAAAACAAh
CCECUEtZjzIAAAA2AAAAPgAAAE1FVEEtSU5GL3NlcnZpY2VzL2tvdGxpbnguY29yb3V0aW5lcy5D
b3JvdXRpbmVFeGNlcHRpb25IYW5kbGVyy84vycnMq9BLzi/KLy3JzEst1kvMSynKz0zRc4TQrhXJ
qQUlmfl5AUWpHkC5nNQiLgBQSwMEAAAAAAgAIQghAn9ZlUsxAAAANAAAAEMAAABNRVRBLUlORi9z
ZXJ2aWNlcy9rb3RsaW54LmNvcm91dGluZXMuaW50ZXJuYWwuTWFpbkRpc3BhdGNoZXJGYWN0b3J5
y84vycnMq9BLzi/KLy3JzEst1kvMSynKz0zRc4TQLpnFBYklyRmpRW6JySX5RZVcAFBLAwQAAAAA
CAAhCCECRnB4jjECAACgAwAALAAAAGtvdGxpbi9hbm5vdGF0aW9uL2Fubm90YXRpb24ua290bGlu
X2J1aWx0aW5zhZDNTttAEMd31x9ZT0JiDKUp/aKhqnKqwo3rxhhiauxo7SA4RW7YotDgVMGh4thL
+xZ9CE59rjxB13hJekCqpZ9m5+M/4xmEkIYQwqj8KvBbA/PrNJ+MM4A0y6Z5mo+nGWyw5ZuLXGQP
Qd3L5tdgxtGAux6YXT9k/BwqfBAm/okH9kqTpLNLkYPhBiyOZSIMo4QlfhQOy0g9Oe97wz7j7MRL
PA60z6O+x5NzMA59LziAehC5LBieMu6zbuBB45QFg38VVTcK44QP3CSS8sNB6BbtofHYaHjkJUXd
KhCXAb0YDeCd9bkXx4VGP/TlBKuIs8BnMVTjcTYSn8qrVG7F7KbYXtv7uAeWO5lmIv08EaCx7A6M
UeGDfTK/ybviYDqaX8tjiQuA1THAVOeop5PJ9Lu4KN0bAC6+iTR/6GatzmzcppO5AIPNZumdcwXE
RqBTZGMwKbZJE0mLbO3BYrui/OfKbiv7UuVfK/+N8t8q+07Zlsq/b6Jt7Y+FW2368wdxMG6SLqHk
ilBdYkjMBa4B6RAwHfkTHa11+Vipq0oqsSQgqUpqkjVJXdKQ2JJ1iSPZkGxKnl2t0617q0YNh9Km
o1PaflEO0peDtugXB6OmeWzar/ZRb3OBdZmvtD7QX6RI0C4qQ9a95VBw6nTHAVo7Nil09H1rWVf9
T92+qqt1qWNSYu+2Mdft3R5eYFqoiu2fVh4pJRRKe6dNOoVyp0cW2FFKHajcDjdxZ+3JHveWPOBf
UEsDBAAAAAAIACEIIQLPMBz08QUAAGUOAAAuAAAAa290bGluL2NvbGxlY3Rpb25zL2NvbGxlY3Rp
b25zLmtvdGxpbl9idWlsdGluc71W3XbTRhDWSrIkr2Wi2IEoQIhxiDGhpQbaIgKlJT/U+QFSAilt
6Y9IFPBBkVJLTkkfoNe97BPwAFzxEtz29DF6/ASd3R39hRxOL3qac6LZb+fb1cw3M0okSVIkSSKS
+NHpW51qL8LY7wW0shX6vrcV98IgoiPzYeh7brAce303DvvUSFc6uqgaeC9jWmHPZMucP4i9lKky
RA1OYCtz4bnbz7wMCS9flRf8MPDcp75HldvBAS1tMUzpQhoWJUsYByOpUe9XoC4HMTW2wiB2exC3
7vnergdblWTrtu9TA3fB34uWdvfiA2r0kjiOLYYDuC+NSxOYUhYZrqt3/NCNU0qJQ1pmDLGsQBiZ
QmyfxUUeUv25G91jOqlrvSimyjMvpqVesO29hFiYub9DK74bAV8A0wdeepW5lkd6NHjKrynv9MPd
ZXFLHIpFBd603vf2e+EgEqGJfWMv2awmK+Ew18LgWVYOhkQ5+Eq56+7R0lIQ9w8oWaVkkyovPKjK
vusPPNAZHD0vosoGJKSCJ6Iad0WZ9KvAryZgk58zIf/7/UVvxx34MTW3xUL4Khu9YMtbFd2o73v9
iNVcuXzpMlQrgDgD16ej674b74T93UVvz4M0QOXRu4OYdUSuUUZwK20Wxd3epho8WDtAZ3nQcOqj
oBcXqbz+fW833PdoWVh2AJYsB7asIJ2XoZ4D2aTgOSh2BNpQ5DA5TVwLVQ1wi8xB9V/EKmEzVZW9
QUw1eLD3qqzitLrxPOzn+pBDUWy+rL2RqWxJVDUki1DNIJZsS9wq3EqWilhHbCCmiCtoq2iPod9C
W8P9McSnEJ9GfAbxFOKzaGfQXkR7FXkfI/6U23HrGuLP0L9oi2y+BHTK6qJ3Ge0Ksu4hvo92A+1D
tF9zO209Rvwd2h/x/E+2dFJ5UybNC0arRogtz0srulVypO5v8opmabBoDYlJ5Y5KtRpo2lESaqlI
LWdU7TBVL1LNjGqk1BPGTo1Idhn8I+AfGxIV/LT5M9sndmWWhTvaICtV6/gV1TrRVh2l+0peMa1x
gHa7BLAFhye41a2TjgbuB7pV78qPX6lD0qZydxRfx15d5UnJjsT31E4FbRr1sWLUk1nUI4cTtIrU
RkYdPUytFanNjFpNqReFFibPeRpyZunIkM4Q+hVESaMmQO4IspIjn3MIk4a9RpwyxSmRb/NPIjSt
/ztNq1YL0Pm27KjC2UaufITg4L5QcM86OljTmsU7GKpZHwD6sC3D8xLsGd1WrlBOrlCV9xUK7Rja
evOJyGusIAVTAOL4iMfDJFHERgfSYQFexsa5wvCQ2PD26aQS6ZshiqSAx4sF/CQr4Im0gI6oiQ2B
yJbTIGAV63qDQJZzXQJZwuIGpou1ceAD5ijNv4g4Oj7Lht+ZZcMKB+fINdDwC9Brrk2YXoBuA7oh
1MMaMV+ZZdey5gWE5wJQ5O7467JpnKwZxlJNNYz2nddl2TjNqyfEv9lVRVi3uiWxqHc1sfi8q/NA
b6WtJzuEUtZ+8Ct3bJ620pnAlpxIe1nm9VOpahOHNP9gqclEtid5bqOQwmradSyhtcIg34V+En2l
i75aL5C/ypFN60GGhqRTaCBhz7zTRHJnCteN5lXROGcKA6fw0cn3g5leIMOhWXGokR7SrHXWZHxI
Cz001fxdxtzPHpl7jaPzbQ33SnxvLd2z23pBIz3VqIRDZuSGTEN0lGDJPY+QqebkE766tVmIhQ99
MrEan1gNugzSvJnTuY52MjcyU2kjZEPbRHu2+QwVaXJFpg8pwia3lHzEVDGx6xj7ZsYbkkZO6zG0
DfFyHoTavMnqJNvn4D0wjPCEUYRbvoFbvm0r4hZWZfbduc77WuJ9bPOB/JuI49M4kCobyDnymKtf
5nV6wmdN4eOoOpTH+D2gH9oVzhCVAAb3tRKEfPPo2eQzqSUzqSejaPBRfHJEuOOF0VS4yue4IKXO
DI7oDKo/yQXiY0lNeClB/jgXLB3Umf9xUCfeaaCjBhX/G5j4T/8beO8fmeSz3yp+9t3ss38+mfR/
AFBLAwQAAAAACAAhCCECQ+Gfxp0AAADIAAAALAAAAGtvdGxpbi9jb3JvdXRpbmVzL2Nvcm91dGlu
ZXMua290bGluX2J1aWx0aW5zPYpNCsIwEEYnP43trEIRKV32BIIbt1oQ0Y0LPUANqYaGBPqz8Gae
yxMYjTibx7z3AQADAALxZtii6PxojcOstt7p5mo1so17YKI+P67ujerOfud7pY/f5XYydjRuCCqK
2vd+CkYPp7Btbhr5xZkRUf1DXiGVgCIFSYpI+mMSyANFmZdC8jXs6YtwpEv2zHi1SNucQEEOQrKQ
5jHRN1BLAwQAAAAACAAhCCECDTPS2IoBAACGAgAAKAAAAGtvdGxpbi9pbnRlcm5hbC9pbnRlcm5h
bC5rb3RsaW5fYnVpbHRpbnN9T8tO20AUHT8yub55dBhoGrHoIitWCFZka4xRQ9XEmhikrJAbJmDh
jitnoGLJr/AJWfFd/YLa8aSpFKmzOfece84ZXUKIQwixSP2a+GYjfcx1lir0gixXMvmeSXR89YKN
ecURUqVloZIM+yOli1Qt03mQq6UOn5PsKdFprhB9pXJt5mQ70zgp7qXGbpJl+S95V9Mlsq3fOFrB
ZDyNxXUQTwTC5fU4iEeTMUIkJlEo4hl6Qmqp1q2N6mOJ+9uS7Y6ej8a+mGFrmqq5/Fpf1nyWxbLa
OqfHZ7gXZYle5MWPC/lTqrsyiJ3oqZBCpot0fX43nkXhbeQL/1sYh4I/oM0IUiDM6tdol+iW6JbM
YQ2jUqM2S0YZrFXK0GDXIDNuvkaHfTTY65ND591zBj1YcIv0rSvKnCH5cvDbctE+sQc38GpXC/ec
1FJj5Q2gyT+Dxw+hfUUBT2DYMrjhnZXXLQ0IH3gl4HBv5bWhxQH2uQtwdDA4M73tf3p52VvHNj3t
nZ6/wc5/g592gn8AUEsDBAAAAAAIACEIIQLdiX/3hBQAANBIAAAdAAAAa290bGluL2tvdGxpbi5r
b3RsaW5fYnVpbHRpbnPdW2t0G8d1xuxiHxiA5AoSSYixJQhxKFqySZj0A5Jj0wAJCqBIkAZAW3aa
KktgKcIGARpY2GKcWHbTSnnUbfqyW6fvpm6b9JEqaes6aev0kT7TntMf/d3f/ZMc/eovq3dmZx8A
BiTgiOlpec5iZu7euXPnzp357swsfT6f6PP5kM/6U/D7Y1h+vm5WKzWMk7Va3dTNSr2GxWRtD8vG
Cy292sRKql6vGnoNS3Vz22hgdVtvbi/UywYWszUTq2a9YDYqtStYZqmUbDT0PYyK2N+sfNLA/kqt
YuLAUqtWItIfwOIVw8RSpVY2rmK1YhoN3aw3cLBUr1YNytLEatYmi01g9m8QEdKLerVl4MBCfWdX
rxFFg4VKrWRctHqgvGg0mlT9B6bnMKZcDX2zCorqtTK0VAOZNb2KI6A3aNqslBagLTNNxFodD5Ro
JaNYxyJYAwtEgavwE2JGsLo2wkqOkv7UngmKrSYvXX4qubKRhmw2Z2cL2WfTl1PZYgFjK/tMMV3A
cq61swnmlBfrLaKjtFSt69DTlToxYWG73jCxWDZK8FN5EYvQTyztVGqtJvbvVuFXaei1K0RRmWaI
yWpmnmRxgMiwspi+3KiZlSoxyzk88rTeTF/dNRqVHaNmgjGCO3rjeaOxUNWbTTzqfVUwy9XKZnK3
gsWGsUOqP4AlE142sWzWaY8hXdjWof/0Fy8auw2jpJtGGSvA1tRBg2cXK0Azo6V6jY1P1KxHCX+0
0oyWnRrT0Y2mAa+gF1P3Tltyp+6N1hsWb4mMVKNVAmtHYehMQy9P42DD2K3qJePpirmNg3lPQans
7IIFmxgbV6GFJvWLUXO70pzubAKPump73Sn0kt6ogT9TGun9QyCs0ag3GGEWnAycnw2fYtatAZSo
fGIZOpJAt8YSt2p6Y2+VjmCA5tfJMAaIHS2vCpGs41Jh4kyZ7IXM5cJGPr92IVlM4yOEtrL2tIc0
REhuMUz8rqsW0DprAcktBoglLIe5uOCOU33Lsj2Ml+WsvBEjHNMlWA6iu406OI+5545PmBqcvJy2
HAasfcxLs4wH1KNeKjUkEAMOsV0SMWxnHWpkUofow+xJso49aakAa5pBRk+uGrUrxGmarU2HiJum
3jCz1rpk1MpWLrBQrdcMuo5IJZLFx8FGpnHVtFe04t6usQ5LzU4TOOotGH2su4upXNQbZMEb1qvV
+ktG2So2seYuuIzDX3xmPY211VbTTBmL9VKLzEOYS+B7j2CparxoVLFmOytUW6EUaWElWShgdWkj
t1DMruWwup5fW0/ni89AE7ncWjFJqJctruDCWq5QzG8sFNfyeMRmvFxIF4tpL+GCRQgQjZIr2STU
3K6Uy0bNmQ0PYn+61trBytPJfC6bu4ClNLhTHsuZ7OJiOoeP5NLgW9mn0pezuaVsLgvqiDkd6Otr
hWw7/dmNWgmW04ZnjZiOFutRvbRdgS5GAXaiTX3HiMJEblXtpcQkfglTLQozvFopVczqXhTWecJN
lxjib9NYc6c7c8CPHUpr1P+m8RG3Odsjg5aTWz45bBUcrwwsNqurdAHGgbxhwngTlznquoZLlFPZ
XDL/DEZp7K+BflipN8oVgmdDefBgWGWba7vgvVhifrGUTa8s4uGVtYXkCmBRPptMraTxCEWly+vJ
fHI1Tcb4eNua39osESSwJMEwJwgmgArETF5/x5jOUqtXQzTvdEq1GTHKE+QC+GpuV7G6WTEX6PSA
ImBGi/wS1LKEBCHn2oXMcTaNSdZ5oeQgCiFRxreEQwSW7FZ0r96K1kFwo1ImtVmtLdYzYCUcDWdh
rEFoVAEZ90Ur5ukm+A5EEmDSslEmWl1p6GUIpsBnHL2on7EGoD+uZMerAHThPcibxgXDiG6b5m7z
/MwMNGs29NLz088Z5mZDB51hDdyZqTSbLWPmYvH+Bx9+8OGHolvQnbJh6pVqM6pvQhXa3k4FNKEj
I1kjrDSMLRJ0YfmiFQHg9KX1fLpQIAuJfykLDiMX1jbyC4AZdIkDd2zkiPeF1sGRK81to0wiBEy9
nXkDzTsjNtrmU8xVIRwrtHYpMmOJeHMTD5O1xuOXgeJ2o/4SW3f1VtPAwxu1pr5lPKU3KjpZhRSd
tLe2Baq1GkbeqGxVKLtqVA3izk0cYhy5VhUi2eFNTxAH1YKbNvaSQskGDiKw7M5ZKGJjZ9fcY25q
wKr3FAlE6Qu7AG1tOROCvKnUnHywajszFEJNx1JrW+F3JCxoPiyrPg1FrFRgqZ+lCksDLMUsHYbU
D2kYSqp2lFFHaSpq46wcYemHGPfdUBrWTjDqh2mqavew8kdoGnZqn2HpWZbex9L7WTrNpD4EpePa
w5R6XHuEvT3P0o+yNMXSBZZeYOlFlj7NtLlE0xNMi+PaZfb+Cnu/zcoVltZYusu0gaBaPas1KfWs
1mLpS4zrk5AqkP6EZfBR2gwhfBHRjKr9DGKUn7UyZ7WfszM/b1WKO5V+yXqT0N6yK/2qnfl1i3fM
4f0Nu4HftFl+y2LxOyxfsVm+ar0Zd978vv3mD+zKf2hnvkYyEmT+GEE5o920X/ypnfkzS1rEkfaO
Le3PrTeS8+Zdu8437cxf2pn3rMyw9teQmfimOHFC+zaKBeFNMIJuBgS1OKtof4OmhLgvgTLX1YmI
9rcd7/1aaEpK+CeGtb9DFrMcVxIylL/Dymo8kFCh/PesjOPBBIbyP7ByKD6UCE2Mav/YLtlq8F7t
n1AsYJFn0fCspL2JpkYSvswN9WYgpIbCqno87FfVqccnYto/e1mhfjfPsPYvrFUtfiShQfm7rByO
S4kwlP+VlY/GjyWOQvnfWHk0PpYYnRjR5qDH0lQkMfLEeOa6MCFrKmQjt9CnsJAJYjkMkz0uYxXa
QzTnjyBGF6EkxP3waPCI8MTgCcMzCc8JeGbhGWUy4pCHpST+GDxj8CThWYRnHJ5VeCJEMnCQX+Gd
gC82rG6FkS+CbiHShBA7r45FhJRveUgTqcoIjPaGsCxrckLIjC0TxcXM2C0UpspQMUw9KdYikuQz
ZOoFU8PqWJiMMoLfoSkRBI6AQA0ECmCBZUU7kvCTzFHtmEWH37EpISEBMQ8VM6DSPUQlS3zChzH0
EMEjxBXaWyEegHc4FlNviKTlYEpQBdaP9hGciH0FhRGKiNHx82icsC2Htbto/3zEKfzEdUaAdpLR
hMybgk2z7CACn00LaVFSy+E41SUpCGbyZ8Zthlgnwy00Qe1nDdoQ7aJtSynWJL3ROi2Ykq3SB7Jk
1LUkNOu1pBA/Qq14Tb1OrXiUmCc/ok1m0KXrxXcDZD15HwHhtIdwG+VPalMJOSNculHssPW7AT/g
jgYM9+7HACMVYkoRX/LH/gu08gmRsHeMTjIfFD3jYdH8QLvRQZM4NJFDkzk0xUNTtBmyjBAF4o4C
boU4U8DfRZPA5p00kVNXBsN00pQ2PsvpYAV0Oq5oD9hKzXKUmuUoNctRapaj1CxHqVmOUnOcduc4
7c5x2p3jtDvHaXeuq90h7UHWLibdt4tie1FOBL1FxXo7oyWcujc6FoVzNwOaelc4pD4KpNCyXw3E
73YqiINWIO0PVEHpt4VT2mNtdm+DJstENos9DPuw2KOyD4t4cEP2mO3DovSWEtbmOZ40z/GkeY4n
zXM8aZ7jSfNdnhTUnoApxFblJ7VkIkQKZ9SToOAiVTAdvktdCkfUYOqYGg3LaiYsUPWz9O3yzcCY
egqKK7S4Crkcza3Z8tfdVT+oPQlqO4U86OEUCqCoUygmFLegJobsQkjb8Oge0p5yS7fQ47BkHqNL
J4EQxCCExAEW7o9TrPdCNAGcD7GIgUFM7NAgJtwBMR+mEPO6wDDmHooxmvYMgxRZRdr735OB8qyX
cptQPtZBOaVNgvUQD1YsFgUq/Yin0qv/ScR83Ev5PqH8aAfPSe10L8EQlWm+gxAvehDi+V3EO0ER
77sSCUpOdAOeNwAhYOSz1n3RQT4vKPi8oEBqdi7iQluwMtdFs9dMHx1OZ4HycVYK7gJ1AaaVnFHa
Z9In9p1JOhHrmUm2+ydBLcUqXIDJpAwmdZMr9QJMRHUwQaUegvJg3YEElXsIKiQCgwkyeggqAooM
JGirh+VVwK9xtrg8TD3UG5t6F5KPsIitc6lhi8rkoS0qJzoWldN0UVmyNjBTbeLfJjPieShWqdQd
CjWTeUV7Dib42zARtTa5QnwqNmbJuRe2OHXwwmP2huh+iz50hpwZBKNkZ3SSTSEE7bhzmm5SYsvq
DYHwn6HdfmEKQU9eID1RgQURtpuBsHpfeFg1wximkKzi+P2JF4nlp9vn2tXYW4gJO5kiFl0Ei8qq
oC1NCTTdmxJB+F6G/C5mSENLGcHqGmLbQGK+mZuBVWgwCw2mnQZfZumnWPpplr7C0mvLCk1fRSzz
mp35MbrPno69bSt3KnWcqrPC1MtBqkD6GUQ7nwPNJChQBVe8lpAORbGbgSEwYgCMKIERfxzFzqrX
XxPIQjtD1tjnRPU6gp8b5OezyBq+GXv3HPsPxCDqAQpRo842KKjKp27Tv+9dA/JpD9m+Rs+PaZ9D
HrpF/f5toH++m/7f14D+BQ7/NYA4F2jaO0N2X6L2KspHPVDTyUK3X65fjlKsuRWgu6vRbrDh7aR4
O65D2135yZlLx24IcWgShyZyaDKHprTR+thdtSs1y1FqlqPULEepWY5Ssxyl5jjtznHaneO0O8dp
d47T7lxXu+7WAR0U0aODWaSDWcSDWeSDWZTeLO5OwtvzeY4l5zmWnOdYcp5jyfkuSxYgDKLR/30A
xgEAYzIffxKF7wY0Pg5oPOpB4wCgMXn9OmrfUkw4W4pVd5eC7/wuBQ24SynYuxRv335q/7799EF9
8wYddLfj2pLsdpySFZAcc0453d1OuOdux7PLmT20gGS0IyCZowHJCsPFB1M+K4ZAPMR/5WZgRH0o
HATVCHw9nPgFG77aXDp2lOHRI57DzdiXkToZRkIkHh0/o0JY8gaaRYis68NhetItQvKLaMpPYxkp
43diFtnqoH24q8KgQtGvAd0+2s2PgAQYefESO6vME1kZiJlmsJh5AzkHzW58KDF7CPSY1hmG2Dfs
EOFujylG1AT0eo/2+lziBuLZYRvMVQZzfaIrLHjFCQss0P+Sjf6/bGd+BTmRgh1JdAQKr3ZFDO1n
xRmm9fl9B/BlnuJeKP41EnpYkh7dV5IV/MW+bYceH6WhxxEn9FBU6e7bt69dA9JpD4mEHfmwG3IQ
ms/36m2gfb6d9t41oH2hg+8axBC9wwwSQzxxYJShulHGmDfKGOsvyuBFFLzI49CiDN55LS/y+KFG
GbzzWl7kcaejDN55LS/yOOQoo48Dyj4Ckf/VKIN3XsmLPP6/RxmSN8pA/2eijDFOlDF6UJTx2KFF
GWMdUcbjNMoYt44l5s+QC/kvo6hzgfuaDSNPUBgJOzCiwoL9PuxfR4B22kO7TWnW4WaP00+CBdbh
Zk8G1drXU6VjXwtSGPB3X7fSadBx3do+DU5yppUNF900Iq8TLmQOn3cKdUEDb3nv93qPBxf8670+
oSGk/TaRqRy82Pd72ccDD/5ln5fvFGe8egNAvxeAPEDhXwC6fD1u/NAgF4AD3+cNfGN4+BeAfWDa
nbkA7ANf+7oA7CnlmPY2mpW030Ft/nVM+10OdT+w7PeykAe+/MtCl49cFnpgil0W2tDW+5oPfYBr
vh6QBBb5Pa5FYp1z070Q9HvAi3dK3+tCsE4gI9kBYgIHxJANYmI3iCGKbDaI3eWAmA1giAJYigLY
F22cWqA4Ne7g1JDqpzhF/xC8OO15cdt9Ee19HccOSQ+4j/OckY5buxcLtsb7g61+dzS8nQpvR8Pb
+dyRHQ0PjniQx4OyHxC2+t3f8OCIB3k8KOsXtvrd8/DgiAd5PCjjwZZ/3+9WOlCsA7b8h/7dysA4
NzBs3Zk9Xx+A0wc+9oFsfcGWyIUtkQNb/e4PeXDEgzwelHXClgNOZF8XPOR9ndxzX4d6gl9oMPBr
tysH/M4z8BvvsXMb6wK/ji9hFg9t9zbesXtLU/CTI0sEX2JfpQe5vsixlG9Zpl8nTS6vwqAJxEBn
PbvgP0KDjNo5d9RA7Dq5+4b0SdCcpHlQlqQkPCEpGZxJV+swM41tOL8dPcTes89zL6TUsKw9OiXE
yaXuo+TWOUIvde0PmLMsh+LyzUBFvS9sqGZY7zrN/fQPcHj7dTvzDe9xbvuR7J+gzrNd+3B+OaVY
R+XkcvpN1HEt3d8F/eOxMpN20XO+ewbqTkLdWFdvr3Vebfd5BfBx1ko0NQxOmSXX7FqG2T5Lr9Uz
ZATCzr2/x/YYtJFBG3CWHq3FJu378XPt9+NWdHTOuRqvMzUS54W3UEqjd/32Jwl7U8T59zLkdzHD
qtofIZzr+/6jfayck4wV9rnYpPPFlgARogiU0x7KbaDcwU+0ItjzUXLkgx9o9xv+KQeEhJzwr/vD
4v7Dv+66CiwD3SHhgB8ltys1aMDXXbddKd6Hz3OcdgcN7rrrtrfb/eFzf8Gd0n4mgX7YwZ0y6JlE
39GgG9wd+K3wnQruDmzIHrN9478DP0pu96RBA7buuu2e1P3hc1fAdggfJfcZsCnegA31PK048KPk
yD5h2Pg+ZxA0FFs9tFAs0hGK5Wgo9jk7qAnRho7Tj9aOdwQEOcCvZcCvpZ4hzJcGu3bmQ7F92b/m
vez/OmiMhIhkQZBv2f1IWOz6LyUJLOLSLHOJMOJvdi2N3k+CrQ8liYQd4Cb/5kXG3MfGPD+sPZcY
y4iX3rTD7RgFdvf+fwp3fiN6IlZiVl2nVn10ygoUwarD7YHiB7xaJ5qcj/27PXZPpgJhRfsWolGR
BJmeAdHrCJr7LIL2PoM4XxdYI/QX6M58ZsBix4Ei1tgGFKBL+ZSqsq8+UwHISdpfQffAMcZSQxaZ
kfIqJBDSvOHPKyT4goz9fav7v3752En1O9RUmEYx5GMPRP6Pz760kWKPMVsWDvpYoTvGJr77svoa
rX7XQHuDOWhgBho4y5lYfPvyZs//AFBLAwQAAAAACAAhCCEC7Yo7ywwFAABHDQAAJAAAAGtvdGxp
bi9yYW5nZXMvcmFuZ2VzLmtvdGxpbl9idWlsdGluc8VU23LbRBjWSrK0Wp+2buI4p0Z1oDGhhCQF
6obTJMEzTmihk4QSZpgB1d7EmsqSkZTTbWdghhcoPAEP0CteAG644F3yAB3+Xa0VN6RpWsrUM/q/
Pf6H7/+8iqJoiqIgJfmZ5IlFjAdB7Lk+MULH32URKa52nPBuGOyGLIrcwCfWatDtOT4fasv+ESnu
hEF31Qsi1t7gVwgRNzdjJ4yJzm8TLFYafpvoUcx6RFvzY5JtBZ7HWjE4ighei1no3PcYyUTiYo75
7TW/5e1F7j4s7rhhBN48B6zBfthzvIiYK0HgMccnmSDuMIjScaLOatBmxHSjRrcXHxHscrdxEJIc
T2StP8NxsBmHrr9LDIkjp8pMj+Z2XN/xGh7rMkjahBhfsENIxecWcytKtLhN6s807tzd+oZkBznJ
fdljPhAgZ1Bc47BfHPmM9ULWcmLWJmYXwjtw5E+06vh23AmDAxsG7LDFepwq+6DDfNuNZyLb7fYC
yBVIs+PADrmTCHKES8zed7w9Zh+4ccfmidnxUY9dt3eCEDw53Z4HE+GInxXNsV1OdptF9p3l7e/u
Ld/+qjFnr/EwkFrQheLbrM3j7EXMnhlszozdC4MeC+Mj8ObEdjtgkT8TJ7nPkewmeGafJ6Iy91ko
RKQtzN0ixa+dqHEIV13OreORbNcJH7BwFdockeHBrc247bn3l3suwa0AFlzQTEYUCcx7gc8S7bT4
kKAtQoRIE0UVQG2DAs7CPG1v+enNdN3kneUyxWCSrv3xylqyxpdeW0eKtwN/d5AQnS+QHLdp/SOn
Dp38dTgx4oLFbULNq1Mr9/n6uCn9qhKVKkTHCkXEwIiqFQVQpZpAheoSTYmkkpzOwsykOblaEmjS
ETkfFYjomMQpgXnpFdGrEqvy/BsSZyTOSrwu8V2Ji/LeDYEj0p9J35Pr70u8KXA8jXdL4GRa1ZK8
96Hc/0jiJwKr/NyY9ruFqjfxT1oJKRVtRcXqeplmFnVq1FSwWFirptXRMaJEndfhAzbnM/AZ1Z8R
LpcQqqi2toS0lSGslHSar3FbENaqqet5egl8XK7pda35SF036FBdbZYBh2GhvG7Scj2TbFTqRrO8
odNiUwFLhbWa6jGqiohGCfo2j3lk+CyiV5DIh8CXrX4PwaGG3EoJ4hZrCCwVludg0ol+9Ct1BEFM
Ot5Utx/qMJhoatsPCzCY5CuFfkwqPWf68aqTkqYCpwmO2U0gBUtS8tW/UUlTVK2ST8jICSqQoAIB
Ce8ACXM1VNd5Gn1OMsmUc2JITnSBlboJWS7R6fq9Jtr+RX9s5fClEsZvlnSMa9f4tATTmpi+9dii
+HIph9+Gpdy6jq35oQ2LFsTdRzoM83J4jGbTBnI60XxRIn2KUkNQWsY7vN5hyGe+rjSHjhHf06tb
fF2tFGdNUNnCIjopT+vXI+oATgtA7m+c5bwYHKMKUZsLspXlhLu6Iui9IemtPFOFKldhThI+IhT4
o1TgyLMVqKRsayA8ybYi2ValAvW+AjNnKFA5RlcEKScKPKFqVFD1baK+sTPUh4T6ZOQPUvWhvvrU
vvpQX32yytF/KW/iLOWNV/+Syht/OeWhU8ozzlFe/eWVd63ftHOVl011cOViOpiEbyp9iSZfUAf6
KR2c+xIpyUs0daYOeKfsQS1cfZ4WPn4BLdgi7qAWps/SQjV9har//yv06X97hSZTKs9/hfbxLn9t
6AVem+kLvzbPT/0fUEsDBAAAAAAIACEIIQKBCSqF8gQAAFwJAAAmAAAAa290bGluL3JlZmxlY3Qv
cmVmbGVjdC5rb3RsaW5fYnVpbHRpbnNtVN1y00YU1kqyvDpxnI0xQTGEBEGpSSm1XRpU2tImJlSx
S8o4IZNedDrCURKBIrmSzEzuYIYpb9BHgJlectUn4BF4hD5ArnvRs6u180M9szo/e/Y7Z79z1oqi
aIqiECX/FeHfAhjP4iwMIjDbYRz53pPQB205OoRCn9tQTPzd0O9nYHbbXhiKfdIDPfIOfDA2siSI
9oAGUeYnkReCtRZxVxr023GUZqvPvXDoZUEcgdFth16aAtmEiVwNdgM/gcnfh17I1Z11DglpcDAI
/VwP0jUE8aI+1rESx6HvRVDgkD5MbATo7ua1F5/7ScqTaM1bTaz0wTDqi6R0rLHuw2HGq3+UxAM/
yQ6BbGHk2Jo+u98A6B7rWupnoD+OguzjyOaJyCbQxO/7ARb0cWALyH0gqyfCW2COwpvHKnpHdWPm
Pcw8tpvHagsK3c3DgQ+ml+wND/woS2GiH4e8W7idgv5TkGYwJYIw4dPcD9A/Jp8F6UMveYbcD2Vv
y3m4l2ADsKdgBmnPF+2BieEAi16Jh9FOCvS5lwSiM2Z3a6y244OBF/Es+sbmMo4Jdi+B0qPhkzBI
9/2d5UEAk/0YZ8TLzyOpmbhDPx45zCAaqdBHPJzCKGue0Fug9+PBIRg+H50UCnG2j5XSfS/db8c7
OL84hECzWE6nvhoND8BcW99a7q0tr2+CurYO2s+PNyt/qqAyBQyqMGLlUkWpo9TR0lhBeqn0mmgZ
DIRXYxNSTsqoaSnPSf+MtC9I25KyJuVFKS/JuMvSnpdyQUpbyk9kXF3KRSk/k/s3ZZW30LrIvpDe
hpRfSnlHyDnmyNPfSPlAStdSatrfpmbP0N0KUSzSMZjmKG71iOigNlT7Jv1ngW/oizzcWCC9KVZ0
rrtk++0r/Z2p0uIRoTwSV8H+TUQTiy4WMbrUIkpnjrGWzip13dHcty/IO7NEJyqUVis6pfXzPcrK
rrr95pWO2lSuHRFLApqgW6RRQA2EptpzdI9XY8ryzqDZdZ5fJapVGpV7RKqgugYYFWx2Q5dyEoHy
SsuLnMTZI1LCsFm5PWXfGwGxfL9TZnPja7x5gbCXTsRPS1nGmiqgOoq9Jc6rmnVOnC/hlyBKVaBc
qRcEluHoOVYdsfL8wHFwkUZVYJJjTFzEjgSuplvnBe5VgXsNvyqi1wT69bqB30/rRZGDOoU8x23E
v4rrmshTHuXBpTZmRC71dC5cqj0vaZoSfM5yPk8SpdtLI6KmRxEdym6MSLJOkirlBUHQen5Os6qS
IIMThKfL7EZO0Yica6cwOFGcJFXYlixUsXdzPN2aOUWMwYlB1KpAHVMzIqVxBjsnqCzxNeGf5USM
G+DL91DrzbLP8R2o+Ts4PdSzrIlb2v9tUdZy9XzKa3LK52SnL4kZN/m027/kc365V2S38a290VEp
8ufBla84AleW3AIqYhbzc/wR4qoJRK3B/fNn38iv9A+NYy+sqFTtlNi3SMl3dbybW0Tr3inr+2Or
Z7CvnQcu6ZXZXfyDINsvxfO/IgZC3gMz238R+ppy/LkF5y5xVkoVnS3VSUUAdYrsBwR7r6Gy7Khc
ucBWWrxLGCMkT6e570lnkrUx+30xCB/4gVXHcD/wP6gfnaI700NAV8XvkouNvC5q4PzNi29N1iP/
N1CzOTdnubhDX79U+XzPczKeqnQNVwdXN7/WvJyNq2cO/gdQSwMEAAAAAAgAIQghAhiPe9xuGAAA
MDAAAAwAAABjbGFzc2VzNC5kZXilmgl0XFd5x7/73ptFo200kjXWWMtorNiSbM2MZiRbsuRFluVY
trwgKUpsQ53RzJM08ejNeGZkS0lxBRgINAFTQhrICYQ9FAoNODlZOdmgIaRAEwJpG6eUk9Ie6Dml
adoT2vTQ/3ffG2ksLzEw9m++u3z33u9u371P8xL6vCsc3UzxrsP/c+NLwQeOVSy4vu0/svDXY4f+
90uRx64Lh4kyRDQ/0eWBkJ9UiOjnCHH6EHhTJdoIWWYjqoGsdxAdgHwMEv9po4uo5RrklxL9chXR
v4HyWqJJ8Ctwl5fo8+Dr4CHwNPg+sK0mcgMv8IP1IAgiYDO4EdwO/gW464gawHoQAlHQD7aDE+BL
4DnwEngV/Cv4DRA+Ig04gQesAqtBPfCDdaAdhMC14BjIg9vB58Dj4GXwW9CyhmgYZMBnwQ+AVg87
wBT4APgaeBmoDagTHAW3gZdBXSPRGHg3OAdeB41NRDvAFLgDPATOg/8Dfj/6B5LgfeBT4H7wA/AL
8CbwNGNMQB84COLgNDgLvg6+DV4G/w5KA2gPdICD4AT4OHgAvAh+Bd4C7rVEteB5cB78CrwOfgPe
AtSCeQelwA1WgXrQBfrBDjAMxsH14Cg4BvLgQ+DL4Bx4GjwLXgT/AF4Dr4NKrKV1oAPcCX4IKtcR
tYEQiILNYBCMgQkQB2lwCtwKPgY+A74JHgZPgxfBL8F/A8d6rCfQDqJgDFwP3gVi4DjIgQ+AD4Pb
wZ+De8CXwVfB/eB18BYobSVaA5rAWrAebABRsBUcADeASXATOA3+FNwN7gOPgKfBi+AX4DegtI2o
B+wAx8EcOAM+Ab4CHgSPgqfAs+CH4EWwpR22mNNEMI2CANucOkEEREEX6AabwGbQA3rBFtAH+sFW
sA1sBzvAANgJBsEuMAR2g2vBHjAM9oJ9YATsB+wnDoJD4B1gFIyBcXAdmADXgxvAYXAEHAXvAn8E
joEbwSSIgwTQwRSYBjMgCW4CKTALDHAKvA+8H3wAfBBgaZEA/MGSkuGX4dDYt6ngZwhj2MkG+INh
JDso6DgR/lfocDpcnUxn/QrAnw2gEvzaqofj/GGdDhkyJc/DW1a7HC60y3PDH9blsAY/yrZxuAxh
TK2cuxorneexHmGun+eRPxzmueMPj8EODuAzD3YA7suCFW5B2ZutcLgo3IPwLVb6DoT/2ArvKdLh
cSiUPVSUfkNR+Mai8AzChXoyRels/7ut+ucRPm2FzyD8J1b4XJH+j9DuopX+DNLfY4WfL9J5BWGe
e16v/DkDOMw28HjyGn4NYQ9VEdws1eHfOkgf/pmynx5EfA3V048h67FSyqV00D2W/LSUTnoBsgH5
vGZY8nppQM28Phowc2WQjVa+H5LLs+TyLLl8M+SHIbfgH7e/HbvxJKSK0xZHH2QTPQ7pQOhrkE7U
+APIEiu/hLz0GOIuWkt5yFKs0I9I6aB7pWyjr0pZQz+U0k5/C1mGFfUtKX30Iylr6KdS1tLLkOWw
6+8gK7Bb/h7SjZbvhKxDu15Lsn11aPGbUtZJ6bPyWXK+j6rpy5Br8I/ja9Dy3VJWWlKhz8q42c81
GBHub71VD0suV49RvlVKjT4npdnveuQ+J+Or6PuQDRSQ+g2WXQ2wkO1rpFUyvdFKb7TSm+AZmpHf
hHgAMgCvmYFsQ03cbhva/zMpy+m7kO0YmfukrKHvQG6EZazXYemx/IKMt9KrkOx77wedVj86Uf4n
iEfgMb4IGbXSoxjh22W8ypKmXhfyP4X0Lsz4l6R00VekXEfPS9lMfwPZjV6wHd1Yf9+G3IyZ+wzk
Vqy0j1ryrCU/JmUzvQS5zRqXOoTdMk7E+yyN8GtB3IPYIeHjA1WgkyP4cP4byH/cyl+DOJdnX8of
zq8J4U5m5dcjzuVLAH84fyPy/8vKb0B8Zfv9yPehDf40gpX5I8jvtfJ5L6+0753IP2jl22AZ2/aR
arMeR7gJK8Ex0CTCZLh7sdpdwgjXkiImpW8Q0GX44wQBrI+MGwODE0dgbBV8K5yJD+9/jz/j3y9z
zL3KaXeirW5IH6w/4S+H3nmyl3qao+5yyrpLEHfh3FWp1ZZ1uxBr9Z+QPsMFH1BKnl/7lI9TjfpX
Yzc9fmJHJcX9HvJM+lQfnXhHB6nXLOva6IQ8hyrQFttV+HB/J1E/jwuHmc/AplrIAKzK8AUc/VHQ
40khqEaRbYU9GIUy7Ih+5KmoWch/UMVHAxn3FnxXIE+RY/B51Mlj5PA34W5g+NlnlqFVHiW25yvI
Zx/loznyiacxFvvYT4rdolx4PLvVcsXH1VLA1k0++19Sxr8b57zhvhZjUmb3OR5FiWF4xSZ7F/kc
J9DCEGKGfxc8ZkCJwp6taMfn+AbStlOWypQT/j1sg6MQ9zkqL8hTYR/nKSzdO9A2y0F48DLF5/gL
tLcX9Uw6qqHVTxnU5HO+KFM/iJQe5BnuzShtuDfhO+Boo4BzI2I7uYaSjL+b7qImZxA9CeP24XEa
7gg8eFmJ41OeUsd9PSWrKFBi2l0i7RhGHtvzIZawp4R172j9Z8PdiXKGewD1ttaXI9TF47TcZ5tf
lh+F3YY7yv2wcT1mfAf3T6vSeN98lOdQtN/Lq8OcFdSD5cxn1lGhYQwRWDGnDqTwnEbQRhPK8/qy
ydK4a6Asthfm9FmMyz6si7Rf4HY4HtbohJs9aRnWthP5LyA+griHAsLssyCf8l5pdzOVCbZ3gCX6
jTkTTSKEPBW73WzP3LeoQO7/S+/btqV9a5cWsjafYeibp4yOVpfS4ZoSOrzKdcl9yroeML6jjMYH
Sml0Zwm9qijihNuN3rqU0UEXnRjrIPc1Faj9auzZuGRPYY9wGzyehz3lF9igyV3EuTxiuCPDN+Dc
kG3zqX7CH4QNFTilbPBAODcw7q9AOrE/FREgRVlLPvUROQdheIsDrS8GnVozZf2lODPKbD48pLLv
GSJFC9B5uyJ67DZ6VdPsrZXn7aKi114GXQdqd9l77Bp5drcqnnUPJqCp9NgdrBl2OvzUWnveITK9
jiriGJeYI5ezx2mjaidy1Wqnmx4806pyrjh4Xqs8Wu30UPSMu+DptF4Nns5pejrHmNJYSa0zPfYS
msTeb9I85GzQUI+zwQFvxiPh0no0J3ne8NnvIPZ//5kIqOb6UcmnrZXrZ5DKVF4/2M9qNXpt+Ldh
DSINawlp2nlfZaYWS7wW7snj8pR6ymqxKDwqt+7YXo01XwvnWA3/VI1xrca9sBrOsRoXnGq4xmoc
ajX1b/1WkGPMaWsgZ51Kp+rsWOvLFhZ8r9PRgJ46Zauyp6UBlMiMriebt8nWjxGrwnNPBXa2Ivfc
WbR3EL2sode2vjHFswX/4PCJBjlbXup1mmeEA+dSryicEQ5qLfh90SMwOv/hUz4hR2exeRI1G/yn
EvTfIzxKtW1ReDY58qfsIeyri08LthZtmidQaUA0wlu1407dJExrzf1XOE/uhb18foyjFJ8ny6eM
ef5VY0VOYxXxni2cF19EGfO84O8KhNnz4PkV6RHItN8GeSPqM/zrkHMjsZdei1AZzonPYyT2Ys83
wcqjWG83ooZCbnGOHTnui3KcKONECYfV5jm0uRVt+nAGs7+y0/ghB84g00d92vJRDrfhZgv5NOiT
cnzUTr0K/Jhyj9RRqFVxNLMW+yrWYhlQ1mD0fPC7nrVro7vIo+0nVfPU7BeqZvj5WaCC4spT4mlR
QQmlxHlYhHCg4yEtJJ5EUkQ8I071q+IbItqvqreJaFDVnhXRxnnV9orYdE613yW6j2wV11Sq9B0R
vVNVnhDBf+rf+lvVcb9ob1SdD4mIsvaw6npARJV3NailpYoQNpettENUu/uFaiObYrPZ7DaHzdnY
qNI9YkO/8FbhihISL6H5UfE9cbhfrKukw7ZHxcOixEnfEiW2ZtVWUiYcquZSRJdNUytdyk+UW04J
p82vag+LarSh2f1CQbQB0WdEXWW7KLNVqo0o4LXZVBXF3R4oNKgOKNAkel4hVnl2C0+l8FTRGlFZ
gQeCCmoWz4mK/qO/fuEFahevisOiGj3FYLAUGA5RVYnJkGuu35K8/phBS/L9UpXhAXlH5VnsxD+W
Efxj3V0yH1+W5DXIK9Ncr6aOGTfPRS5bilxTmvn8XM91BS3JZyDHO4HZZkTWGcGJwvXCpaB13Kjw
bxVuXjWQq/EExetnQGr0UbVshbXNvcT63C7HmQEAJwY5gDuZmcPpOwHLHrDmiUWXCyhuxaU4FfcT
iz4lLPaUPvU5u4aoSvueWKwtKEi9Chlbzeqar8kqELG7FRRUI04U0hCy7XGgCsVt95W7HbJKM+58
6j747kXxxGKLS+FKGHeFKZ0qwlVsR8Ee51Pv1VY/sRip8WgeJazIb9UMh8VOm2xC29vstqEJJeJB
cy6P3QkvFlbCjgC+99RIHedet7sEOi4YWsq6SL8PR9jdMCS8bAg3LHtmSmtcWBSlwjyng43CQG0R
lZYVyl6P24maSyJOt8unrRbh0j01eyvcZTLN7i6HrBitcKuQ2g1PvTfIdmEokcTGr0iyI8lRpAVj
3VTS0hKfiRnTeoKDCX0qNpfKk7MoMZ6ezaRzepbsLYlkNr9APS3JllhLRyyVS3fsjyWNgXg+eTKZ
X2gZ043EqH5iTs/lx2O54y2J9LCxMxY/Pp1NzxmJlk60MJtOJKeSqMzWYsRmdfz5NpePTaZ0xPMz
yRzZ1sUSCdygW9tIbW2bwJ8vR2JGIptOJuZDliGh7JyRT87qoUHLsL5hKG5oHUF+SJ+PzWZSemh2
IZbJpJLxWD6ZNkLFVvZB+YbWkZtiJ2OhFDoeGstnk8Z038XtzCVD+y1zL5F7sRVsxvrWoxdX3XZx
EpX2x4y0sTCbnsttI2d/PJU0kvltZO83pbKtDw+EZs9JDFJ4sPXarK7nYWnbodbOtp7eHdFwT9fI
5p4txZ0LHs+vzeSnk/GbKbpc4lBWP5nUT7X19uyIRqI9I91dlysUGOxFxZFNm0c6ey+nU8LjHjMw
ruQYymbT2S1+chaMo8pCyGqU7Hv0VCrtJzFMyvAwOYcPjI0PHBgcIrGXxAgpI4NgmLSR4SMcGyF1
BF+1hekIpXOhgdyCEecV1XeZ9H6qLtbfidWW0vvIu5SY1+fzoaFEUq41OLmlDB6X0AS++qhuKfFU
MjGtm/rjKHiJLE42S11TKDUfiln7wFyYhm7kCzujj9YuqxWW8Wwsr2eTsVQ0xLXtQzOXULpolVFR
g4WaVipxXaGLGyyojepWwbF4OqMPY79wgQ2XLyD1rsskYLAM9lHX5ZWTBrplxFLW9uTNPRKbnUzE
+mjT71GKTbuEDyjamy1L67GPGi9uoUizj1oumS9XB0/CWH6B10375bWm0kY+tBtfu2OzydRCH7Vd
he7vUO31enJ6Bl2+ggk5NlKumYFUctq45FSj07JTy7q7MOlZ6Q37aO8VXCUPZjrHszYGX5PS82kj
11LsYvblW1JyPjs6Wzr7aPsfVlcf9VyhguJ2V54uvCywjq/G41P3VWqibwX3xX3r/92LWV6PS7df
dek+8l9Bd7QlmeCVe/nOjmJGFtJzWDYbr6DFa2JGx7k5zt+8rwIjiVjqZPJ4KGYY6bx5VA4Z8VQ6
h6kfTMVyOfZJV9DZr+dn0jCu8RJKw4ahZ61Kmi+Rv1+fnbQUdLTTcAmVMSzvWH4uiy3Zeqns9Fw2
ru/SJ+emh+bzupHDkdRHq83DNpkO7ZybmtKzOq4ksYSe7aNVSznDB4fm43qG7wYXJBuZOfiArB6b
7aM1y9rLyYWqapcyD87liwq5l9ILmpY5Kb5pDM7EsmN8PzLi6FK1qStzhuE0p9lGT1HigTkeoQvT
Dk7epMcxdcV61gUGB9jKS83OuWRKdt2yS7Y1gctUH9WbygbOuT35fOa60ZHBNGYMRxiPScVyLnKW
BpW1V2hag2rlYPWkZYM+qwJMA66X2RwKcu8h+6hq5Hg6j/tOCMsnhkMFJ0N5Iek63IJ4O1gaN52c
DU3NGdKqXGi3FcLmehuNyNtr9F9Yx9KxhanAfTCXjGNR1hfbsaRROM5qC7nS1VrdQ6nKYreFGxl5
9i8MLN9G5fYj7dDBsXE82o7tHzjkWlHAtU+Oj6t9zF8I7XZt8Hf6V+pd3iUUa670nKgq4p+KHddh
m6tooJc6uBt5+/Ku9hFX59rOjZ3hyJZOhPAdjrrah1xUueKiT2V8eHZ0dA1fu+8Y/vBy3fjujh4p
jvWQmCBlYphsE8PDw7jgTeCCN4H7Hr5GkDgygjthLcTevbj2gb3DR6DHycNkRzrnKxNHyDFx5IiM
OCee/ixc0824dYojpPCl8ehOqi6+dhc2yQWJhV1SH4vH9VyuBTc8tppvcaN6LoNjTm/JUKmZuzsV
m85ReeFGd2wWjzmk4tGESvBccSzBPofsCOKJhxxY4fIBqiw+o8ePH0jnD8ylUrSmODY0n8miVWyu
iVhqTqdVxZmHYlk8C+HaRDZ2vjpNY2KD1qNM8IJHmeDg25/PwcL5HCx6xvC3Fi8JzPyW3t422nz5
hgoH4cUFe/AuyLa3L2gdhReX793cRqtR3rpnmNtp2MCDIPwiaXH4IVIS+HNJIkKuRDLHCXBMVHHh
8yQJnUp13Ol5GgcwNa5CZDhBdvhYeCKqlI+kqDqbvxZPoRly6PN6fC6vU9lU0kjw7O9cgH5Vcaw1
GAy2kW0qNZebIScWys6FvJ6jCoSGl88CWoW4aTyuQsvLwoXk/Zjr2DSaR7j4hKCaFQlmU6VIHTue
zGRw7pIDEe4SNc7AMee2hEKGfiqTm0lngjNzuNbl8jflgpmZDCnJBGnJRCcel7E6ndi+5tqyJ42T
6eM6VSVz49lYXB82DmXT07z8oJgncZychRVCGvywTs6lx3Jl9iRp8sl8u4FF7I/Lq4F/Ukcol/fn
0348tXbIrPxCRvfziROE8w9edIiQM20M4ijFUJenjUPpXH7IGvkKPHUYy6cNKWkYlgkDzHkmQvYM
74ccObFA8rtwPlBlBi4ZJzP+liB7RE5UnBiRpqNfcvOSHSH+24UnFzupJwrrCYVgQWlu+U8TVIFT
CM3jxiB3P2fmd6XNaSI3ItbfMMzbDTmQIuejIocpGk/LdTSEfV+VkxeQYWMqncXDHPY2kniljWKO
lhacO7/Cy9AG/kuHP5YzB4/P5KDpnNqCmHq51lqtQ7ON7KzcEqa2/Ew2fQrHIw5IPDQmb9YTmNWM
jj/IDEiHtnSjIWc+bdZH5Xme/6GT6CkbXLkcxbBkMVRz8qEORxf7L9PplZpp8kGP1LlsimwnpcvS
TmKzkO1UNokBVeaTpJ8+vavnlsAkZgWjG9gSSOjzgY0B3tnJlByPDqwrXWbAXyJrJpbrkI4vNzeb
C2zJZ+f0jYHZpNERyyQDWyJdGwMn9Sw7SZTpCXYFI5HAu+mX6unTp28JXOFmO7jkS67qmQWV693d
m/Twph7Y9IfV24fKpqLRaE9ksvfKlRW735UnMtcSDXd3h6MR/epr4VLd3bGpSDQav/pSFz7j8Fj0
dHUmuicTv1cVy887qCm2aXNvd29s6nepSXZ9MhHeFOnWMdnKWvGKWO1TrlE+JLTVj4hGZT0S6u3e
We9x72bvO70z3jrRa7tL1Auv+KSo17y1XvJ+0+t5QGjqw6Je1YRWotE/Ci1cKOleLmkm2ZYTRK96
uYL4UcI0pt40xvOI8OYKFYS8x7wxUKe0wjxvtmCSCpPKvdd6gzAq5q323u3FO8beVd7H8f2s9za0
hZ80LjByHXdPrF5TqEFDDVXePd5ub5X3Hm/U+2nvC94u72Mo/z1v2Puc97w34s1dsqYW1OTrUKQI
FqpTUJ3L24zij4CHvNu8Nd6A1yMrUC40Bb8tKKKu+tZF7bFasbiovVK76kn/bbWi6s1a/GAglDpR
4kXmbavFexa1Z1fXVb3hxa/4mnbW70PCXfVrnvT/bLU4IxbrlCf95+qF9uN6oaqKrQ6/8+KfH2Vf
aeGyb7aIT/qfaWnRzl4jqs6sI00oJWf9ovB/Pdp+o6H1Sf8zDaLqXryzJpTys/52pJ5p2vCk/8eN
ouoLeMNGoY6655tE3R1r5W8c6zfidxDQA/YB/i0ia8n3W/JOS34Vkt+JOQf5KPgu+Cl4FfDvJl68
B+QH/PtLDLJQL5fntJkVadxWGmnv5B9iij6LiHMewx/+TWgeafy7aAbyrKVfyOf3mm5F2n1WOqLy
c25F/NkV8VdWxOXrEyhZqJflz0EGcP+GAL9Lz/agS/J9eu4XfpaU79Tz2BwAj+ElAf6th98V4Hfr
hd+0nd+vVxEuJ/MdJoEG8fO0fFdLQTq3xe/fawjzuww8N4Qw18PvcKnQR3VyvOxWOr/fxS9VsK38
3v//A1BLAwQAAAAACAAhCCECj7/gzIoGAACkFgAAEwAAAEFuZHJvaWRNYW5pZmVzdC54bWytV0tT
XEUUPneGx5ABMpCYkIS8CBACmQuBJCZRUUgw4U1BpOJGcsNAnGR41MxAHguTcpUf4MKFyyxcWGq5
sCzLpeXCpZUfYUVXWViWC/Xrc09ze3rulZFipr653af7nO+c06f79sQpQc8PEDnUSpl6onco+LQ6
QbtR9YEu4DwwAawCT4FPgS+An4AXwCugHrqdwBiQAT4CngM/A78DsRhsAR8Az4BvgB+AH4EXwK/A
X0B/nGgT+Bx4BUxUEX0G/AHMVxN9D3TVEH0C/AnM1xJ9CfwCtCeIBoFZ4BmQqiO6DXwHpPYQucAw
cAu4B3wMfAu8BP4GmpOIFaimIn1IS7QCqF6OPLqDdg69KsrSIq1xLqrw68msPbSOZx69LBXwzcqc
vZDn0S5idBG/vnwCvU2xWIvnKjPk0MqwrQxad2iD7uKrRwgrt0QPYW8NFosyN4nxDfZXSbPMsAR+
5fcmxnIYVboN7NkqzUHrPs2zr4GXSfYmkFzFb4b17JGprYhT4PIwche9YqRd5UEOvQc0jPYi5mwg
AjVS4JaOpkCz+FX5aOIoi5B6nDHFqKJSfkzgeYeja6Jl6Cvbpt2rzFvkjBY5+xlo5CX3wxhVKzEE
bzyWEtXx6mxgfoZGt1a2iVsrsJjl3IdHd6iCWTqTQaXsQ2tdfF3h+FfF33clYpWRRzwzw7F7NFKS
Ed/yLMfvr3WczpFLfWjF0FL7taZkrqod3d/kKnnEledx3CoDWa6mw5bE5ZrR+XRLbLo0iUyOYn2I
Tmyjt8hxLKFW/NhcrOQQvQfdq3QD0c3CxsEyG2E7yqVr0JukGWicsjQeGh7qKN2QPA+VZaInxNLi
ll4Bei6yncVvkWsox/HdRX+G62iTd92DEMudEZbzbNOvBN9HJdm+JsI8VSfVGt1Dv5899PePi7xq
ubarVmEU+v454XEcjznLxN7YltX4Mu+eR0COfZ7hGYtceQXekaUzouz3hdj3z8Zl2T8qpwWu9xz3
81tsesZoyYxZ5l2Ss0FxXNh1DjUjKqLzO2Ir3UPDWCV/F6jdNEvjtEDT8EjtiSG6Ce5p3mF9u8Cl
9uocbA5h1SbAMwOOaVTYKHoj4EjvAsccrM/DWrn17l2xPg57M7Ae2E2F2C3Iu6kob5vT285xQ1bZ
22L2K2STdf21T8rezfF9wCs5ae3TLnhTuLw3Pd6L/m5awXiUpeEdaKnz8X2s8xDqaRR1tYBVGMFz
BL15rqoFjE6jChbQu4XIpiG7ifY1XjM1Q2nO4atrr3NHfkyip1a0/Ezs3pE9ewXTZavcjVtQEd91
ukK9+BZgwb/HeWi7Ze8X34teZryPZ57PtN6yt2JDydssLfValEpIsP1VOQcLfO+o43e98i699Q5X
79t1uat4fGuKvjW2cAaU3jLX0ApqYYNZMxH3i/+jE9zhErIDzcpOyH3JPFf3wlKBo0tHeJwwZhT4
HoT/Ck6Cb3T4t+E4QAyIAzVAHdAI7AVSQAvQDtTHHOcI0AqsA0+Br+KO87LKcX4Dqqsd5yyQBwrA
Y2CwRplPIQPq/kP0Dz5H5X9LDPKvDbn6XER7P7618l9HzauXcfW3wRFZA+9cFRvFD4nsNWNem8gO
8M3Jn3dYxi/xme3L+kR2xdJV7TcMWaP4O8G1Evj7tvgbM/xNGnotImu07MclJ7YtzZE05JdDOPD3
C7dJP4ZzIqsOOJpiBodtS3Fc4soJ5IPC4fwHh7Zn6yl7SrHJkLtiL2nYo8A/p8FpfKJkjiFrpQaW
xQwZVp9ltYGsWT3PG36YslSIrMmQaV+aSzhSzLHfkDnCe5Dvsn4OToluS8m81BMVvzpZjhrxt0r8
VTuIX+W9Xzj7RTdhxaU42yFrMzgvCKf+6HU+Zcw5ErHOx4TvmLHOtp6212HIeyPsHRd7xw17tp6W
2zFouZ1PvTe6QvJs74024W+LyJ/m6Irg6KmA46RwnNyGoyeE4zaevYb8TeGIWxxp4UiHcOh5dcCA
zBswYhgw7L8eEUO76LWLbA9wVmRnjbWwbWmOixVwdIi9jm04LkZwXK6A47TYO70Nh21Ly+21UNzP
8Bw05G8Jd7XF3Sk8nSKr4n/dvuyEyGpCzqVEiGyftb56n1+rYJ+PVLDPz4hfZ4zYbT0ttzm1L9cr
8OVGBb70iC89BueNCF+uR/gyVoEv4xX40i2+dBuc4xG+jEX4MlmBL1MV+NIlvnQZnFMRvkxGnJ12
3Wq5/Y6OW3czfQdzIu5s/wJQSwMEAAAAAAgAIQghAmTfcGLYAAAAhAEAABgAAAByZXMvYW5pbS9h
YmNfZmFkZV9pbi54bWx1kE1uwjAQRr/Jr6kQ7YIFQqxZsIhZVt2g9CYWCUoEiSPH3WfBITgCZ2kP
1Q6JU9pKHenJ9htbM2MfAmcCCCtcAcRwwe4Z93hklsya2WLIvTLTaVnb3DT6pKw2ECJ7M8qWusZk
cjC6Sk9NoRDHVg+7MFTOqDozusyw2RTWNi9Stvsir1SbuESy15VUzVGavJXjZXQksOC6KRFdmHfm
gwE99X7OfHKEvEaMx97+8LcI+vMcgZstcustJ3jyCA8UDV/w7Qiz3nl3F4xv/V+u2/l/ehlr0j89
fgFQSwMEAAAAAAgAIQghAhyzi3TaAAAAhAEAABkAAAByZXMvYW5pbS9hYmNfZmFkZV9vdXQueG1s
dZBNTsMwEEa/aZvERVXbRRcIsWbRRc0SsanKTawmKBFNHDlm3wWH4AicBQ4FXxL3h0od6cmeN7Zm
7CEUPgQQ3OMLQIIQdE84xYzckQfyiL72QiaTovKZq+3OeOugVPrujC9shfH41dlys6tzgyTxtt9F
kQnGVKmzRYrlMve+fta62eZZaZpVKKy2ttSmftMua/ThMPaicMu+GxH5JN/kh0DmnV+QX0bENSYD
en/m2xh1+QKj8LY4rG1N8eUxbiTuv+DoBNPODU6O1/fr1g3/OeYXsxx6ypUZ/wBQSwMEAAAAAAgA
IQghAurEk5p4AQAAVAMAACkAAAByZXMvYW5pbS9hYmNfZ3Jvd19mYWRlX2luX2Zyb21fYm90dG9t
LnhtbJWRsU/CQBTG31laSgUFo4kxOrkRQx0cjIsyOjjpAInLBdq0EbimPZ1MdHJ05h/RxU1h0fg3
6XdwtbWRwdf80pev7+vde88gmy4MIkbbtM+I6qQD+SVlsQq2wC7YAyfgDHSAByJwCx7AIxiDKfgE
1Wo4kl4ciQGXIibb7l/HXIZiRJYVhTdCdtKkS41GEvDYO80bHMePxbBz3uMDD24pdDrXu5mu00pF
6e1BFHAql6WYZ6bJtcJH/ViEfWo2AymjI9dNeoE35ElLf2j1xNDl0ZUbe4mbFptmMvu5YSSeJLpn
Nh2gtzZjbAyewDN4Aa/gDUzAFLyDD0CsTpvwbIAvRBXvGliCfpjTVah5r+Nhev6qrqS/20RrpH0T
vZfUt6J9ds5HmY9Z5LDafL0/GlHlbnaPTLP2sWKlGTlNVSrNzLSS7/vHSrNyGqYz08p/1NmFOkPP
pNiD6g1jpp2cvqx7K/2jN6Z7q/w6d+51FtyleKZR2Fu6H7Zgn99QSwMEAAAAAAgAIQghAubX/7gC
AQAA/AEAABwAAAByZXMvYW5pbS9hYmNfcG9wdXBfZW50ZXIueG1sdZDBSsNAGITnN0mTSEEjHkR8
gh6Sq/SiBS+CZ+9LG0mwyYbNerbgS/guvoH6SIJO2o2JBf/wkWXmH5JZDxG+BBBc4BNADDfUrjHM
ETknKZmTG3JH7skLmU7L2uam0WtltUEUrZ6MsqWukSRtoUx+O7bj+MHoarFuCoUwtHp3CgLlFFWv
jC5XmM0Ka5t5lrXLIq9UmzojXeoqU81jZvI265c9r81t968bidgGWIjIK3kj7+SDQI5xRi8h35wJ
3yE5oH450ruJeD7lI+4OtnvOp3cCl7PbvSEXuJw/ymHIyQSHEu6u+FcTxM+d5g2a32f9P9rmynMd
9r/p7XXrO8g/nX8AUEsDBAAAAAAIACEIIQJXQXBTAwEAAPwBAAAbAAAAcmVzL2FuaW0vYWJjX3Bv
cHVwX2V4aXQueG1sdZDBSsNAGITnb5omkYJGPIj4BD0kV+lFC16Enr0vTSTBJhs269mCL+G7+Abq
Iwk6abcmFvzDR5aZf0hmPYT4EkBwiU8AEdxQu0E/x+SCJGRObsmS3JMXMp2Wtc1No9fKaoMwzJ6M
sqWuEcdtoUx+N7Sj6MHoarFuCoUgsHp38n3lFFVnRpcZZrPC2maepu2qyCvVJs5IVrpKVfOYmrxN
98ue1+a2+9eNhGwDLETklbyRd/JBICc4pxeTb86E74CMqF8N9G5Cns/4iLuD7Z7z6Z3C5ex2r8/5
Ljce5NDnZIIjCXZX/KsJoudO83qN8c11p43/aNxxHQ6/6R1023eQfzr/AFBLAwQAAAAACAAhCCEC
dLCUdnkBAABUAwAALAAAAHJlcy9hbmltL2FiY19zaHJpbmtfZmFkZV9vdXRfZnJvbV9ib3R0b20u
eG1slZIxT8JAFMffWVpaBAVjojFubsRQBwfjoowOTjpA4nKBEhqBa9rTyUQmR2e+iC5uCovGz6T/
a6+2Njh4zS99+fW99t69GmTTpUHEaJcOGFGd9EJ8RdlaBztgD+yDU3AOOsADAbgDD+ARzMACfIJq
1Z9ILwzEiEsRkm33b0IufTEhywr8WyE7adClRiMa8tA7yxdUKoNQjDsXPT7yUC2FDhPfzbwOHUf5
9igYciqXpUgi0+Ta8Ek/FH6fms2hlMGx60a9oTfmUUs/aPXE2OXBtRt6kZsmm2YUv9wwIk8STZlN
h+itzRibgSfwDF7AK3gDc7AA7+ADEKvTNmo2wBdWFfcaWIE/ynm11Hlv4mL6/FVeST+3k9S4bo77
Vq5uTdfZuTrK6phFFVZLxvvjiJz7eB+Zsw4wYuWMnFOZypmZw5amJ8pZOTcYDGJXXpJnF/IMfSbF
HlRvUv9zqV/VvZX+0RvTvTlL9lL55dCr3kvxm0Zhbul82B/z/AZQSwMEAAAAAAgAIQghAt/6b8zk
AAAAjAEAACAAAAByZXMvYW5pbS9hYmNfc2xpZGVfaW5fYm90dG9tLnhtbHWQwUrEMBCG/9lu22xZ
VNDDIt6FPWzQk4gHBV/CY9hm2eK2KWm8+wA+gI/hY+hT6d+atSI44WPCNyGZTAKFFwEEZ3gDkCMG
3RXGOCSn5JxckhtSkfm8aoL1rduZ4DyUKp+8CZVrUBQb7+qHe7sLhj64uM1z05TeVSWWy20I7bXW
3Xpra9OtYmG1drU27aP2ttP7w7NZ8Kbp+Izt+3kWhQXznYi8knfyQSBHgz8mn4wpc0om9OGX7yPj
/oRrGv+YxtzXFCeQoZD0exQ/TnAwuMnosgvgtnfJ6IYrkz+97N+Uf3r8AlBLAwQAAAAACAAhCCEC
zjbx/uUAAACMAQAAHQAAAHJlcy9hbmltL2FiY19zbGlkZV9pbl90b3AueG1sdZDBSsQwEIb/2W7b
bFlU0MMi3oU9bNCTiBfBl/AYtlm2uG1KGu8+gA/gY/gIHvWp9G/NWhGc8DHhm5BMJoHCswCCM7wC
yBGD7gpjHJJTck4uyQ2pyHxeNcH61u1McB5KlY/ehMo1KIqNd/X9nd0FQx9c3Oa5aUrvqhLL5TaE
9lrrbr21telWsbBau1qb9kF72+n94dkseNN0fMb2/TyJwoL5VkReyDv5IJCjwR+TT8aUOSUT+vDL
95Fxf8I1jX9MY+5rihPIUEj6PYofJzgY3GR02QXw1rtkdMOVyZ9e9m/KPz1+AVBLAwQAAAAACAAh
CCECawCw7uMAAACMAQAAIQAAAHJlcy9hbmltL2FiY19zbGlkZV9vdXRfYm90dG9tLnhtbHWQwUrE
MBCG/9m222xZVNDDIt6FPWzQk4gHBV/CY9hm2eK2KWm8+wA+gI/hY+hT6d81tSI44WPCNwmZTAKF
FwEEZ3gDkCMG3RXGOCSn5JxckhtSkfm8aoL1rduZ4DyUKp+8CZVrUBQb7+qHe7sLhj64uM1z05Te
VSWWy20I7bXW3Xpra9OtYmG1drU27aP2ttPD4dkseNN0fMb2/TyLwoL5TkReyTv5IJCjvT8mn4yU
OSMT+vDL9zHl/oQrjX/MYu5rihPIUEj2PYofJzjYu8no0uFuMrrpBXCb/OlleFP+6fELUEsDBAAA
AAAIACEIIQIF9mjw5AAAAIwBAAAeAAAAcmVzL2FuaW0vYWJjX3NsaWRlX291dF90b3AueG1sdZDB
SsQwEIb/2bbbbFlU0MMi3oU9bNCTiBfBl/AYtlm2uG1KGu8+gA/gY/gIHvWp9O+aWhGc8DHhm4RM
JoHCswCCM7wCyBGD7gpjHJJTck4uyQ2pyHxeNcH61u1McB5KlY/ehMo1KIqNd/X9nd0FQx9c3Oa5
aUrvqhLL5TaE9lrrbr21telWsbBau1qb9kF72+nh8GwWvGk6PmP7fp5EYcF8KyIv5J18EMjR3h+T
T0bKnJEJffjl+5hyf8KVxj9mMfc1xQlkKCT7HsWPExzs3WR06XA3Gd30AnhL/vQyvCn/9PgFUEsD
BAAAAAAIACEIIQKdiyln2QAAAIQBAAAeAAAAcmVzL2FuaW0vYWJjX3Rvb2x0aXBfZW50ZXIueG1s
dZBNTsMwEIXfkD9HilQWICHEmkUXNUvEBpWbWE1QIpo4csyaLnqIHoGz0EPBa+NQQOJZn2b0xvaM
HUFhK4DgBu8AMgTRu8dJM3JNbskdxtoTKYqm85Xr7dp466BU+eqMb2yHPH92tl2u+9ogy7wdsyQx
wTFd6WxTYj6vve8ftB5WddWaYREKi5VttelftKsGPW3GRhSu2HcpIjvyQfYEcn70L8knlTCm5Iy+
/+EfFDO/4IrD29IQDzXFlwsKSccv+PYi5G/H+05ePJ2Nfnmbx+jPLFNP+WfGL1BLAwQAAAAACAAh
CCEC2tcqQNkAAACEAQAAHQAAAHJlcy9hbmltL2FiY190b29sdGlwX2V4aXQueG1sdZBNTsMwEEa/
IU3iSJHKAiSEWLPoomaJ2KByE6sJSkQTR45Z00UP0SNwFnoo+JK4FJAY62nsN/6PoLATQHCDdwAp
QtDd4xRzck1uyR2m2hPJ87r1pevsxnjroFTx6oyvbYsse3a2WW26yiBNvZ16cWyCMW3hbF1gsai8
7x607tdV2Zh+GQrLtW206V60K3t9nIytKFzx3JWI7MkHORDI+egvyScjZk7IGb3/4YeYsX/BNgtv
S0Ieamp8eS7J9AXfLkL2Nu53cly+fRxc9Mtx/OcuxzPlnzt+AVBLAwQAAAAACAAhCCECyMT0T4AC
AABMCAAAPwAAAHJlcy9hbmltL2J0bl9jaGVja2JveF90b19jaGVja2VkX2JveF9pbm5lcl9tZXJn
ZWRfYW5pbWF0aW9uLnhtbO1VPW/TQBh+L05r54NQIQZADIdUMVR1YrtxnSAkFAmxQFioUMRmEtMY
nNhyXKROtJ36ExiYmZn5AfwMvv4CSzd4zz4nZzspWdi46PF7efx+PO/5dCeBAk8UAAK3IdgAuAp8
EIABLAbjbyHuIjTEfcRjxHPEsxLApzLAZ8QXxC9EmeVC1OvuNHLCwPfsyA9BUUZHoR25/hQqlbe2
d+Q8Cv0JyHI8P/BT9uA4cDA2CP3ACaPjp/bEwVg/HDmhOz2E04vTiz5Vraa2yx7Uo3ob5xpOh1Tj
s7z14hlzvNRJXTuV+pdcL2ifxhK7GbdFAbGUqjd1rd3uGnrHMpO3Rvyy0zVNzerohpkwRqFmLCPX
m5iNikni+GKeuRJBUkERC1MzimKmqEidSxLXKNMizSRKkqgr0mUWFc4GZ4N+khAfJv8Y8w9mWPt6
29iz2t00LhZvGHsd09o3TH1OFUJ3M+FMoRCWRKjLg9Vi4cQzm0Mgi8WzOWi2eBIiRP/fXP9kc8my
PR2FvjvCk+iV63k9LxjbsLMzjqLgXqs1G46diT1rcqfm0J+07OBNK3RmrTSw0fBfvnaGUW/qTvih
F9jR+KEd2SBJMydi5+kJUWAbbY8Q8h7xtUTIN8R3xA/ETwSQLbiBPtcQv3FU0NYQJeS3BZ6NBs6v
4y8dzOcD2puCT537bHKfGrfsHbsCJKi+qyVHf8ptfUxrImQEcpLMOSn5H3MK58pCbIlzeA3AFe7H
rMT7ymtjmjv8nsn3RQTNm0INwuPO0dIlvW6s6LUGdXJZr5zDdk4epL3mOZa7yvuqCn3RJX2d87tz
XX2lJd/iztr6Fuu+TF9eR8rn113K7b+UJyv25R9QSwMEAAAAAAgAIQghAkwWIdDmAgAA3AoAAD8A
AAByZXMvYW5pbS9idG5fY2hlY2tib3hfdG9fY2hlY2tlZF9ib3hfb3V0ZXJfbWVyZ2VkX2FuaW1h
dGlvbi54bWztVctu00AUvRM3TZqGUgELhFi4okJqFT/G9sQ2QqBKCCGhsqoQ6gqTuCSQxJbjInVF
aTesWbGALd/CL1RCvL4DCe7E48bOi7aqxIaJjmZ87iPnzp3RSFCGLxUAAtfh1zzARRCDADyB4eD8
NcRNhI64jXiIeIx4KgHcwdgHiC3EG8Q7xEdEtdruxX4UBh0vDiIol5u7kRe3gx4sLLzyOrv+/Sjo
Qqk0WG8FKbu1F/oYG0ZB6Efx3iOv62NsEDX9qN17DofFw+KmbKt6TXFVXW7IOi4RskKtsVUD1yrV
Lcs1qGOzxGoMjI7LmG471GAJY+SS8ZlnGS4SWzabnE0yiB/Pc6wkI2lMEQ9TcooGzLgi5ViSktGU
K1HOJUqSKFPSZedteTPxY6qOgzKDObab217VMkyL1qlp2/w/LXRy63rdNa3ZxsxuqBa1dNfUqc2c
gdvwc7YxJxxZw6SGTqlNXb5zOjUsnZlJ2SfwyGVD3ajTMSxDuBomwzJc07WY+XeHadXNKm5abbxo
Ew9FMqU9mMxuw8HRwdH/m/APbgLjSfLWSdz5nntTZQ5zxUGs8a+6npxCNtM2zGDnvBQ75zbTeK5n
HM9qzc1v3ji1je+C12tGQbuJ78JOu9PZ6IQtD9bXW3Ec3tK0fqPld72+KpzURtDVvPClFvl9LQ1c
WgqevfAb8Uav3RVPUOjFrXte7IEk9f0YYJ+UYRXfsQ1CyHvE1wIh3xDfET8QPxFAluEq+lxC/Max
gPMiooD8aobnYwnXV/CXDu7j4Hx5gg8RPjzXvLCXAZaJiPsg3t00riri5jNxMIwji1Ali8nzfZzr
c6oVUUIgJ5UEJ03g5jKxBcEVEReEH58lsR+j2lLNK6fQLEHl9ajmGpmtuSy48hk0j2pL+dH+pH27
cYa+vcV5bcIeFE/Rt0+ZvgluDjJ7MMrx3BVRbyVT19qEHnF92in0FSb0aOXE+vbvztKnTenH6L5L
I3cw5cmUu/kHUEsDBAAAAAAIACEIIQKRvH3ajQEAAKwEAAA4AAAAcmVzL2FuaW0vYnRuX2NoZWNr
Ym94X3RvX2NoZWNrZWRfaWNvbl9udWxsX2FuaW1hdGlvbi54bWzFkzFLw0AUx9/12iatpRZ1UBFU
EAvFNo7FQeniIEUQOugYk8NGm1y4pIKTujk7Ca6OfhAH/QqKzn4AN32pdzbEZtGhL/x4x//eO/6X
l1DQ4T4LQGABPgCgBDIIQBuGMYnMI6vIOrKF7CAd5BK5Rm6Ru+iMkuOFTPi8Z4ZcgK7bfWGGDveg
UDg1e322LbgLmjZYdzjW+4L7TIRnu6bLsJ4LmwnHO8Ia07MFd2yo1bph6G8YRmB1mWsGDbnRsLhr
mP6JIVhgqOJymR8eMytseY47sJDPB5bZY/tqcQCUBixErxdEhyXMLULIDfKcIeQFeUXeECAVmMX9
KeQTI49ZQzKor8T0KCZwPYOPiqimiXl6RA2RNdFZObmvA1SI7LvCPBfr02VfLtYHwz5CoXiufY/t
56wH5XWoZZ8e25uRRmPa+15zoOFnAAUENRplKu+e9KH8Lf7T3xr57U95oSM8p/lL+lB68r2reSz/
cR7VMcyjKO9bjN2rmjKP+hjmMcpfPWUeyfdOE/+W0knKP/cFUEsDBAAAAAAIACEIIQIF+oIIlAIA
ADgJAABBAAAAcmVzL2FuaW0vYnRuX2NoZWNrYm94X3RvX3VuY2hlY2tlZF9ib3hfaW5uZXJfbWVy
Z2VkX2FuaW1hdGlvbi54bWztVctu00AUvROntdOEUAELhFi4okJqheOHbNlBSCgqYoPChgpV7Exi
moATW46L1BVtJSQ+AQm2sOeHyuMH2FZs4I49TvxKaCqxY6KTGZ25586ZufaYAwGsGgCBm7C3AnAZ
WCMAezBrlL+BuI1QEPcQjxBPEU8qAB+qAJ8QXxCniJ+IX4hGYzgOncD3XDv0AhCE/kFgh0NvDLXa
a9s9cB4G3gh4Phrvegm7e+g7qPUDz3eC8PCxPXJQ6wV9JxiO9+H47PisK0pmS7lD/0RXVHUcKzjs
iQob5Xs3GtHAhUHSuVNJf8n1TOyKkcV2Jmy2QHopSW2piq63NdUyjXhWiyattmEopqVqRsxohTUj
G7m9pbOJ6SSRvphn6iRlqeCIyqSMo4gpOpKmltJnlNmimEkUJ5HmpMscKpzsnOx0k4RJLZJ6GYam
Wbqpt614N9GUrpumamiGokVEUUVHMyW1NpNE4VKZTiosF4Vl1IwqWzIjFzNLRvFT4f/n6J88Rzxv
j/uBN+zjpfNi6Lod1x/YsL09CEP/rixPegNnZE9aLKjV80ay7b+SA2ciJ8Jm03v+0umFnfFwxO43
3w4HD+zQBo6bOCEcEQE28Y7sEELeI04rhHxFfEN8R/xAAFmH6xhzBfEbG17HUEdUkN9M8bQ1cXwN
f0mjMRb2V0tiCIuhuVbZvACwTpjuI7vTE12D6VZTOpjpSB0apB5/Gqa5PideEUIMTmAcV8JVU9oK
4/CzA5dYHO05dh55b4nnjSU8E1h7k/fcJYs984zjL+A57y3h8/VJ6nbrAnV7h/1WyRmsLFG3t6m6
Ma4KqTPIczT3GtvvWmpfWyU1ov7kJfxBSY02zu3v6P4if/KceuTPncu9gwlP5rybfwBQSwMEAAAA
AAgAIQghAi9fM4DbAgAA2AkAAEIAAAByZXMvYW5pbS9idG5fY2hlY2tib3hfdG9fdW5jaGVja2Vk
X2NoZWNrX3BhdGhfbWVyZ2VkX2FuaW1hdGlvbi54bWztVktv00AQnq3bJm1CqRAHQByMVHGoamfX
9sY2AqFKCA6oXKgQ6s0khgSS2HJcpJ6oWiH1yo1Dz/wmeuH1O5BgNl43a+dBD3Bjo0+z/uaR+dYT
bTSowucVAAI34ecywGWQiwA8h/ES/A3EbQRF3EU8RjxDOBrAPcx9hHiKOER8QJwi6vXuIA2TOOoF
aZRAtdreT4K0Gw1gZeVt0NsPHyZRHyqV0X43ytndgzjE3DiJ4jBJD54E/RBzo6QdJt3BKzg6Ozrb
0V2Tbhm+SfWWTnGL0A3mTOxauDcZdRzfYp7LM681cno+59T1mMUzxioUE1ZUGW8yn1pNV4uM8ifr
nHeitDTRkUgzCh2NmMmOjPOWDKWngkS9UCgrYswop9o9fSeL4ybFxbjFPddXj5eLIkXvNE7RbjrM
ob5Nmcs90aXyON85rmGb3OM+bfqe5Vhb4qlJme36ts/n+sYV3EKU4RbC5jpnKZknZJYOMatbfvHw
Jqk9OF48Xvw/3f9kujOBjsUptSlnbrNwuuiwHdbEd++OphHfid/EwbCd+c6/O+4IZC2bWZQxl/ni
4CizHMrtTPUFIgrVsG853TLUsnk23w63/xzwV38C6LBxJjJz/iuYyu7htRAM2knUbeO18LLb6233
4k4Am5udNI3vNBrDVifsB0NTBpmtqN8I4jeNJBw28sS1tejF67CVbg+6fXkDxUHaeRCkAWjaMEzx
/jokVdhAu00I+Yj4skDIV8Q3xHfEDwSQdbiGMVcQv3DhlQk1xALyGwov1hrur+InXyLmFO11JaYu
Y5ZlTE1a4avi7Utg9V0tu4Zzbv1T/p2ICgI5rSI5LXsecVXJLSq5C5JbQlySccJqUle5N9GzJ+/8
si6i9LysfAeReSdo9Slal2ZorUGdlLW+V7RKDuUc3s+1ljlRe1XqWlV06VN0ncj/MRftD6a8i1sX
7m987tP6K/eR8+Vz10rzl/Nkxlz+BlBLAwQAAAAACAAhCCECCNjAkY0BAACsBAAAOgAAAHJlcy9h
bmltL2J0bl9jaGVja2JveF90b191bmNoZWNrZWRfaWNvbl9udWxsX2FuaW1hdGlvbi54bWzFk79L
w0AUx981/ZHWUos6qAgqiIVCG8fioHRxkCoIHXSM7WGjTS5cUsFJ3ZydBFdx8k/Rf0HR2T/ATb+p
ORtiu+jQFz6843vvHd/LSzTS6SFJxGiBPogoT2EwogYNYhLMg1WwBjbBNmiCS3ANbsFdcEbecnwu
XdE1fSFJ19s9afqWcCibPTW7Pb4lhU2ZTH/dFKh3pXC59M92TZujXsg2l5ZzhBrTaUthtalc7vi+
u24YXqvDbdOrhhvVlrAN0z0xJPcMVVwoiMNj3vLrjmX3LaTTXsvs8n21OCBN87gPrxdMpyXkOmPs
BjwnGHsBr+ANECvSLPanwCcijZwBCegrET2ICaxn8KgIamrI00NqWFgTnJUK93WiIgv7rpDnIn16
2JeK9NGgD0Zz55nvsf2cda+8DrTk02NjI9C0iPa+V+tr+AwoC6BpQdbCu8d9KH+L//S3w377U160
IZ5H+Yv7UHr8vat5LP9xHqUxzCMX3jcXuVdpxDwqY5jHMH+VEfOIv3ct9m8pnY34574AUEsDBAAA
AAAIACEIIQLGPmLwrwEAAHgGAAA2AAAAcmVzL2FuaW0vYnRuX3JhZGlvX3RvX29mZl9tdHJsX2Rv
dF9ncm91cF9hbmltYXRpb24ueG1szZS/S8NAFMffGU1TrVrUQcRFEJEiRnEpIhQXF0EcRHQztodG
m1y4pKKT/gPuDuLqKjj43/jrH9Fv2jsbQzJol77y4R7fvJd+7+4Rgyy6NIkYzZLFiEZJBfJd6sY4
mAELYAVsgG2wD47ALXgAj+AJlEquH3EZiKYTCUmW1WhJJ3KFT8XihdNs8S0pPCoU2vme0OreVcDR
G0gRcBld7TgeR6+QDS5d/wT1jt+Qwm1QpXIaRcG6bYf1U+454bJ6sFwXnu0E57bkoa2Lx8bE8Rmv
R5u+67XtmGZYd5r8QCeHZBghj+D7hlk0j3WTMXYHXgcYewPv4AN8AmJlmkbNBPhCFLBaYAD6fEKP
o4R8Cj8dcU0V62RGDVM18btM9Rx5mam+e3UHuq+o+sxEH3X7mEnD11bnKn/e9aK9drVB7LoWa0ZC
W1t7bmuDiV79H0NguJMb8Wqo80h7057nevRczvCs/Rm/9tGp+4vnuRzPiz16XmJZ59zRevWc9qb1
9EzpWav8c9ZW+2TWRtQZjCT2uppzb9U+mbUsz9Ucz7U+mbUsz7WcWUvPlJH6Jmqd5XwrvwFQSwME
AAAAAAgAIQghAtHLipOxAQAAeAYAADcAAAByZXMvYW5pbS9idG5fcmFkaW9fdG9fb2ZmX210cmxf
cmluZ19vdXRlcl9hbmltYXRpb24ueG1szZTPL8RAFMff6Op2WWxwEHGRiAiisidEgouLRBxEuKnd
Wcq200xLOPEPuDuIq6ub/8avf4Rv14ytpj0sl32bT+bl2/e635l5qUEWXZpEjCbIYkQDpAL5DrVj
CIyDabAIVsEW2AOH4BY8gEfwBMpl14+4DETTiYQky6qfSydyhU+l0oXTPOebUnhULLbyXaHV3auA
ozeQIuAyutp2PI5eIetcuv4x6h2/LoVbp9nZkygKVmw7rJ1wzwkX1IOFmvBsJzizJQ9tXTw4KI5O
eS3a8F2vZcc0w5rT5Ps6OSDDCHkE3zfMoimsG4yxO/DSw9greAPv4AMQq9AYaobBJ6KI1QI90KcS
ehxl5KP46YhrlrCOZNQwVRO/y1TPkVeY6rtXd6D7SqrPTPRRu4+Z1HdtfV/lz7uetde2VsCu12LN
SGiNRqOlFRK9+j96Qd93bsSroc4j7U17nuzAcyHDcyXDs/Zn/NoHdex5MsfzzD89z7Osc6YMzzcd
e05703p6pvSszf1x1qpdMmv96gz6E3ut5tzbcpfMWpbn5RzP610ya1me13NmLT1TRuqbqHWW8638
AlBLAwQAAAAACAAhCCEC2ctfwHUBAAAEBAAAPAAAAHJlcy9hbmltL2J0bl9yYWRpb190b19vZmZf
bXRybF9yaW5nX291dGVyX3BhdGhfYW5pbWF0aW9uLnhtbKWSzUrDQBSF7zS1TX+oRV2IuCkUkSKN
SxEXduNGcVV0a2wGG9tkwmQqdKUvILh0Ia58B9/GvxfRk3bGltCC0hu+3MuZeyeHyVhkUzZLxGgz
eVGZdKA+oUksgw2wBXbBATgGZ+AC3INn8ALKZT9UXEai7yohyba9gXSVL0IqFG7c/oAfSRFQPj+q
28Ko7WHEMRtJEXGphqduwDErpMelH16h3w09KXyPGo2uUtG+48SdLg/cuKkXmh0ROG7UcySPHdNc
qYjLa95RrdAPRnYsK+aKSqVYSdHj576nuvB8x2yqI7cYY4/gLcPYO/gAn+ALEKvSOnpWwDcij2yD
DPT6lJ5EEfUaHhNJzx7y6owepnuSvXJ6HXWV6bknffZmrqDnclNzNJljOSre2uNf+LvXq/E60fDX
6TDRrBladmrWfGMJlMa1lWRLn0fam/FcW9Bz9c+eH1r/9Vyb43l7Qc87bJbnsb9FzzntzejpO2Wl
7qnR2Zz7+wNQSwMEAAAAAAgAIQghAoCgA3qlAQAAeAYAADUAAAByZXMvYW5pbS9idG5fcmFkaW9f
dG9fb25fbXRybF9kb3RfZ3JvdXBfYW5pbWF0aW9uLnhtbM2UzUrDQBSF7xhNU1u1qAsRN4KIdGF0
V0QobtwI4qKI7ozNYKNNJkyi6EpfwL0LcalbH8En8e9F9KSdsTUk4M+mN3zM5c494WTmEoMsOjeJ
GM2RxYjGSAXyHerFBJgFi2AFrIMtsAsOwDW4Aw/gEZTLXhBzGYq2EwtJluWeSif2REDF4pnTPuWb
UvhUKHTyhtDVxkXIoQ2lCLmML7Ydn0MrpMulFxyh3wlcKTyXqtVWHIdrth01W9x3omW1sdwUvu2E
J7bkka2bx8fF4TFvxhuB53fsmGbUdNp8Tyf7ZBgRj+H7ilm0gHWDMXYDnocYewGv4A28A2IVmkHP
JPhAFLBaYAj1hb56EmXk03h0JD01rFMZPUz1JO8y1T7yClO6W3UHWldUOrNPRz0dM2n00upe5de7
7rXXXm1Ya42M2nCfVtdGwGg3N5LVUOeR9qY9z//Tc+XHnp/qv/U8n+N56Z+e11mW566/756vfu05
7U3X0zOlZ636x1lbHZBZK6kzKPV962rOvdUGZNayPNdyPNcHZNayPNdzZi09U0bqn6jrLOdf+QlQ
SwMEAAAAAAgAIQghAtk/ShCsAQAAeAYAADYAAAByZXMvYW5pbS9idG5fcmFkaW9fdG9fb25fbXRy
bF9yaW5nX291dGVyX2FuaW1hdGlvbi54bWzNlL9Lw0AUx9+Zmqa1alEHEZeCiHQwdisiFBcXQRxE
dDO2V402uXCJopP+A+4O4qirf5G//hH9pt7ZmiaDuvSFD/f45r3km7tHDLLowiRiNE8WIxonFci3
qReTYA4sghWwBjbBLjgAN+AePIInUCq5fsRlIDpOJCRZVutMOpErfCoUzp3OGd+QwqN8vpvvCK3u
XAYcvYEUAZfR5ZbjcfQK2eLS9Y9Q7/gtKdwWVavHURSs2nbYPOaeEy6rG8tN4dlOcGpLHtq6eGJC
HJ7wZrTuu17XjmmGTafD93SyT4YR8gi+r5lFC1jXGWO34HmEsRfwCt7AOyBWplnUTIEPRB6rBUag
L/TpcZSQz+DSEdfUsU6n1DBVEz/LVPeRl5nqu1NnoPsKqs/s66NeHzOpeGV9HeX3sx60156Ww1c3
Ys34oVFXy/X16neMguJXbsSrofYj6U17rvzTcznVMw14brfbv/ZcyfC89E/Pa2zQs/ZnpOz9bzwn
vWk9OVN61qp/nLXakMzamNqDsb5vrWWcW31IZi3Ncz3Dc2NIZi3NcyNj1pIzZST+iVpnGf/KT1BL
AwQAAAAACAAhCCECnU73KHwBAAAEBAAAOwAAAHJlcy9hbmltL2J0bl9yYWRpb190b19vbl9tdHJs
X3Jpbmdfb3V0ZXJfcGF0aF9hbmltYXRpb24ueG1spZLLSsNAFIbPNL2kF2pRFyJuCkWki8alSBd2
40ZxVXRrbAYb22TCZCp0pS8guHQhrsTH8vYi+qfN2BpSsHjClzn8c87kz8wYZFI2S8RoK3pRheJA
fkyzWAGbYBvsgjY4AqfgHNyBJ/AMKhXXV1wGYmgrIck0nZG0lSt8Khav7eGIH0rhUaEwybtCq91x
wNEbSBFwqcYntsfRK6TDpetfot72HSlch5rNvlLBvmWFvT737LAVT7R6wrPsYGBJHlq6uFoVF1e8
pzq+603sGEbIFZXLoZJiwM9cR/Xh+ZaZ1MDYYYw9gNcMY2/gHXyAT0CsRhuoWQVfiAJGE2SgN+b0
KErI1/HoiGr2MK6l1LC4JlorH88jr7G47zHee91XjPvyc30062M5Kt2Y0yP8WetFe51pOHU6iDTj
l3bfibTsXK/+Rg6Up7kRjUa8H0lv2nN9Cc/5FM+1VM9Tf0bKfyzjub7A884/PbfZX/d5ec9Jb1pP
3ikjcU+1zhbc329QSwMEAAAAAAgAIQghAsTDFXbaAAAAbAEAADAAAAByZXMvYW5pbS12MjEvZnJh
Z21lbnRfZmFzdF9vdXRfZXh0cmFfc2xvd19pbi54bWx1UEtuwjAUHGMQkWARiS66YJE1QrEJFEXd
lg0LOAEbC4KC+CRKfIDeoZfrbco8GkRVibHHHr+P7fc0ApwUoDDEN4AOGtBm8UCP3JB78osMgtL5
fOG8w3q9iuzYRh+Rje3bmJpiMhWIsvPbeS4QNbsFJjZt/Gkia8LEye9Et+suu6o47DAa5d6X78bU
2zw7uzpuHPG2OBtXHk2V1eYeHIbypeXFZ1VZnJwvKv7zUwXoS11tpaBCvFIPyB+ixV2TLdrTP3ZB
m/qFQzX160db2DFo2fW/++556sk7V1BLAwQAAAAACAAhCCEC6Q83xIsBAABoBAAAJQAAAHJlcy9h
bmltYXRvci9mcmFnbWVudF9jbG9zZV9lbnRlci54bWzFk81Kw0AQx2dN06YffiIoouCheChixJN4
KfXgwYOIeFDwsraLiTbZsImCJ3tU8AHEq1cfRV9B0RfRf9qNDdGK4sEpP2aYnQm/bhuDLHJyRIxm
KceIhkkH6m3qxyiYAQtgGdTBJtgBB+AK3II7cA8qFdePhApkm0dSkWW1ThWPXOlTsXjG26diQ0mP
CoVuvSsxHygZCBWdb3FPYF6qllCuf0SmyduBwzHL/ZaSbotqNSeKgjXbDpuO8Hi4pA+WmtKzeXBi
KxHayfDIiDw8Fs2o4bteVyWfD5u8LfaSYp8MIxQRnDvMonnkBmPsBjwNMfYMXsArIDZG0zgfB2+I
ArIFhtCvpvpxVFBP4pNEPLOKPPHFDNMz8bNMfY56jOm9S+Sp1F5R75mpPervsTKVmNX7CT+etZ64
9nu5ZNf4ohcX+V5txNnQ3z3rkfjN/dFv5cd+nfp3flmPpJ+998S7+gvvaWIXWe9F9tn78eG6/p13
SXuXUn7VAfda+we/svYrp/xqA+41+59nA96Rd1BLAwQAAAAACAAhCCECsHyOJYsBAABoBAAAJAAA
AHJlcy9hbmltYXRvci9mcmFnbWVudF9jbG9zZV9leGl0LnhtbMWTTUvDQBCGZ5umTT+sHwiKKHgo
Hoo04km8iB48eBARDwpe1nZrok02bKLgSY/6D8SrV3+Ton9E39iNDaGBigenPMwwOxOeblqDLHKK
RIwWqciIJkgH6gMaxiRYACtgDWyBPXAITsEDeALP4AXU664fCRXIPo+kIsvqXikeudKnSuWa96/E
rpIelcvf9ZHEfKBkIFR0s889gXmpukK5/jmZJu8HDscs97tKul1qtZwoCjZtO+w4wuNhWx+0O9Kz
eXBpKxHayXCjIc8uRCfa9l3vW6VUCju8L46T4oQMIxQRnO+YRcvI24yxR/BaYOwNvIMPQGyK5nE+
DT4RZWQLFNBvpvpx1FHP4pNEPLOBPDNihumZ+FmmPkc9xfTePfJcaq+i98zUHg33WI2qzBq8wp9n
7SSuwx7e+t1W3DNG9FBQabBjxNnQ3z3rkfgt/dFvfWy/wVyeX9Yj6WfvPfFu/sJ7ntht1nuVjefd
6/V+7rWqvaspv2bOvbb+wa+m/Wopv1bOvWZ/8yznP/IFUEsDBAAAAAAIACEIIQLUTy8kCQEAAMQB
AAAkAAAAcmVzL2FuaW1hdG9yL2ZyYWdtZW50X2ZhZGVfZW50ZXIueG1sdZDBSsNAEIb/aYxJtNQe
FEQ8e+ih8eyl9qI3QfAF1mQh0SQbNlvBi/ToE4gP5AP4BIpPon9qQlVwlo8Z/pmdnR0PIV4EEBzi
FUCEzqidYm075IAckWMyI+fkkjyQ4TCvnLa1KZQzFmGYLqxyuakQRXeqWOgza0oEwSq+Mqyvram1
dfcXqtTwfVXUmWKBqlJr8hSTSeZcfRLHTZLpUjXTLjFNTBmr+ja2uon74tHIXN/oxM2rvFy9j6WE
/BEwF5Fn8jYQeScfBDLGPnN75JO2SR+QAfXHH3prIeNdHr/bQ9D5Lifb2JLge129Nn7q+621jf6u
90tbzlqtTbb9qXmt9/7M188h/8z9BVBLAwQAAAAACAAhCCEC12fC1wkBAADEAQAAIwAAAHJlcy9h
bmltYXRvci9mcmFnbWVudF9mYWRlX2V4aXQueG1sdZDBSsNAEIb/aYxJtNQeFEQ8e+ih8eyl9qI3
QfAF1mQh0SQbNlvBi3j0CcQH8gF8AsUn0T9tQlVwlo8Z/vmZnV0PIV4FEBziDUCELqidYh075IAc
kWMyI+fkkjyQ4TCvnLa1KZQzFmGYLqxyuakQRXeqWOgza0oEwbK+MvTX1tTauvsLVWr4virqTNGg
qtSaPMVkkjlXn8Rxk2S6VM20a0wTU8aqvo2tbuLePBqZ6xuduHmVl8v78SghXwTMReSFvA9EPsgn
gYyxz94e+WJsMgdkQP3ph95GyHqXx+/+Iehy15NtbEmw+q5eGz/389baBjeatZr3S1v52qKdT81r
s/dnv34P+Wfvb1BLAwQAAAAACAAhCCEC0pE91oQBAABoBAAAJAAAAHJlcy9hbmltYXRvci9mcmFn
bWVudF9vcGVuX2VudGVyLnhtbMWTTUvDQBCGZ5t+pB9qFcEiCh6KhyJGPImX4sWDBxHxYMHLmi42
mmTDJgqe9Kj/QHv16m9S9I/oG7uxIbYFLzrlYYbZmfB02xhkUi9PxGiJ8oxoinSgPqBhzIBFsAo2
QBvsgUNwAu5BHzyBZ1CrOX4kVCBdHklFptm9VDxypE/l8hV3L8Wukh6VSl/1kcR8oGQgVHS9zz2B
eam6Qjn+GRUK3A16HLPc7yrpdKnV6kVRsG1Zod0THg/X9cG6LT2LBxeWEqGVDE9Py9NzYUc7vuN9
qRSLoc1dcZwUHTKMUERwvmUmrSDvMMYewEuOsVfwBt4BsTo1cD4LPhAlZBPk0G+m+nHUUM/jk0Q8
s4U8N2KG6Zn4WQV9jrrO9N4d8kJqr6z3Cqk9Gu6xKlWYOfgJv5+1mbgOe/lk1xjRi4vioDbibOjv
nvVI/Jb/zO+2Pckv65H0s/eeeDd/4d0gdpP1XmM/vfuPnfYk74r2rqT8mmPutfUPflXtV035tcbc
a/Y/z8a8I59QSwMEAAAAAAgAIQghAiP76BeIAQAAaAQAACMAAAByZXMvYW5pbWF0b3IvZnJhZ21l
bnRfb3Blbl9leGl0LnhtbMWTv0vDQBTH3zX9kf6wVhEsouBQHIoYsYu4lC4ODiLioOBytoeNNrlw
SQUnO+rsIq6u/k2K/iP6TXtpQ2hBF33lw3u8ey98emkNMqmbJmK0SmlGNEc6UB/RJObBCtgA26AJ
DsAxOAcP4Bm8gFdQKtluIJQnezyQikyz01c8sKVL+fwN7/XFvpIO5XLD+kRi3lPSEyq4PeSOwLxU
HaFs95IyGd7zuhyz3O0oaXeoXu8GgbdnWX67Kxzub+mDrbZ0LO5dW0r4VjRcLsuLK9EOWq7tDFWy
Wb/Ne+I0Ks7IMHwRwHnATFpHbjHGnsBbirF38AE+AbEKVXG+AL4QOWQTpNCvxfphlFAv4RNFOLOL
vDhlhumZ8FkZfY66wvTePfJybC+v9zKxPZrssSIVmDl6heNn7USukx7e+qAZ9owpPRSUHe0YYTb0
d096RH5rf+Y3mpvll/SI+sl7j7xrv/CuErtLem+yn3k3Go/jey1o70LMrzbjXuv/4FfUfsWYX33G
vSZ/82zGf+QbUEsDBAAAAAAIACEIIQIjDNeZ5wAAANQBAAA+AAAAcmVzL2NvbG9yL2FiY19iYWNr
Z3JvdW5kX2NhY2hlX2hpbnRfc2VsZWN0b3JfbWF0ZXJpYWxfZGFyay54bWx1UDFOAzEQnD3fJW6Q
coECiUg0EUWKuKFAvIGOjgZZPkuJyOWis3t4CC0/4j8wB7aITmSs0di7412vFTQ+BRAs8A5gggTG
bvEHTS7IG/KRfCKrynW7rkddh2ijf7bO+Z3vuW0wndp903fbBqvVJsbDvTHBbXxrwzol1q5rjT28
mN4Hk81luY2+hdaBlVxkceJNNGbUDxG5UiKQGS55rskvoqAqsmB8eRQfUHF/wZUxeB6o8yNPmTxF
8qikQ45zyzWqV/X7JTk2//Gld4xrDT3uqOf/9JATPc4wkVxvfE+N5s1zyYl/+AZQSwMEAAAAAAgA
IQghAqKv70DnAAAA1AEAAD8AAAByZXMvY29sb3IvYWJjX2JhY2tncm91bmRfY2FjaGVfaGludF9z
ZWxlY3Rvcl9tYXRlcmlhbF9saWdodC54bWx1UDFOAzEQnD3fJW6QcoECiRQUEUWKuKFAvIGOjgZZ
PkuJyOWis3t4CC0/4j8wB7aITmSs0di7412vFTQ+BRAs8A5gggTGbvEHTS7IG/KRfCKrynW7rkdd
h2ijf7bO+Z3vuW0wndp903fbBqvVJsbDvTHBbXxrwzol1q5rjT28mN4Hk81luY2+hdaBlVxkceJN
NGbUDxG5UiKQGS55rskvoqAqsmB8eRQfUHF/wZUxeB6o8yNPmTxF8qikQ45zyzWqV/X7JTk2//Gl
d4xrDT3uqOf/9JATPc4wkVxvfE+N5s1zyYl/+AZQSwMEAAAAAAgAIQghAn3q2gjyAAAA9AEAADoA
AAByZXMvY29sb3ItdjIzL2FiY19idG5fY29sb3JlZF9ib3JkZXJsZXNzX3RleHRfbWF0ZXJpYWwu
eG1sdVCxTsMwFHyvToiXShV0YECCoVOGemCJ+AhWNsBNLKUiaaLYe/kSJvhDdri4jmoFcdLpovPz
3YsFSfpmIqYb+iSijALgFXTGCrwG78AcfAKfweXSOu3MiznoXWMqStOya7oBqpu+1pRl+lAN3b6i
PK+d6x+UsmVtWm234WBbdq3S/ZsajFXTcJLsnWlJSmsaUzoEAu8saQ39IOYvZr4VzMQrv9cl+AMI
aAIu4G8if8QFvtc+4YRx5hV6Fc2kYUaEmSToeCZPcd7js7cosI/vjLx7eCLsNs8fewvf87eXo964
45HEccqb3xOzN5j+lf95m19QSwMEAAAAAAgAIQghAlLTU3jyAAAA9AEAAC8AAAByZXMvY29sb3It
djIzL2FiY19idG5fY29sb3JlZF90ZXh0X21hdGVyaWFsLnhtbHVQQU7DMBDcrRPiS6WqKqgHpPbA
KYf6gFQBH+EGNYmlVCRNFPsBvIQT/JA7jFNXtSI60mit8XpmvYIk/TAR0y19EVFGAdAe6IwZuATX
YA4+gy/gdGqddubVHPRbbUpK06Kt2x5V112lKcv0oezbfUl5XjnXPSlli8o02m7CxaZoG6W7d9Ub
q07NSbJ3piEpralN4WAIfLCkBeonMX8z80owE8+GuebgLyBQE3AC/S7SPa5wXgwOR/ieHep11JOG
HhF6klD9nTzaDRqftckW8wyZkXYPTYTZxv4+1+/25p9cjnLjjMfIb/xOjHZw+itf2M0fUEsDBAAA
AAAIACEIIQL63CLrAgEAACACAAAuAAAAcmVzL2NvbG9yLXYyMy9hYmNfY29sb3JfaGlnaGxpZ2h0
X21hdGVyaWFsLnhtbHVQu07EMBDcTexLmpMOBIgCiSsoUIQulOjEl9Ag41jkdHkpdg9fgmj4B/4O
xuCQKMBEo8mOJ97NxpTSOiJiOqN3IlQBTHRLI1bgGrwEr8Et+Ag24HJpnXLm3jTqoTLFT61Lo/eo
pdRt1fZQVXWloiRRTdG3u4KyrHSu2+a5RbZWdhMONrqtc9Xt897YfAgLsXOmpjS1pjLa4ULgmVM6
hb4Q8yv4xsznMTPx6ss/AD8AAZVgBP9i4nskeD/CM8BnHPR4klmEjAgZGdSfYWeHXuX32n550ehF
mWD2Xjx6fEeLpzjMO+/pZ7mBnvwxC09mmfa4Qo/hvvl38Wwvw//zP/v6BFBLAwQAAAAACAAhCCEC
tiCz8AMBAAA0AgAALwAAAHJlcy9jb2xvci9hYmNfaGludF9mb3JlZ3JvdW5kX21hdGVyaWFsX2Rh
cmsueG1shVDLTsMwENyN4yaXSgWB6AEJDhxQDzVCnCo+gV9AlZtYpCIvxb6XL+GG+AX+Dsbg0CiA
mGg02fFod7WCUrqJiJhO6Y0IVQAT3dIeM/AcvASvwBX4ANbgdGqddmZtar0pTf5dt52xFrWUWVM2
HVSXbaEpSXSdd802p8WicK5dKWWzwlTaLsPDMmsqpdtHhQ6qD8fx1pmK0tSa0mQODYEnTmkOfSbm
V/CFmc8EM/Hs0z8A34EYKsEI/sXA90jwf4Svh8846PEgMwmZOGRkUP+Gmx16lV9n++FFe4+vSe68
JwbemiY7EfYdz/S73EFPftklGuzy34z7wYxxLzG6VX8T/uOGH1BLAwQAAAAACAAhCCECgE/M2AMB
AAA0AgAAMAAAAHJlcy9jb2xvci9hYmNfaGludF9mb3JlZ3JvdW5kX21hdGVyaWFsX2xpZ2h0Lnht
bIVQy07DMBDcTeIml0oFgegBCQ4cUA81EpwqPoFvAExikYq8FPtevoQb4hf4OxiDQ60A6kSjyY5H
u6uNKaOriIjpmN6JUHkw0TVtMQNPwXPwAlyBj2ADTqfGKqvvdKMeKl381F2vjUEtRN5WbQ9VVVcq
SlPVFH27LmixKK3tVlKavNS1Mkv/sMzbWqruSaKDHMJJsra6piwzutK5RUPgmTOaQ1+I+Q18ZeaT
mJl49uXvgR9AAhVgBP8s8B1S/B/gG+AyFnoYZCY+k/iM8OrecLN9p+L7bL+8aOvxJYmN8+LAu6fJ
Jvb7jme6XW6gR3/sEgW77JpxG8wY94pHtxpuwv/c8BNQSwMEAAAAAAgAIQghAuWoUWTkAAAA0AEA
ADkAAAByZXMvY29sb3IvYWJjX3ByaW1hcnlfdGV4dF9kaXNhYmxlX29ubHlfbWF0ZXJpYWxfZGFy
ay54bWx1ULtOwzAUPTdOqJdK5TEwMFWIoUO9MCC+AYmNFbmJpVYkTRV7h89gYuN/+CM4CY5qRXCs
o2ude3wfVtD4EkBwhXcAJ4igdosjFuQluSQfySdyPvfBBvfs9nZTuwpFUbZ122E2s/uqa3cVVqtt
CId7Y3y5dY3165hYl21j7OHFdM6b0Zznu+AaaO1d7crAQsSb6KH3B0Q+RQSyGOY4Jb+JjFGRGfXr
RO9R8H7BM6L3PDCeJZ48erLoUTH2Of1rHTQ5arJE8ariHNNafY87xvM/ekjSI613k9SbvlOTfce9
5J9/+AFQSwMEAAAAAAgAIQghAp/XTvfkAAAA0AEAADoAAAByZXMvY29sb3IvYWJjX3ByaW1hcnlf
dGV4dF9kaXNhYmxlX29ubHlfbWF0ZXJpYWxfbGlnaHQueG1sdVC7TsMwFD03TqiXSuUxMDABElKH
emFAfAMSGysyiaVWJE0Ve4fPYGLjf/gjOAmOakXlWEfXOvf4Pqyg8S2A4AIfAI4QQe0WeyzIc/KS
fCSfyPncBxvcs9val9pVKIqyrdsOs5ndVl27qbBcrkPY3Rvjy7VrrF/FxKpsG2N3r6Zz3ozmPN8E
10Br72pXBhYi3kUPvT8h8iUikMUwxzH5Q2SMisyoXyd6j4L3M54RveeB8STx5NGTRY+Ksc/pP+ug
yV6TKxRvKs4xrdX3uGM8PdBDkh5pvZuk3vSdmuw77iX//MMvUEsDBAAAAAAIACEIIQLfK5sT5QAA
ANABAAAsAAAAcmVzL2NvbG9yL2FiY19wcmltYXJ5X3RleHRfbWF0ZXJpYWxfZGFyay54bWx1ULtO
wzAUPTdOqJdK5TEwMCGmDvXCgPgChJDYWJFJLLUiaarYO3wGExv/wx/BSXBUKyrHOrrWucf3YQWN
bwEEF/gAcIQIatfYY0Gek5fkI/lEzuc+2OCe3da+1K5CUZRt3XaYzey26tpNheVyHcLu1hhfrl1j
/SomVmXbGLt7NZ3zZjTn+Sa4Blp7V7sysBDxLnro/QmRLxGBLIY5jskfImNUZEb9KtF7FLyf8Yzo
PQ+MJ4knj54selSMfU7/WQdN9prco3hTcY5prb7HDePpgR6S9Ejr3SX1pu/UZN9xL/nnH34BUEsD
BAAAAAAIACEIIQKlVISA5AAAANABAAAtAAAAcmVzL2NvbG9yL2FiY19wcmltYXJ5X3RleHRfbWF0
ZXJpYWxfbGlnaHQueG1sdVC7TsMwFD03TqiXSuUxMDAhpg71woD4AwQSGysyiaVWJE0Ve4fPYGLj
f/gjOAmOakXlWEfXOvf4Pqyg8S2A4AIfAI4QQe0aeyzIc/KSfCSfyPncBxvcs9val9pVKIqyrdsO
s5ndVl27qbBcrkPY3Rrjy7VrrF/FxKpsG2N3r6Zz3ozmPN8E10Br72pXBhYi3kUPvT8h8iUikMUw
xzH5Q2SMisyoXyV6j4L3M54RveeB8STx5NGTRY+Ksc/pP+ugyV6TexRvKs4xrdX3uGE8PdBDkh5p
vbuk3vSdmuw77iX//MMvUEsDBAAAAAAIACEIIQJCkBTb+gAAAEwCAAAhAAAAcmVzL2NvbG9yL2Fi
Y19zZWFyY2hfdXJsX3RleHQueG1shVDLbsIwEJzNo/GFQAuHHrhU4gIHfOgF9Rv4hzZKrIIgTRT7
Dr/SQ8Wl/9huEkdYAcRIo7XXszPW+hBYewBhil8AESwIWOGMR+YLc858ZX4wP5lxrE1i1LtWe5Ua
lWEwaBtlpbTmeximxb6oEEXJV1YV2wyLxcaY8k1KnW5UnuilfVimRS6Tcid5UnbiINgalUOINoCN
gCMJTLh+g+jE/CEi0AjP9p9/DJ9rwPS4P3P6NR74PGkcWtSaNdcnRxNajWc1QbuS5l2wtK6N/7lH
Q4QH3/6j79VljO9k4E7GyMkYX8lYNZ6XGeRkuH6x49ef83s77XZHN3b9D1BLAwQAAAAACAAhCCEC
X2biROUAAADQAQAALgAAAHJlcy9jb2xvci9hYmNfc2Vjb25kYXJ5X3RleHRfbWF0ZXJpYWxfZGFy
ay54bWx1ULtOwzAUPTdOqJdK5TEwMCGmDvXCgPgGJISQWJFJLLUiaarYO3wGExv/wx/BSXBUKyrH
OrrWucf3YQWNbwEEF/gAcIQIatfYY0Gek5fkPflEzuc+2OCe3da+1K5CUZRt3XaYzey26tpNheVy
HcLu1hhfrl1j/SomVmXbGLt7NZ3zZjTn+Sa4Blp7V7sysBDxLnro/QmRLxGBLIY5jskfImNUZEb9
KtF7FLyf8YzoPXeMJ4knj54selSMfU7/WQdN9po8onhTcY5prb7HDePpgR6S9EjrPST1pu/UZN9x
L/nnH34BUEsDBAAAAAAIACEIIQKA2MVf5QAAANABAAAvAAAAcmVzL2NvbG9yL2FiY19zZWNvbmRh
cnlfdGV4dF9tYXRlcmlhbF9saWdodC54bWx1ULtOwzAUPTdOqJdK5TEwMCGmDvXCgPgGJCSEWJFJ
LLUiaarYO3wGExv/wx/BSXBUKyrHOrrWucf3YQWNbwEEF/gAcIQIatfYY0Gek5fkPflEzuc+2OCe
3da+1K5CUZRt3XaYzey26tpNheVyHcLu1hhfrl1j/SomVmXbGLt7NZ3zZjTn+Sa4Blp7V7sysBDx
Lnro/QmRLxGBLIY5jskfImNUZEb9KtF7FLyf8YzoPXeMJ4knj54selSMfU7/WQdN9po8onhTcY5p
rb7HDePpgR6S9EjrPST1pu/UZN9xL/nnH34BUEsDBAAAAAAIACEIIQIAQJGHEgEAAHACAAAoAAAA
cmVzL2NvbG9yLXYyMy9hYmNfdGludF9idG5fY2hlY2thYmxlLnhtbHVQy07DMBDcjROSS6VCOXBA
ggMH1EODxAVVfAIXxAeASSxSNS8lvsOXIC78A38H49amlikbjSY7nuw4KyijPiJiOqUvInS2mOiW
djUFzoFL4ApYAi9AC0wmo5ZaPapWPteq/O2LShVr9ElSdHU3gGXdV5LSVLbl0K1Kms8rrftlno/w
NnJc2INF0TW57Nf5oMbcmeN4pVVDWTaqWhUaA1FvnNEJ+J2YP4BPZj4TzMTTjX4IfKNicAJE0C88
3VSK92M8roznCXzkeQ6sR1hPYtmcZVvrdv5Oix5IvBpNeNo17ijs3cL5JvcOPNuTG3m57OUaDnPv
kesyZnsybjYz/2awlxH+h5sXfieCPbt98j/7/wFQSwMEAAAAAAgAIQghAp1IcXpxAQAAYAQAACIA
AAByZXMvY29sb3ItdjIzL2FiY190aW50X2RlZmF1bHQueG1slZO7TsMwFIaPk5SmQC/0PiDBwIA6
NEgsiI2dperERE1q1KppEzWGDcGDIAQDQmLjBYHfJKFW1CjqiT7ZPjk5n3MzyaaRRcRon2xGtEtx
YH5Jq6iBQ3ACLsAAXIEZCMED+ARfoFwOJZfi+tZ370Ix/l+LBb/xtLU7Ee4M60olWofCE67UCoKl
CFWDQsH1PX9J1WqU566c3nP5d4Z7wYRTscgX46U/HVOvN5EyOHecEO3nPOzHJ/quP3d4MHPQ00mK
LWsqxZxsO1JD8cRsOsY9PBNjL+AVvIEP8M4Y+zYYOzAZI1ajLur2wA/CxlgCBvJHWl7FDuZNHEmo
mhHGulazHdeYcU0pegVJ73qSK6xyxpDMR5UrarlT7NOM95bur7zqnTbWeA3NS5pXjWnvAN7E0chw
NHMc1gaOZoajleNI91O5rZQ3cbQyHO0ch7nBfbQzHJ0ch7GBo7PGcYaxu8bBMp7VUOuXvs5MfffJ
980y/odfUEsDBAAAAAAIACEIIQK1TpYtHAEAAJwCAAAjAAAAcmVzL2NvbG9yLXYyMy9hYmNfdGlu
dF9lZGl0dGV4dC54bWyNUbFOwzAQfRcnTRgqlZaBAQkGpg4NEkvFxMyG+gFgUqNUJE0UG7EBH1Kx
IX6Gf4ILtakViuBFTxe/O9+7XAQSrAKAcIB3ADuwIOAcGwyYR8wT5hTr3AXzgfnI7Pe1kUZd3VbZ
vVbz77NaypvCO9eN0m0+irKqqBqOsqhziTiWy3lTLeYYj3Nj6rM01VmuSqknNjHJqjKV9V3KHVJX
HIYLo0okiVaFygw3ZDxTwl8DrED0wnxjvhLRoSACDbDPuV3mByPi2GMGrB97eouE3/f4cWhrrjkO
vZrY1ghb01uvDvb+0GliowUziKdWCz3tlGcUdrZuf+c7+sMXW3yDf8zifEdbfKdfPj99yfP1+116
/br3RGf3bsf0yz/5BFBLAwQAAAAACAAhCCECWKkdAfEAAAD0AQAAJQAAAHJlcy9jb2xvci12MjMv
YWJjX3RpbnRfc2Vla190aHVtYi54bWx1ULFOwzAUvFcnJEulAh0YkGBgytAMLIi/YGIDTGIpFUkT
xd7hS5jgD9nhnDpqFJWTTs86n989P4UUPwIILvEFIEEAtTscsCIvyGsyIx/JJ3K5tE4782x2+rU2
JeK4aOu2Z9V1V2kkid6VfbstkWWVc919ntuiMo22m3CxKdom191b3hubj+Yo2jrTIE2tqU3h2JD4
kBRr1k+IfIvIlRKBrIa5TslfQrFG5IL6zUT3OOF5PXTYw3teWM8mnjh4VPBEofq7dG8dNDloiweo
9yFzot1yRhVmm/f3uX6350dyZZI7zxj7zd+p2Q7Gv8o/u/kDUEsDBAAAAAAIACEIIQK1TpYtHAEA
AJwCAAAiAAAAcmVzL2NvbG9yLXYyMy9hYmNfdGludF9zcGlubmVyLnhtbI1RsU7DMBB9FydNGCqV
loEBCQamDg0SS8XEzIb6AWBSo1QkTRQbsQEfUrEhfoZ/ggu1qRWK4EVPF78737tcBBKsAoBwgHcA
O7Ag4BwbDJhHzBPmFOvcBfOB+cjs97WRRl3dVtm9VvPvs1rKm8I7143SbT6KsqqoGo6yqHOJOJbL
eVMt5hiPc2PqszTVWa5KqSc2McmqMpX1XcodUlcchgujSiSJVoXKDDdkPFPCXwOsQPTCfGO+EtGh
IAINsM+5XeYHI+LYYwasH3t6i4Tf9/hxaGuuOQ69mtjWCFvTW68O9v7QaWKjBTOIp1YLPe2UZxR2
tm5/5zv6wxdbfIN/zOJ8R1t8p18+P33J8/X7XXr9uvdEZ/dux/TLP/kEUEsDBAAAAAAIACEIIQJG
urwHGgEAAJgCAAAnAAAAcmVzL2NvbG9yLXYyMy9hYmNfdGludF9zd2l0Y2hfdHJhY2sueG1shVE7
TsNAFHzPa2M3kQKhoEAKBQVKEaeOgBPQcAJY7BWO4p/s7eEYhALRcAcOEc4E42QXWyYoY43GOzt6
s/YKCujFIWI6pU8irAyY6JJaDMEz8AKcgXPwEczBwaDWUqs7lcuHVMW/6yhR0RJrz4uKtKigMi0T
Sb4v87gqFjFNJonW5TwMa2QzWU/NxjQqslCWy7BSdWjDrrvQKqMgqFWqIo2BwDMHdAJ9I+Z38IOZ
x4KZeLjxD8FvwIV6oAP/vOM38PF+jMeiydxDjzqZA5MRJuMZbfaCbXQ7v/WcGc7TeKL13K/1+kqY
s/Xn297Rnl7u9Dba770l8dTvfV2trm3vaEfvzabnb6/T6d33bd2O/izRuw/73/mfe/oBUEsDBAAA
AAAIACEIIQKxXx2i5QAAANABAAAoAAAAcmVzL2NvbG9yL3N3aXRjaF90aHVtYl9tYXRlcmlhbF9k
YXJrLnhtbHVQu07DMBQ9N06ol0rlMTAwIaYO9cKA+AYkJpCYkEkstSJpqtg7fAYTG//DH8FJcFQr
Ksc6uta5x/dhBY1vAQQX+ABwhAhq19hjQZ6Tl+Q9+UjO5z7Y4J7d1r7UrkJRlG3ddpjN7Lbq2k2F
5XIdwu7WGF+uXWP9KiZWZdsYu3s1nfNmNOf5JrgGWntXuzKwEPEueuj9CZEvEYEshjmOyR8iY1Rk
Rv0q0XsUvJ/xjOg9d4wniSePnix6VIx9Tv9ZB032mjygeFNxjmmtvscN4+mBHpL0SOs9JfWm79Rk
33Ev+ecffgFQSwMEAAAAAAgAIQghAn7YTczkAAAA0AEAACkAAAByZXMvY29sb3Ivc3dpdGNoX3Ro
dW1iX21hdGVyaWFsX2xpZ2h0LnhtbHVQu07DMBQ9N06ol0rlMTAwIaYO9cKA+AYktg4syE0stSJp
qtg7fAYTG//DH8FJcFQrgmMdXevc4/uwgsaXAIIrvAM4QQS1WxyxIC/Ja/KRXJPzuQ82uGe3t5va
VSiKsq3bDrOZ3Vddu6uwXG5DONwb48uta6xfxcSqbBtjDy+mc96M5jzfBddAa+9qVwYWIt5ED70/
IPIpIpDFMMcp+U1kjIrMqN8keo+C9wueEb3ngfEs8eTRk0WPirHP6V/roMlRkzWKVxXnmNbqe9wx
nv/RQ5Ieab2npN70nZrsO+4l//zDD1BLAwQAAAAACAAhCCECMgIX/LQAAABUAQAAHwAAAHJlcy9j
b2xvci92ZWN0b3JfdGludF9jb2xvci54bWx1TzsOgkAUnCcYtrDwV1hoZ0XBWhobO0/gBQhsAhGE
AAew8CqeE2eTJRISZzN5k3mz+956ULgLINjjDWAOB3on/KDINXklbzY3T6qiahAE8TNtqjxFGGZd
V1+0bpPMlHEbuUaUVKWO64duTKuHsO/nnSmhVGsKk3R8iHiJwoL1IyKQJXbUK7InuA5mlvSPI9/C
p97yDLCZM+tmlPFcRoaMq7bHvx16Ss/NnN7zJrsMM+XPjl9QSwMEAAAAAAgAIQghAnH7Oqe2AAAA
VAEAACUAAAByZXMvY29sb3IvdmVjdG9yX3RpbnRfdGhlbWVfY29sb3IueG1sdU/LCsIwEJxtUszB
g6+DB4+eemi8COLFm1/gD5Q20GJrStMP8OCv+J26gRRLwQnDLLuT7ERA4UYAYYcXgBgB3DvgB8Vc
MS/Mq/fFua1th9ksexSdrQokSdn37Vlrl5emyVwaBmluG521d90ZpwezlFVvGijlTG3ynh9iPElh
zvomItACW66XzA+D4yDy5P5+1PeQXG/4DPCeE+t65BHBQ4MnqJ/x36KjJBJh5/SemGQZdtKfjF9Q
SwMEAAAAAAgAIQghAsJJ+hxbAQAAFAMAACsAAAByZXMvZHJhd2FibGUvJGljX2xhdW5jaGVyX2Zv
cmVncm91bmRfXzAueG1slZE9S8NAGMefa14atWqrAQULdfQFGjfBRSmiDi6CQwsuR3N9wTYJyS0u
0g/ioINTJze/g5/HSbD+k15oGqnghR/33I/n7p48p5FFtkbEqEoWI1ojNRDf0mxYYB1sgV2wD47A
MTgDl+AG3IFHMAaGwb3uQJCuy4dAYNn2B35IphlJHspmGrSQIDy3OZ1a0H6nEwmJNeeBpGKRe27o
912yrG7I3b7wJNVqPSmDE8eJ2j0x5FFd5dTb/tBJth0c/JUR3DuhiJz0ZF3vSzFEzSNm0R7mZ8bY
C3gFZYOxCtgAm8AGxMq0rXozwVjCXEr6Nu/jvq2AAvwTTfs7UWMZsY3PVPml+X166tjMlVOnZfK+
Pg4bsdMz7sq9SJyRcZ9v48SZGbfz/d6Ia7uGq2RqW1W1FTK1FWb7qgjPY1fM1aup/8+fld5h/+8O
+n3H6DS9I39W6vM9ZgvehC14wx9QSwMEAAAAAAgAIQghAvH4RDWYAAAACAEAADwAAAByZXMvZHJh
d2FibGUtdjIxL2FiY19hY3Rpb25fYmFyX2l0ZW1fYmFja2dyb3VuZF9tYXRlcmlhbC54bWx1TksK
wjAQfdP0k4ULERcuPEEpzVbceJbSBlpsm5DkAF7Gc+oEUhTBNzxmePN5IyAhCSCcEQDkSGCtwQeS
eWDemEXRm9k4VFW3Ds5MA+p6DMFelfL9qJfOt6nR9mZRnb0rp73ahsvSTdbOGg+S2PG9JxGB9jgl
jxeD7ZFFsn750iME10cOSr9lKcce/5k1OZH4ubft0R+fN1BLAwQAAAAACAAhCCEC1M49cPwAAABM
AgAALAAAAHJlcy9kcmF3YWJsZS9hYmNfYnRuX2JvcmRlcmxlc3NfbWF0ZXJpYWwueG1slVDBSsNA
FJyXxCYeAtX24MGDB08VmpNQ/Ib+g2yTlQYbE7IrHvU3BO9e/EedjRsboiIODG/37byZ5YVIsA4A
wSneAMTwEGCFPabkGXlBXpIbsiTT1Fhl9fVNnd8bXXzdm1Ybd0+SolUParPTiGN1V7R1WWCx2Frb
XGWZybe6UmbpH5Z5XWWquc04nPXiKCqtrmhk9E7ntm7xJAnmzH6ByCv5LCKQKU7YOyLfiZA1IgP2
zwd9hwnP887hE06zZj0eaA68JvCayFf3llDqaue/78kh4sfQ/2Ps1WfM/siQf2TMfshYdZ7fM2SQ
MfRLMZHebzwXjnba705+2fUHUEsDBAAAAAAIACEIIQJMpJjp5gAAANABAAAnAAAAcmVzL2RyYXdh
YmxlL2FiY19idG5fY2hlY2tfbWF0ZXJpYWwueG1sdVC7TgMxEJw9Hzk3kcKjQIIyNCnihgLxDVR0
VMi5s5QouVx0tkQJnwEdn8QfwRh8wjrBWKOxd8e7XitofAgguMQrgAkSGLvGL2bkBXlF3pMP5HTq
gw3usV67eusaaN309smudg5VZfdN320aLBbrEA63xnjaWuuXKbGsu9bYw9b0zpvBXJab4FoW8m7n
6tD1eBH93fsdIm8iApnhnOdj8pMoqIosGJ9n8Ygj7s+4BkTPHfUk85TJUySPShpzmtao6uc7hphU
qJ5Vese4VuxxQz39o4dkPfJ6k6ze+J4azTvMJf/8wxdQSwMEAAAAAAgAIQghAiXJwrhXAQAAMAMA
ACwAAAByZXMvZHJhd2FibGUvYWJjX2J0bl9jaGVja19tYXRlcmlhbF9hbmltLnhtbJWSz0rDQBDG
v01iEguFVhQUcvBQEAo2PfcshYqIfx7ArslKQ5ukJAsePFR8C28+Q5/Eg++jk3a3LiEenPAxy2Ty
/Xaya8PH0AYYAnwBaEEFAy7wGx3SEemUdEYakkaka9IL6Y3UbpeSS/EQzUQ0FzEsK4nh+3HBn/nj
QsBxZD6J4bpPRZ7SwvN4Fhc5NXW7PEtS+jY+L8VCRDIv0O/PpFyOwrAkv5SXA9U8iPI05Mt5WIgy
1AaOk0iRotWSBc/KRCZ5Brwyn6YCPsDYJ+mdMTZxGLskgXVwrGb6ptij7JEsqveMehUurQ/p0VH1
TCmfGD2+6rFhbXo81aveHVTZ2/5WXWNj+KsN06jdwFvZam91/4p7RTlo4Fob5y3XZKwbGHcGI2hg
TNU56/r+bjbsGKbfPflVNbthNqe2F82t+2tu7x/c2wbuuoE7Nrh1f7t2D/R5sz/uxw9QSwMEAAAA
AAgAIQghAsBrEyMnAgAAtAYAAC0AAAByZXMvZHJhd2FibGUtdjIxL2FiY19idG5fY29sb3JlZF9t
YXRlcmlhbC54bWzFlL1v00AYxt+LP+IkBEKatBUUhBD0i6hhASEGBhYWJmAH1z4aq05s2cfQCSRm
/gEGNiQWPgYkoCMbMys7I38CPGd88ulkq6ILV/3k6+P3ude+xzmLPProEjFao5gRLVM5MBdUjQFY
BRfAFrgKroNb4A64Dx6BfXAAnoMX4BB8Bd/Ad/AD/AS/QL+fC1/wh3zh78Y8JMfJZ37KcQ2SOMnI
dTM/jJ7kZNsxfyzIskSS4m4W7c0E7u4mQiRz6nSiRc7FXVnS7Rbze0WF5xX/PICp1yumt/862m1/
EWZJFGIWJNmCZzltb8+ESG9Op3kw43M/3ylLdoJkPvXT/WnG86myOU6xHB4sElyul/phGC325CNH
aRpz9M55zAOB16heK09imOkZ8+gG3v8VMfaSMfYavAFvwTvwHnwAn8Bn8AUcAmKDIoMx+I1xAteT
oAVdaLocpzAf4c8u85N1XnkfVzYk96nUOjVaV9OWSq1naLKnfIdlreew7Mm0nq3K15rYjEnfJWgr
mm9Q+tRQNWe0mqWaGtn/bM06en+q+g9135rmG9X4WOUb6L5zmq9f47O0fVrFPlllZqZPrXde08dH
7N8V7J9az/Spb+Cipp+u+QZs7flGZbaOpo1Lza2paxt16lnMnko391jpZmYq78tHfBNyv9aPmdvG
MXPbaMht8x9yu6blttmQ2+Q/5DZpyG29ITczH6Wbv1OlrzTUm2eGZZxr6vxiDefdH1BLAwQAAAAA
CAAhCCEC6rbg/ooBAACkAwAAKwAAAHJlcy9kcmF3YWJsZS9hYmNfYnRuX2RlZmF1bHRfbXRybF9z
aGFwZS54bWx1kktLw0AUhe+YR9PGaq0VWxFx5aKLxoWguNStCxF3rmIT22CbCZlxKfo7XCuI4AM3
PnDp/9KTOKFDqBM+cnPmnnuTOzHIoVuDiNEqbTKiJqmFOKDJckADdMA62AA9sA32wSE4AREQ4BI8
gFfwBb6BZYmhn4S49/mIp2TbqR9EF4JMcxSeSTIMyRPsptFgKLF7yqXkY6pWo1iE8iBLqdXy+CjP
cJz84Rgm183DvT9HpeLHQcqjAFGfp3GYCup2h1Imu54n+sNw7IueSun1+djzk3MvDYVX2CwrLwd7
4gdBFA+0dxd8hIxr5tAWvumGMXYH7sEjeALP4AW8gXfwAT4BsQa14VkGP1gu7nUwA11qerbmELdw
mWr+WV5F7eMsWJPsq7o6l7JW1bRFpdVKWtZzB1pb69lQPZnWkya+bJsKX0fzzU7xzWj92uhnqG8v
+4p6K5q+MKUe0+q5ZLOiXtlXzHJN0+enzNLQ6rXUjExNW1KaNSXPLuUV71LuWejlGRul/6A4b/bP
//ELUEsDBAAAAAAIACEIIQKvsgpX5gAAANABAAAnAAAAcmVzL2RyYXdhYmxlL2FiY19idG5fcmFk
aW9fbWF0ZXJpYWwueG1sdVC7TsQwEJyNA3FBpONRIEEJzRXnhgLxDVR0VMiXWLrTXcgptkQJnwEd
n8QfwRgcYUUw1mjs3fGu1woaHwIIzvEKYB8JjF3hFzPyjLwk78h7sq59sME9NCvXbFwLrdvBPtnl
1qGq7GM79OsW8/kqhN2NMZ62zvpFSiyavjN2tzGD82Y0l+U6uI6FvNu6JvQDXkR/936HyJuIQGY4
5fmQ/CQKqiILxi+yeMQe9ydcI6LnlnqUecrkKZJHJY05TWtU9fMdY0xqVM8qvWNaK/a4ph7/0UOy
Hnm9g6ze9J6azDvOJf/8wxdQSwMEAAAAAAgAIQghApRX94JUAQAAMAMAACwAAAByZXMvZHJhd2Fi
bGUvYWJjX2J0bl9yYWRpb19tYXRlcmlhbF9hbmltLnhtbJWSz0rDQBDGv01iEwOFVhQUcvBQEAo2
PffspSKe/HO0a7LS0CYpyRYPHiq+hTcfyYPvo5N0ty4hHpzwMctk9vtlsmvDw9gGGAJ8AfChggEX
+I0e6Yh0SjojjUkT0jXphfRG6nZLyaV4iOYiWogYlpXE8Ly44M/8cSngODKfxuh0noo8pYXr8iwu
cmrq93mWpLQ3Pi/FUkQyLzAczqVcTcKwJL+UlyPVPIryNOSrRViIMtQGjpNIkcL3ZcGzMpFJngGv
zKOpgA8w9kl6Z4xNHcYuSWA9HKuZvin2KLski+oDo15Fh9aH9OioemaUT4weT/XYsOoeV/WqdwdV
dre/VdfYGt6mZhq1O7gbW31b07/iXlEOWrhW7bzlmgzZwrgxGEELY6bOWdf3d7NhxzD97smvqtkt
XKcxr+Y2/TV38A/ubQt33cKVBrfpbzfugT5v9sf9+AFQSwMEAAAAAAgAIQghAvMpq9a5AAAAdAEA
AC8AAAByZXMvZHJhd2FibGUvYWJjX2NhYl9iYWNrZ3JvdW5kX2ludGVybmFsX2JnLnhtbHWPTQrC
MBCF3xhrA25cqIh4gi7MxoV4AZeeIdRCxZ+UpgfwAJ7AvefUV02tiE74mMxMXvKioFEJIJjhAqCH
EOwt0IYmAzIla7IhUeRzW2TMqTu4EnFsT9vS7bZIkryqipUxPs2zo/XzMJin7mhssTdl5k1zuL3G
uwNrnEU/37qKyI1ABpiwHpE7o8OsSIf95Ue/ji73Qy4JvlXI9Uy/vvDWjT900Q+dtDrpoycq+PjW
qS9/jQ/54/sBUEsDBAAAAAAIACEIIQIIMOClrgAAAFABAAAwAAAAcmVzL2RyYXdhYmxlL2FiY19j
YWJfYmFja2dyb3VuZF90b3BfbWF0ZXJpYWwueG1sdU+xCsIwFLxnjC3oIOrg4OjUoXEUF0dXfyG0
hYitKU0/oD/jd+oLJFgKXjguee+SexFIcSeAcMAAQCKAayf8kDI3zCvz5n2ysLXtkCT6VXb2USLL
TN+3F6VcYapGuzw08sI2SrdP1VVORbOUzui28mprPmOgFCt+901EoDX2Ie/D4FEw8+T6cVT3ELzf
8YrwnjPrduSZBw9FT1Df43/REgsSIXN6T0xmiZn0Z8YvUEsDBAAAAAAIACEIIQLi+hvxrwAAADAB
AAA0AAAAcmVzL2RyYXdhYmxlLXYyMy9hYmNfY29udHJvbF9iYWNrZ3JvdW5kX21hdGVyaWFsLnht
bHVPSw6CMBScR/ktMbIw0ROwoKw9gQsv0QAJRBECuNaFVzHxljqNEI2J00ymnTfte1UIkQkg2OAG
wMMEehk+CMkFuSZ3Nufl7bHt4fu9KerzgCAwp6Jv6wJJUo1jt9V6yKuyMUM6FdK8bbTpDrovBz2H
eb/uumNpe1wlRES9i8iDhERY8bwkn4RDVaRDf//lW7jcx1zONK+a1NY4u7jwLur9rdnzJGbup8f8
lvzp/QJQSwMEAAAAAAgAIQghAoDxEc1DAQAAzAIAADMAAAByZXMvZHJhd2FibGUtdjIxL2FiY19k
aWFsb2dfbWF0ZXJpYWxfYmFja2dyb3VuZC54bWx1kb1OhEAUhc/A8rdosoU/a2KpzRZLYmVMbGy1
MEZrQ1gU4u4OYcZaH8DSytia+Ab+PIOPY68HAkIIXvJlLoc59w53TLj4MgCBbXwDWEUVAjhFEy4Z
kS2yS/bIITkmF+SSPJBH8kwsSyVhFnON5FzmsO08nKW3Cp6XLlWsT+IrjeGwzM/S60TDdcuXc5nB
98v0SGotF3CccDnLZTpjFsl8GecKk0midXYQBCpK4kWoptWWaSQXQZjdBHmsgtpmWWW51pmUnFO/
Fy52eNYnIcQLeSVv5J18kE8CMcKYe9bJD8Ph6hGDum7pRQyZr/EZVDMr9pnVd87PoqXUBj2a1aPZ
Ha3ouU9to9XTr3qKVk80vuLK/nybLZ/b4zManxHBvDOrf+/66nrjlr7SU0809YQPW9T1ur5a7/6X
2Zl9PWPxz538AlBLAwQAAAAACAAhCCEC3XM8Ys0BAACUBAAAKwAAAHJlcy9kcmF3YWJsZS12MjEv
YWJjX2VkaXRfdGV4dF9tYXRlcmlhbC54bWyVk09P2zAYxl/XCU1bCmiCAVMFA3FCo0ECIYS0Czf+
XNimnSaBlxoS0SZR42lH4DtwRFx32xG2SfsC+1LjceRQK0oPOPrJ9uM/7/PaDiePbh0iRh3aZkQz
ZAraX2hUtP4WbIId8B4cgM9AgAR8BzfgJ3gAf8E/0G5nSih5ep4E3zLZe+7LWHztW/10KDM9znk2
DMhxVBQrajSiOJPqWJ4rajbz9ofoIlTkeXnnU5JSq5U39xOlkgG5ruinoaB6XcS9YRL1aH09VCrd
8/0sCOVAZF0z0A2SgS/SSx+B/WKy6+abIX6k5AAx4yiWG6lQQYiYmezLQCVDfSbXzMvP444Yuwc/
wCJjbAU8gl/gN/gDljljxGZoAfPnwH+UJuoWqEFXlq7LJNqz+Bxz/nqea8Y93M4GTVxpbaJCq1ta
12iepb2DpmOuQXttxZw2MYui5+yinrfmtM0cZvlio71fFevOUL+x1k2Zddxaxy1PR1TPfTojrfaR
eK41LG0LZ8zNOZb3L/SyX+3nGHWnIo+a5YdKeeR3U5Gb3mupIrfaC3Mr/C6NyaNTkcea+Q/Ledh3
pv2tvsDfYYW/E8vf6hh/ZR+FXn5TvPTui/fNxvwPT1BLAwQAAAAACAAhCCEC6SGDTX4BAAC0AgAA
KAAAAHJlcy9kcmF3YWJsZS9hYmNfaWNfYWJfYmFja19tYXRlcmlhbC54bWx1ks1Kw0AQx2ebj6bp
B0UEi3jxpJQ0MbXaIl6KHnpoQVARTxKaaIJpU9K1BS/6IN48e/MBfA5vXn0J/W+T0lJ0wm9n8t+d
ZWYSiTR6zxAx2qJjRlSk1BCf0cKyoAwqYAc0QQdcgBvwCt7AJ/gCssyDISdV9b3gzuekKNPA5T4V
Cs4Dj3pBHEex51KxOAm86SiK+dVsu1Sav3eSvFzuNgjDkyiMYtK0kcP9U4c71G736nuGbXebZgsu
PDAPjRqWrl03GmGtZbRCgW02jBqW5Nh+V+Qkq/1I2awzdOMocKla9TkfHVnWuO97A2dsphtmPxpY
zujeir2xNT8sy6IKdDbx+hxVET0zjXbhtxljl+AafEuMZWTGJCADBRArz+a3AX5gOXgdZKC/LOnC
CojX8ajp/PXUiz0NKeckPenJZ5prCquk9/2hSQttTXihyQsN4UdbaMqKJmrrQttcqi2f1pZZqk1d
5LE8qUxP/xktQRJeSvtfvUtamcu8f/bPvH4BUEsDBAAAAAAIACEIIQIToxDv7AEAAOgDAAAzAAAA
cmVzL2RyYXdhYmxlL2FiY19pY19hcnJvd19kcm9wX3JpZ2h0X2JsYWNrXzI0ZHAueG1sdZPNbtNA
FIXvZGzHASdpSyWqCkLYIFRFdRJVoiAW/C2QSFYIQctqlJjaIslYzjRhBxI8BkseAVjDmiVLXgDx
EnDGHsuuVUb6Zjwnc8+9nhtzcuk3J2J0hT4wom0yA88zKkYdtMBlcA3cBANwFzwBLyk7/wa8B5/A
d/AD/AS/gAvPNrCshZgHWFS0UOQ4YRCdhIpsex1NVQghjlZSvcgfjsh1E6mEiuSCPE+cKjmOkkQm
wZSazVUUrGOZqOdpbKuV7x9npo3Gq2g2eyhnMoFNLFT4SChBnc643+t3R8MDMw8PuqO+mfvdY9rd
Hd/qDbAdDHu3MWebdD6mel0spomMpqhZoJI11pNEnsa0txcqFd/x/eUkDOZiuW8O7k/k3Bfxaz8J
ln4ebFm6HrzmKpgo1PeOuXSIe+LE2HXG2DNwBL6Ar+AGZ+wPqFmMcWABGxDboB3Tm78Yuk+boAb9
Y0nX4xLpHm+TY/q6mbU6/d1FyFPib9PYQrPZTnaOn6PVC21Lr1pzC80i+nZfa42KpmtT0K6Watsw
tVml2vRoZ568bTTrjNe91N8+R3POaJ8f6JwjaJ1Szi2Ts1bKeaGIYx45TGsXQdPUoVdu7rzqpXMc
mm+kmoOVcmg/z/h5Jb9qXK5X74lXep73lv3nv/APUEsDBAAAAAAIACEIIQJ37/mmZwEAAKwCAAAm
AAAAcmVzL2RyYXdhYmxlL2FiY19pY19jbGVhcl9tYXRlcmlhbC54bWx1kk9LwzAYh9/031rnZAeR
CV4EDzJKa6ZzzJuo4GGCICIey1ZtcVtLFzbwokc/jB/Ao/iFvHnVX9rUjaFpH/LmSVLevKlONr1q
RIy2qMeIVkk1xD2atwqogwbYBV1wBi7BG/gAn+ALGIaIx4IsKwrj+0iQac7igYioVpvG4SxNMnGT
j9fWyvF5sdBx7uLh8CQZJhnZdhqI6DQQAYXhBe+6h94B7/GO1+66bZe3XL4nQ2kxbhdB4TCJFZ3f
aZ4rvp/HuebFW8SFbz1SpRKMB1kSD6jZjIRIj3x/0o/CUTDx1ITXT0Z+kD74WTjxy8WGITPFcadh
XyBzemY27aAO24yxa3ALNIMxHRjABMTqeS03wDeajd4BGvzLgpetingdj6nuwlG92qddkf7kFFdW
OpM11Pf+cPrcGUTvx9IZS07mIe9/cyGPFZWHtpCHOd/HqmQx6Sz1v8DpstfVWZe/pS/VoDwr+6c2
P1BLAwQAAAAACAAhCCECJcxDw1MBAACAAgAALgAAAHJlcy9kcmF3YWJsZS9hYmNfaWNfZ29fc2Vh
cmNoX2FwaV9tYXRlcmlhbC54bWx1ksFKw0AQhmezmzSxtvSg0IOHCh6kpImFmlJvooKHCoKIeAxt
NMG0CenSghd7FM8+kN58K/3TbmgtOuFjdv7MbmZmw8mkuUbEaI8ajGiblGHdp5WVQA3UwSHogQtw
Dd7AO/gEX0AIGY0lGUYYRI+hJF2fRUMZUqUyjYJZmmTybhFXq0V8uUy0rIcojs+SOMnINFNfhue+
9KnbvWof2V7cajsdGzQ6znEvN7vjeI3Wr6hI8eyW90ylkj8eZkk0pGYzlDI9cd3JIAxG/sRRL5xB
MnL99MnNgolbJAuRfxsNTIOBRC2wOTPpAH6fMXYL7oEmGONAAB0Qqy3mswu+YSa8BTTor2t6bmWs
d/Doar6W8mqfdkP8xVpeQ6HprK7O+0PjK00QfZzmmtjQ8jr66g6LOrZUHdpaHfpqHyuTwXLNUP8A
NJ57rnrdPItvzKDolf0zmx9QSwMEAAAAAAgAIQghAiFwbAiVAQAA9AIAAC8AAAByZXMvZHJhd2Fi
bGUvYWJjX2ljX21lbnVfY29weV9tdHJsX2FtX2FscGhhLnhtbHWRvU7DMBDHz/loUyiIr4EBpAxM
yG1q81FgQEIwMKQjAsYoDTiikCo1RWLqyAPwBrwIz8PMDn+3qVJVcNEv5/x9dzmfbfLo2yJitEXv
jKhOhWEdUmk1sAp80AJnoANuitgF0AanoFJRSXqvNLnuS9rViur16FlnnTTPszzp0tLSME1e+lmu
r8fby8vT78tJXq12l/Z651kvy8nz+pFWF5GOaPQx+uiIQy7CfS7ihmgK3vIbkreax8bJodhXEnt7
SsjQxL12xDE/CI/4wd/RcYtD9qFw6UNSQsSTOMkbJg5OhlLwNiJNBd+o0EyBhhyXlwL1x6820lH0
larV6KmbZ2mXdneV1v2TIBjEKnmMBs1ioxlnj0HUfwjyZBBMgx3HnBTTGyaxxslpxDzawXivGGO3
4MtmzHIYs4EDXEBshTYRsw5+YF5xVxb0txnd2CLWG3jcmTulMs9lmxON/aFZpbZmvNHsUnOIPs+M
5sxppo9w/N+yj4WiD2umD7fM257Wr4AqgGYbbxdnna9lz81gelb2z2x+AVBLAwQAAAAACAAhCCEC
Wd5jGyoCAABIBAAAKwAAAHJlcy9kcmF3YWJsZS9hYmNfaWNfbWVudV9jdXRfbXRybF9hbHBoYS54
bWylUz2P00AQ3Y3tSwK5E1/FFSC5oDqtHXv9FdOdjuIKpwIENEiWY3CED0e2yUlXcR0SHb+In4P4
A1fCm018jiKoWOvtzr6ZeTNrrzU2Yuc6Y5w9Zj8HjE3YdnDGEtaPMXAfMAEHOAXmwBvgJfLeAd+A
78DBQZEvPxQtM4zL5aIt2GSSfm6r+bKuqzpfsMPD9TK/XFV1+1q5j466/fkmbzx+vyzLs6qsajYa
rdK2eJ62Kbu+ub6Zx3boiwhT5tjSE5ZjB6Zje6GwXNvpzdA3HWFJW7omdlEsLN+0fMwvpPCwN6UI
G+XwTV+QWBALx3Rt1ydN1zNJg0wvTFxHuLKEGrRpOosozPUpLKRE1zdDTJkqCBlUIm1a/Z0qgGqG
VpRUzSOIypEDKlbff+JKSJaRiApvbbnJ7cGv5qGYZRRPlSSpzGJlyMaxcVJpys2kHFJIko1pgU3Z
0vmPdGpL2kEGUs5IAocgESlvzaChbfdtgt5QURsjMFVOZykK4rHwSisUoaobCStKEONdseEw/bSo
q+WCnZwUbbt6Np02WZFfpI29ddhZdTFNVx+ndd5Mu2Bdp9uDG7nOsxa3iX3hI/YUd/YV5/wt8Evj
fKBzrgE6YACM32PHiHkI/MYYbe//APzXHZ7GXdiP8Bg7/wnr8wx+vOH4X7hBzz2glTit5/BX/jgl
Tt/jqI9E1e37uLPtY7DTh9HnPen0D4AhAE6jVduedV9L23sH3Vn5P97NH1BLAwQAAAAACAAhCCEC
ykU//oQBAAAYAwAALgAAAHJlcy9kcmF3YWJsZS9hYmNfaWNfbWVudV9vdmVyZmxvd19tYXRlcmlh
bC54bWydksFOwkAQhmfbLbQihIMxmHhA48EQaGlNCHgzauJBExNiDDebUm0jUkI3kHCRo4/k0Rfg
mfRfWAJBvDjNl9n5OzPdzq5OJpV0IkaH9MmIdkkZ1re0siwoghI4BS1wDe7BMXKroAOeAOci7gvK
ZKIwfokEGcY47oqI8vlRHI4HyVA8zuNCYRnfLBIt6znu9S6TXjIk0xz4IrryhU/T2XR253rVZuDa
brVe9qq1ut2SzkvlCr5ck1FQWyQgkAlwXtuVCc2yLJ/IJm59S1Yqkzx09H5/ou2eQXLr5Xnxokfj
fz0a8x6NCWWzfr87TOIuVSqREINzx0mDKHzzU1u9sIPkzfEHr84wTJ1lMudyJhjsKAwEZgSbMpNO
4I8YYw+gAzTOmA44MACx4vzc9sE3zIS3gAb9Y02XlsN6D4+hzt1SXtVpbdLfrcX1WGoGK6l+WzR9
pXGirwup8Q1N7kPetYO1feyofWhr+zBWdSxHGSa1jLqb0HTpdfWvm730jRks/5X9MZsfUEsDBAAA
AAAIACEIIQLV63JbswEAABwDAAAwAAAAcmVzL2RyYXdhYmxlL2FiY19pY19tZW51X3Bhc3RlX210
cmxfYW1fYWxwaGEueG1sdVJNa9tAEJ21JFtuSWggBR9SUK9h9bFrOXV6KJTkkIKTWyg9ClntijqV
sRcHnIvpL+uP6G/JtX0jydiYdsTbmX1vdmY/5JBPZw6RoDP6LYheUmuIb2hnfeAEeAto4APwCbhG
3h3wBPwEul1TlN+MJc97LKfW0NHRqiwe59XCfq7nx8fb+U2T2O9/LWezq2pWLcj355k115nNaPO8
eb5Vl1KbMI3U+EqlUSqTaJwGahgNZRIoLZM8VHUc6q2IaKylnoykZlHVIqRLdnqlLvJEgg7ASB2A
MirNmzwtQ86D0xOtZIpMrhAwC44LhHp9i746T6LRiPeAyukITi1DjiSyVTPU8zrgZpDgebKuD5Xw
BnlIjV4NjUom6l0dq4s19XrZj+miKqd0fm6snb+P42VuiodsGbVClFcPcTb/Hi+KZbxNdl2+PLzA
qsgtLpM2wqcAb3QvhPgCdFwhHMAFPIDEKxpAfw38gfXgfaAD3u7xbC8Qn+Jz2//Bbz1riD0xaDjx
D66z47D810fmnAOOe07ADfZ69tuenb2e7m7dm9aTB3Qb3WHvtOc6rOUcnHd7LvGfe/gLUEsDBAAA
AAAIACEIIQIW6fpy1wEAAJgDAAAxAAAAcmVzL2RyYXdhYmxlL2FiY19pY19tZW51X3NlbGVjdGFs
bF9tdHJsX2FscGhhLnhtbHVSTYvUQBCtzsdMRtnFBYU5KIzXpTNJd8g28SCIHlYYwYuIx5CJZnDW
DJmQhT25/8Kfs2f/kDf1VT7MOGiHl+p+VV2vqrtt8uibTSToMb21iO5TPwTRJY1jBpwBTwENPAde
A3eI+w78AH4Ck0mRbz4VNbnu9WZdF3Ry0mzy611Z1e/b9enpsL7sAmezj5vt9mW5LSvyvF1aF6/S
OqXb6rZ6E8m40KtYRpmvlkqGC1/LcJmw0TfwqqjQja9XmKkGjJFadYyRKmnamKTNYBBjmFCRjApf
Nxo0z8EkMuJlFkpWWfhQkL5mER8bYuTsNRKEcAQH6MVQg/lTQ8wCyAb1NuMqafOroapWtxXsCx8J
rbKuQ4hyh6w9erkHraQ5SGD+ShAfS8TtySnTN8tHgy0qZMqgPtOokGtNiovmAnWqGL/khqbT9Mu6
KjdrOj8v6nr3LAj2WZFfpftl71hm5VWQ7j4HVb4PhmDH4YvD7Td5VuMi6avwaIH38U4I8QGwHCFs
wAFcgMQDmsP/CPiFMYX1AAt8fcDzuIf5Q3xO/xa93rIPc1fMO078g7NGDtvvXjBnH3GsuQI3P9Cc
9ZrWgaYz7nvSW3KBSee32dp9X8e57KN+h77Ef87hN1BLAwQAAAAACAAhCCECc0mnIAICAADUAwAA
LQAAAHJlcy9kcmF3YWJsZS9hYmNfaWNfbWVudV9zaGFyZV9tdHJsX2FscGhhLnhtbHVS3YrTQBid
adI2VXZxQaEXCuPtkkxnMvlpFARZL1ZYL0W8DGk1xa4tTdgFr9x732VfwYfwdUTPN5n+UHTCme/k
fPP9JeOxgP3yGOPsKfvRY+whc4szdsn2awScAc+BGHgFvAV+49wQcQnwEhgM6vnic92yfv92MWtr
dnJys5jfrleb9oN9Pz3dvl92B0ejT4vl8mK1XG1YEKzLtn5TtiW7u7+7f6enoc6kmlaRknkWKhFp
mSShkoZYAUXm+dVUFjrUscwrJVUa4mxsBGhBNMl2NG+wqcSquYh28jK3YYnUGhlSyp8KLeMUZKpF
TDGWaZlREyZEcZOQNY2lICIybrc+WFMphMWJUF0C1LQlUREtQyqQ8yKXKYjRIpN5ERYiC4sqcoUO
kzW2jhE2Lx1VaMcOa1yLEfWIWXQcYpSMvpmiEWJtZ51SC2ZHs1QoZM9oKqPDWBaxoK1j5EAFK9CE
2lHa7ci64yLa69/YcFh+nW1Wixk7P6/bdv1iMmmqen5dNtI5ZLW6npTrL5PNvJlsD/s+/XVcnZt5
1eIWfOcBE7hb7znnH4Gez7kH+EAfYPwRG8P/BPiDNYQNgB709kCn9QD8MR7f3ePAWfKB9/m40/g/
tN5eQ/jP16R5RxrVvII2Pqg5cjV7BzX9fdwzZ1kfGHR+j6zn5jrO5R3Nu52L/+c7/AVQSwMEAAAA
AAgAIQghApgQv5XDAQAALAMAACsAAAByZXMvZHJhd2FibGUvYWJjX2ljX3NlYXJjaF9hcGlfbWF0
ZXJpYWwueG1sdZLBattAEIZnLcmWmibkUEICPajQQwnrldey5Di3oBZ6SKAQSshRyGolqljG3iSQ
S33MY+UB8hR5keRfeY2Nadd8M6N/dkar8VrkEreIGH2kZ0b0nsxCfE7r1QH74BB8ASPwDfwAQ+w9
AxNwC2xblRNF7XaRl78LRY5zX45VQbu7d2V+P61n6qp53ttbPX9fbvS8X2VVJXVVz8h1p6kqvqYq
pcXL4uVCRiLiclB1e+KE97QLuTaZ5F0ppC9FzLt9ES+DgegnMuaRGPkyFJKH/gjlYQIBcdgkQg7t
UisybtIyznRxz9cV6B37aKO7x5V+G6h6sCdVxKNKogCp6Nwc7OGiaTFIhjA+oj6MfsGQR033KJF9
hHLAh9roFATsXdY9UKeTTsazuhzT8XGh1PQ0COZZkd+kc2ESIqtvgnT6J5jl82C12bb1oDDtuzxT
GBzRgrn0Gf4TY+wnuAYtmzEL2MABxPab//IAvGK58B5oQX/c0PXaQfwBP8fcBc94U9e6JOuvt7wy
K81hh6bfPzRrrdlET2das7c0fQ59/442zvHOnKO1cQ5nXcd2qM201jb3FZqlvWW+dbuXtTWD1bey
/8zmDVBLAwQAAAAACAAhCCECPsL+IMcBAAA8AwAAMQAAAHJlcy9kcmF3YWJsZS9hYmNfaWNfdm9p
Y2Vfc2VhcmNoX2FwaV9tYXRlcmlhbC54bWx1UsFu00AQnY3txKa06gGhInEwEgdUrTdeO04I4oIK
Ug+phEAIcbQcgy3cOkpWrdRLc0J8Fh/CX/QD4E2yUaIIxno7O2/fjmdn1yGfXjtEgp7Sb0H0kKxh
PqGt9YBj4AR4AYyBd8B74BzaD8Ad8ANwXVNfGep2q7L+VhnyvJt6aio6PLyuy5tZOzefV/HR0SY+
XwuD4GvdNGdt087J92e5qd7mJqfl/fL+QidSDwqtRjIOUxlplbJLm1hGwyJmYhQyCy6MeCyitRgB
i+FYPDwbS51Aq2No9SBc5b290COVjNmk1kgHfaIymSkdRhmEmBRgXnI+jjG3Kxj0JLO71CBEbjlU
STjEOJpoLRPdJDLmOlOVFilviVWGdY7ZrXQ7v1cxm76lXi+/ms7bekqnp5Uxs1f9/qKoyst8oeyC
KtrLfj773p+Xi/5G7LrcObT/uiwMOklL4dNz3NMzIcQn4AvQcYVwABfwABLHq7t9DPyB+fAB0AH/
c4dnO8D8ET7Pvo3Aeruv85Gcu2D9hDacJ05svn9wzpZziX69Yc7d47gOfo9Pdup4YOvo7NThbfeJ
A+oK5rr2/YJz2Dv2rPu5nL0ebM4q/tObv1BLAwQAAAAACAAhCCECyFZz1z8BAAD0AwAALgAAAHJl
cy9kcmF3YWJsZS9hYmNfaXRlbV9iYWNrZ3JvdW5kX2hvbG9fZGFyay54bWydksFKw0AQhmeySZNL
oIptI3jwIAgVG4+iXr35DromKy02TciuiCd9DUG8+ho+lHedrUmzhA3VTviZ7MzsfrPLMAjgiwEg
7MEnAK0qQ4ALaKxP2iedkM5Jl6SS9EQKQ6m4Etd3efIgRbpaiwW/nRvrohRS54MgLfmjzoHv80Va
5rMUxuOpUsVZHMtkKjIuJ1VikuRZzIv7mDbHdbHrzpTI6CAp5iJReQkvGEBEvbwB4jvpg/SKiID9
ZXyL9E3mkvdIDsUPjLg2n/536KtN16hlrKnpVTVuVeNVXufo7ba1936fbxWr6xxLHWtieAz+M6v6
bTN1LzfkB5Ze2Aa9dHEHHdzhBtx19z0yuMMO7ugf3L++s8kdWbhX5CML11lzX5NxaDAiC+OU/K6F
gQbDPC+EHtbntfex1ozXs4wds/8DUEsDBAAAAAAIACEIIQL4wvyzPwEAAPQDAAAvAAAAcmVzL2Ry
YXdhYmxlL2FiY19pdGVtX2JhY2tncm91bmRfaG9sb19saWdodC54bWydksFKw0AQhme6SZNLoIpt
I3jwIAhFEo+iXr35DromKy02TciuiCd9DUG8+ho+VO86W5NmCRuqnfAz2ZnZ/WaXYeDDkgEgHMAX
AK0qQ4BLaGxAOiSdki5IV6SS9EwKAqm4Ejf3efIoRbpeiwW/mxvrohRS530/LfmTzoHn8UVa5rMU
JpOpUsV5HMtkKjIuoyoRJXkW8+Ihps1xXew4MyUyOkiKuUhUXsIr+hBSL++A+EH6JL0hIuBgFd8h
fZM55F1Sj+JHRlybR/979NWma9Qq1tT0qxqnqnErr3P0drvau7/Pt47VdT1LHWtiGIH3wqp+20zd
yy35oaUXtkUvXdxhB3e0BXfTfU8M7qiDO/4H96/vbHLHFu41+dDC7W24r8k4NhihhXFGft/CQINh
nhdAH+vz2vtYa8brWcaO2f8BUEsDBAAAAAAIACEIIQLHqQ2D9gAAAAQCAAAuAAAAcmVzL2RyYXdh
YmxlLXYyMS9hYmNfbGlzdF9kaXZpZGVyX21hdGVyaWFsLnhtbHWQQU+DQBSE5wELeGtiEz00sb1y
6Ho0nvwBXo3xZAigS2wLYTcx8eSf8e4/1KEugZD6yJe3zDLDvg2RIgoAwQrfAM7gS4A7jJWQBbkk
a5KRR/JMXkgUufrgEMemql+Ng1LvdekMe9Hsmg5Jkh/KrqlLZJlxrr3V2ham2ud26ze2RbPXefum
u8rq4WOlrMnbivG2/qj612ZHGfiU9HiWjYg8kCfyRSCLo35OflgRuyIB9ZuJ3lfM9ZKP+BmV7/1e
Sss1RAbfcuJLT/jC0bfi8ir055j7+rx79ouJnvi8YJInY57iVH8zzLThH/OscHYHw6zyz938AlBL
AwQAAAAACAAhCCECtuJXkscAAACoAQAAQgAAAHJlcy9kcmF3YWJsZS9hYmNfbGlzdF9zZWxlY3Rv
cl9iYWNrZ3JvdW5kX3RyYW5zaXRpb25faG9sb19kYXJrLnhtbJVPywrCMBCctZUG9eATPHj0oB6M
R/Hozc+IbaBF20ob8KhHf8E/8C91CwmWggcnDLtsZicZDwIvAggzPAC0YcGzDb7oMifMPfPAFCIq
1FUdzxpBoLKoyJMIq1VszGUnZRnGOlXl2l6swzyV6nKShS6lE/t+YnSKTscUKisTk+QZ+95JoMf1
SUSgPqbcD5hvBn8JrYo8n9fmFXzux3wcKs2W67Cm8ayGnMbW6k5w4iWCm2ffbO45v9EffouaX3PP
a2RzGehH5g9QSwMEAAAAAAgAIQghAnqwsbXHAAAAqAEAAEMAAAByZXMvZHJhd2FibGUvYWJjX2xp
c3Rfc2VsZWN0b3JfYmFja2dyb3VuZF90cmFuc2l0aW9uX2hvbG9fbGlnaHQueG1slU+7CsJAEJw1
kRzRwidYWFpICs9SLO38jDMJJGgeJAeWWvoL/oF/qRu4wxCwcI5hl73ZuRsHAi8CCEs8APRhwLMt
vhgw58wD88gUIqrUVZ0uMTxP5VFVpBGCING63EtZh0mcqXpjLjZhkUlVnmUV19KKXTfVcQbf15XK
61SnRc6+dxIYcn0SEWiEBfdj5pvBX0KvIc9XrXkDl/sZH4tGs+M6aWkcoyGrMbW5E5w4gHdzzJvd
Pes3/cNv3fLr7jmdbDYD/cj8AVBLAwQAAAAACAAhCCECRZCSH1IBAAAoBAAALAAAAHJlcy9kcmF3
YWJsZS9hYmNfbGlzdF9zZWxlY3Rvcl9ob2xvX2RhcmsueG1snZNPS8NAEMXfNrGJh0LV0j/iUahU
bI6CJ29ePHkWNCYrDTZNSVZ61Ks3r4J69Uv5XfStTexSEqqd8JjszOz+ZsPEgosDGxDYwyeATeQm
gFMsrEn1qWPqjLqgLqkn6plqNDLlK3l1mwT3mQzRas3Xs2gSJrPfcFEmJ/7N2FhPU5npvOuGqT/T
OTiOPwnTJAoxGIyUmp54XhaMZOxnwzwxDJLY86d3Hjd7RbFtR0rGPCiTYxmoJAUehcvbAa8Q4o16
pz6oFyEERBNd5raoL9oGfZ2qMb5vxLW5fG/xKUzXnNPvGDVOXlPLa+rzT4l8/3YRsxcx0UBdWHkf
y2dphqJvlzBsgwGDof3PHUq4Vkmd2csRnIeil3ZJL9f0nZJerDV6qeJ2KrjdNbir7ntocLsV3N4/
uH/9zia3V8LVc7W7Yq6wgtE3GMtnWUtzX8y3qPgfvgFQSwMEAAAAAAgAIQghAp0FlbhRAQAAKAQA
AC0AAAByZXMvZHJhd2FibGUvYWJjX2xpc3Rfc2VsZWN0b3JfaG9sb19saWdodC54bWydk09Lw0AQ
xd82sYmHQNXSP+JRqBRpjoInb148eRY0JistNk1JVnrUqzevgvXql/K76Fub2KUkVDvhMdmZ2f3N
hokFF0c2IHCATwDbyE0AZ1hag+pRJ9Q5dUldUc/UC+V5mQqUvL5LwodMRmg2F+vZaBIls99wUSYn
we3YWE9Tmem860ZpMNM5OE4widJkFKHfHyo1PfX9LBzKOMgGeWIQJrEfTO99bvaLYtseKRnzoEyO
ZaiSFHgSLm8HvEGIOfVOfVCvQgiIBjrM7VBftC36OlVj/NCIa3P53uRTmK65oN8zapy8ppbX1Bef
Evn+3SJmL2PCQ11YeR+rZ2mGom+VMGyDAYOh/c8dSrhWSZ3ZywDOY9FLq6SXG/p2SS/WBr1UcdsV
3M4G3HX3PTa4nQpu9x/cv35nk9st4eq52l8zV1jD6BmM1bOslbkv5ltU/A/fUEsDBAAAAAAIACEI
IQKwVUxcRAAAAHwAAAAxAAAAcmVzL2RyYXdhYmxlL2FiY19yYXRpbmdiYXJfaW5kaWNhdG9yX21h
dGVyaWFsLnhtbGNm4GCoYWBgYGSQYTAA01AAZCgwIAAXV05iZWqRbk5mcQmI38DIAdTJwMDEKMCg
AqSFgPg/FIDkRYAQBpiBaiSwqAEAUEsDBAAAAAAIACEIIQKwVUxcRAAAAHwAAAAnAAAAcmVzL2Ry
YXdhYmxlL2FiY19yYXRpbmdiYXJfbWF0ZXJpYWwueG1sY2bgYKhhYGBgZJBhMADTUABkKDAgABdX
TmJlapFuTmZxCYjfwMgB1MnAwMQowKACpIWA+D8UgORFgBAGmIFqJLCoAQBQSwMEAAAAAAgAIQgh
ArBVTFxEAAAAfAAAAC0AAAByZXMvZHJhd2FibGUvYWJjX3JhdGluZ2Jhcl9zbWFsbF9tYXRlcmlh
bC54bWxjZuBgqGFgYGBkkGEwANNQAGQoMCAAF1dOYmVqkW5OZnEJiN/AyAHUycDAxCjAoAKkhYD4
PxSA5EWAEAaYgWoksKgBAFBLAwQAAAAACAAhCCECUs38ZGEBAABMBAAAKwAAAHJlcy9kcmF3YWJs
ZS9hYmNfc2Vla2Jhcl90aHVtYl9tYXRlcmlhbC54bWytk81Kw0AQx2ea2ERpofWDWmrRgqceGk9a
vHjxIvSkDyDbdLHB5oPsIuilnnwEj149+jq+jU5g1y4hq4c64c9mZ+c//GZhHfBh4gIgHMAnAGyB
CgS4hFW0SEekIemEdEG6Il2TlqQXUrMpJJP8lidsuuCzn32WcyFo73l3OXuI5CM4jshDaDTCNKGS
RN5ET5yOWTLL02gG9fo0kjHLYDicS5mdB4EI5zxmYqQqRmEaByy7D6hzoF2uG0keg+8LvuChTPOC
+xl9mgzgDRDfSR+kLiK+kgBbsE9n26Qvig1aPVKN8mMjX8Qm/e/Sh+o+ijpXnftUWqyFb0K5HcPn
K1/N8IHh0zm09NozetUretVWvnZb5ZxVDk/BWzpqznIvnS/z6vk7FXPgL3No5u4/MnctzB0Lc+8P
Zts999dkHhvMfQtzr4L5mNbDCmYdmm+wJt+ZwTew8JU5nNL70O8ALe/mG1BLAwQAAAAACAAhCCEC
EYgvavUAAAAEAgAALwAAAHJlcy9kcmF3YWJsZS9hYmNfc2Vla2Jhcl90aWNrX21hcmtfbWF0ZXJp
YWwueG1sdZA/S8RAEMXf5M8mYnOKgoKN7QmXShArP4Ct4HWGJNwG79yQDQg2+jns7f2G+hJ3SQw6
4ceEt/NmZydEiigABGf4BLAHFwLcYIxePyCn5JxckHvyQDZEKV3VG90hjp/rstPMVudNxVyYrWmR
JPlT2Zq6xHKpu665zjJb6GqX25U7WBVml+XNY9ZWNvPFvk0U2fql72bNljLeJMUJ770TkTV5Jx8E
shj0Q/LFiJhjElC/muh9KP4f8RP3xqHOnafAQpzvdqgbfYnzBRMfRp9cQr3GPyv8pYVutnkvP9vx
RE//mC2c9NuHEt9v7gtnO/BvlX928w1QSwMEAAAAAAgAIQghApz62ASnAQAAgAUAACsAAAByZXMv
ZHJhd2FibGUvYWJjX3NlZWtiYXJfdHJhY2tfbWF0ZXJpYWwueG1snVRNS8NAEJ3NRxOrwaqtLSL9
ooIUbOpB0OLZk4g3jxKThQbTpiQBEQ8W/4BH8eLN/+OP8SjoJGbbJXZRM+Gxy2Te29l5sDLoMFUB
CGzDOwAYkAYBOId5lBAVRBOxizhAHCNOEGeIO8QD4hHxFOsYYWRF9JKOrSuPOiBJrgO67gTWTZwA
VbV9zw+gWAxty6MXrhMNQVH2+/0d0DRr7AQ+ElhVtzuMosnANEN7SEdW2EsLerY/Mq3JtRnQ0GQk
RXEjOkJlz7qlwZ7nhhEKJcdgByH1qB2hJsCU6HhrgBcg5A3xTAh5RXwggJSghv/WEJ8YBVx1hIT5
DpePo4j7Mn4s4ppTXDe4mqW0RooHm2qR9L+ebCWS6HO5AWj3ctpHVis+4zDR/HkGEZyxiizGq3C8
5RkPZjwFoX7vZZW79ybHW1lw71i7urCnuTbMe1rneTWOpy3gydxdDCgQNpssj+Wrgplt/dIf78ER
50GWx/LZmbB8dsYsXxb0Vf+HlwbnZSOnl80/eNnK6WU7p5dtgZctwcw6Ob3sCLxsCrxsCLysC3Sy
7wMRvCdfUEsDBAAAAAAIACEIIQI/DtCgmQEAAIgEAAA6AAAAcmVzL2RyYXdhYmxlL2FiY19zcGlu
bmVyX3RleHRmaWVsZF9iYWNrZ3JvdW5kX21hdGVyaWFsLnhtbJ2TS0vDQBSF77SpSV9QRG0r9rFw
VbFZKi5ciCstKOJWJKZjG/pISQbEVV36A9wILgQXbt35+HN6piR2CAlYp3zMnZObe3IvnTQZdK8R
MdqgAiMqUrAQn9J8lUATbIEdcAhOwAXogQfwBF7AGygWfWEJfmn3uT3g3d/zxOO+j7NhdD3rxroa
cspmnbHPRYdfC8rlZvGZ0+sL5MwO5+6E8vlZeOAK4Y5I161x13OdLrVafSEme6bpw2hk+e3gQdt2
R6Y1GZiwM8PkTGZWhDTNEXwEr6F1y73toeNLL58PuS1cj+iOGbSJHp6JsVfwyBh7Bx/gE3wBYiWq
IGcVfGPp2A2Qgi4UXa4s4hX8tGCWMi8dPEfMqrQ0lZoWo2VitKWIJj3l964pnoXAM1wyp4O9rOTk
gpyU8l00r70caiyihX4VpVY+xm8XezXGjyl+KaWXY9Kn6WCu0ffCeusL1NtX6kXfC/VoD6FejvGX
Pddi/NWeZU79D3NpLNDHkdJHI2EuzX/OpZkwl3rCXGoJ+dH/XjpyP8J7wBLuzQ9QSwMEAAAAAAgA
IQghArTEvkFpAQAAgAIAACQAAAByZXMvZHJhd2FibGUvYWJjX3N0YXJfYmxhY2tfNDhkcC54bWx1
kc9OwkAQxmf7B4oK0UQTDh7wSsqWLQWKBxOjB0zq0RjDqYFqG4slsIHEE2/j2TfwSbz5HPqtlECI
TvPL7Hwz29nZ1cmipUbE6JR8RrRPuWHdp42VwBE4Ay64ADfgDbyDT/AFCoU4Sp5iSaa5SEYypnJ5
nkSLSTaV979xpbKO+6vCUukxSdOrLM2mZFmTUMbXoQxpMLgVri263O0GwufCt12RNgTveHajy5ut
wHXtHne9FJHo2Y0m74gAO9xaT8U+77RqeUWbex3b491W0OY+KsQrFYvhy2iaJSOq12MpJ+eOMxvG
0Tic8TzBh9nYCSfPzjSaOetiw1Dnw5DzaChxXqIls6gGf8cYewCawZgODGACYodURf4EfMOK8BbQ
oMstXdke1sf4jPzOrdyrHNYma6409oembTRs/7hUmr6jqZ4BtOpWz1LeU9vqaWz2sQMqMKWZ6m1X
eV15PZ9r91/6zrzrudg/9/ADUEsDBAAAAAAIACEIIQJYPN6rSwEAAFgCAAApAAAAcmVzL2RyYXdh
YmxlL2FiY19zdGFyX2hhbGZfYmxhY2tfNDhkcC54bWx1kU1Lw0AQhmfz0SZqSwWFHjzotYSN2aZf
HgTRQ4V4FPUY2miCqQnp0kIP4tE/5M2D/0zftSktRSc8zOw7s5mdXZ0suteIGB1RgxHtUmmIh7Q2
G+yDEyDAObgGr+AdfIBPUKnEUfIUSzLNeTKWMdVqsySa51kh737X9fpqPVwW2vZjkqaXWZoVZFl5
KOOrUIYkxI0nHBEMuDdw+rzbDoQz4MJPO9zvOj7vtYMO76PCC1Dn9bjoLahaDV/GRZaMqdWKpczP
XHc6iqNJOOVlgo+yiRvmz24RTd1VsWGotjj7LBpJHAP2xiw6hr9ljD0AzWBMBwYwAbEGNZE/BN+w
KrwFNOhyQ1e2g/gAn1HepVV6lUNsstOlxv7QtLWG7V8XStO3NNUzgNbc6GmXPbWNnsZ6H9ujClOa
qd5smdeV18u5tv+lb827mov9cw8/UEsDBAAAAAAIACEIIQIaSkWq5gAAANABAAAqAAAAcmVzL2Ry
YXdhYmxlL2FiY19zd2l0Y2hfdGh1bWJfbWF0ZXJpYWwueG1sdVC7TgMxEJw9H5ybQHgUkUIJTYq4
oUB8AxUdFTJ3lhIlx0VnS5TwGdDxSfwRjMEnrBOMNRp7d7zrtYLGhwCCM7wC2EcCY5f4xZSckxfk
LXlHTiY+2ODu65WrN66B1k1vn+zD1qGq7GPTd+sGi8UqhN21MZ621vplSizrrjV2tzG982Ywl+U6
uJaFvNu6OnQ9XkR/936HyJuIQKaY8XxEfhIFVZEF4+dZPGKP+1OuAdFzQz3OPGXyFMmjksacpjWq
+vmOISaHqJ5Vese4VuxxRT35o4dkPfJ6B1m98T01mneYS/75hy9QSwMEAAAAAAgAIQghAsHCKyno
AAAA1AEAACsAAAByZXMvZHJhd2FibGUvYWJjX3RhYl9pbmRpY2F0b3JfbWF0ZXJpYWwueG1sdVA9
T8MwFLwXh8YLVfkYGDqiDh3qhQGxs7GxsSCTWGpF01SxJUb4G0gs/Cf+D5xVW0QRnHU66/l879kK
Gl8CCOb4ADBBAmtX+MUJOScX5D35QE6nPtjgHr3bujq4Blo3vX2xT1uHqrK7pu82DZbLdQj7G2N8
vXat9at0sKq71tj9s+mdN9lclpvgWgYdMrs+9n4TjRn1EyLvIgKZ4SLN9E0UVEUWrF8O6hFH3J9z
ZUTPHfV04CmTp0gelTSeaVqjqsOX5JrconpVaY5xVuxxTT37o4cMegzzjjGRnDe+p0bvze+Sf/7h
B1BLAwQAAAAACAAhCCECOdTLAvEAAAAEAgAAKQAAAHJlcy9kcmF3YWJsZS9hYmNfdGV4dF9jdXJz
b3JfbWF0ZXJpYWwueG1sdZDNSsNAFIXPzb90U/EHBTduK3S24soHcFuwO0MSOsHWCZlAwZXP4d69
b6gndYaEUG/4uOHMnDN3JkSGKAAEN/gGcAJXAjxiqF4/JdfkltyRZ/JCNiRJdFVvdIc43tdlp9mt
zpuKvTBb0yJN87eyNXWJxUJ3XfOglC10tcvt0i0sC7NTefOq2soqv9nHRJGt3/s0a7aU8SEZrnju
SkTW5JN8Ecj8oJ+RH1bEHpOA+v1I7yvh/zk/cXc87HPrGTCH8z2xX4x8qfMFIx8GXyzBnyYTLXSz
TbP8bJcjPTsyWzjkyQyJ+LypL5y8gb+r/PM2v1BLAwQAAAAACAAhCCEC0jX1gSMBAAD0AgAALgAA
AHJlcy9kcmF3YWJsZS9hYmNfdGV4dGZpZWxkX3NlYXJjaF9tYXRlcmlhbC54bWyVUbtOw0AQ3PUD
u4kS8pAoKCioghS3CEFNE74BLvahWMRx5DugoIDfQEJ8DZ9ETZhLzsRyHAFrjfY1t3O+dSmkT4eI
6ZA+iJBZY6Jz2lgHOAJOgAvgEtDAE9BqKS20vL7N43slk59czsVkhjwMk0I8mpja7XVLxDp9QJBQ
EIh5UuRpQsPhVOvFWRSpeCozoUa2MYrzLBKLu6iQKirJnpdqmWG0kjMZ67zAPV44pAP4N2J+B16Z
+cthJu6s6vvAEubB+4CD+nGlbixA3MdXmuHcwHcrnD3LcS3Ht9708H5d4/31E27VnE2NxxQ8u/Zu
9fmlbu8X3b9omJpb45W6vQbd8UpnW9f5h+5V5d/6DRqn8IMGDa5o7JpXP+fW9lvukXfs/RtQSwME
AAAAAAgAIQghAp6Bq6tNAQAAZAIAACAAAAByZXMvZHJhd2FibGUvYWJjX3ZlY3Rvcl90ZXN0Lnht
bHWRz0rDQBDGZ/KnTSwtCgo99KDXkiamtlo8CEEPFeJRxGNoogmmJqRLC558Ac++jgdvPpR+axJa
ik74zex+s5vZ2VXJoFAhYupRj4laVBnGU1qbCfbAERiCC3AN3sA7+ARfoNGIo+QxFqTrqyQUMbXb
yyRa5Vkh7n7nnU49n5YLTfMhSdPLLM0KMow8EPFVIALyvJvhseW6/pk9QUjH9qk1gPPdoTVKBxNr
kkpce2QN4MplJ77cU3r3hZrN4DkssiSkfj8WIj93nMUsjubBwq4S9iybO0H+5BTRwqkXa5o8BVpZ
RjOBU72yQYfo7ZaZ74GiMatAAzog3qUu8gfgG9ZENIACXWzo0nYw3senVfdqVFHmMNa5W2r8h6as
NWz/8KSmbmmypg+tu1HTrGoqGzW19T5uUYOlpsv3K/OqjGrV1/a/1K1+6774n3v4AVBLAwQAAAAA
CAAhCCECvQGgyEkDAACACgAAKgAAAHJlcy9kcmF3YWJsZS9idG5fY2hlY2tib3hfY2hlY2tlZF9t
dHJsLnhtbO1WPW/TUBS9buJ89Stp0xakVjISXaI6sR27tjugljIg0U4IQcMQ3MQ0UZ04StyWgaHK
1F/DzMjCViRGKvEfYGOE+5zn+iNxAIkRR0fvvfPuPfdcx/FLAjJwmQNgYB2+pgDuAr0YgEvwrzQi
j7iDuIcoIXYQTxDPEccIG/EWcYX4PAPwjgV4j/iI+IL4hviBmMU6y4hdxAHiKSKZ7BodE1Kpltk+
aTnAshftptNCYtAwLPOFNzmC+fnztnnRs/vOczdiYcFbPx6lZrOv25a1b1t2HzKZnuG0HhmOAbmc
0ze6A8twUC2wOKIJe1avZcBwf7h/yAllYYsXywJnuVME18CZokiSJquyrrmU6G7JsqqKiqQIkkuM
Z5GZn8nxwRQ3nJ+Ux4+Vc8NC2ZSaVDKUzoVKuvG3iTXukFPJQg/YJcXksVmD1BMFWdYlUVOV0a7k
bmq6ogiqJkrKiJFCYmQkKv5ktBdU44Iibv64zq2TgKUxR9Ko+4Ajlxl3xN9a4gOeQi1yIaGRCB8j
FxxrMLwZ3vy/sf/+xuLT6sYpZQEv8kRrqh68vQoRCe9O4gK9l2VRFvSqIKqKRlwGltM3fY1qWdEU
XdjWNUmWtshqWxCrql7Vlal7voIaiuLVUNjUzbhOpjUS1wd5Vrf08M0bp2qQThvdZt9uN/FFemy/
qTfb5E0K+TxZtLtds1/vmP0TswnF4rHTrTdaZuOU7LkTpFnWnUGh4I518pb2Ulj2pG+f9aBUajlO
b6dSGWBMxxiUac1yw+5UjN5ppW8OKp6PbLbdsLv17pll4VlC5PDEODcbDh4Cl0wGNDyTEsAwzxiG
OULcTzDMJmImyTAJRBLBImqIl4hrBDB597xbQ/zEawHHFcQM8lcBnlwkrogflp6XK3QsIDJYukA5
huYgxzIc1ZvAsT6XxJPyIeFSEc7zsRHwUYzxsUp9rFIuEdD6dH3wgHDJCVw2VPPDHuFyEY74eEX/
F0R9JCI+lqiPpQk+AL7vRn0QztPfDOivxegvU/1lyqV9rXUyXRntwzyNI2OCfs9RfY+P9uX5Kf1B
v4u0zuJf9usgV5nQbzKin6f6+d/0O0fj5mjcbKim32sl5h5Ee/X4jRg++ttgYn5LvwBQSwMEAAAA
AAgAIQghAuB1wDoxAQAAsAIAAEEAAAByZXMvZHJhd2FibGUvYnRuX2NoZWNrYm94X2NoZWNrZWRf
dG9fdW5jaGVja2VkX210cmxfYW5pbWF0aW9uLnhtbI2RT0rDQBSHf69pk4mbplJEoehWCjZb6dql
gjcI02SwocmkpOOfXT2Bez2FF/Ee3qK+0AkOpYW+8MHwG977ZiYeBL47AGGEXwAnsEXAHf4rYE6Z
S+aamTIPjGQ+mC+m29WyVBAiq+WrnBUKYSh1XkqTVxpBIHVWV3mGfn+bquzmRaWmqhFFs+otybVW
dVKq+kllGAzSuUoXyVKaeZuNx3NjltM4XvFeKVcTO3GSVmUsl4u4Vqu4tYRhnlY60c9FAd83kicY
4J0EhnxWD0SfRPTDgCKcc3bGbLg8e98O57dO3lSX10P+yHkXsvuCl48I1k3fPWcXTl9o+zpOX1Ni
iydapzNrAFp79my7s1rH6AiHbx3+HkfkOEYHHFdHOHrW0dvj6DuO3Vneztu3b0wH/skfUEsDBAAA
AAAIACEIIQKNqrdfPwMAAGQKAAAsAAAAcmVzL2RyYXdhYmxlL2J0bl9jaGVja2JveF91bmNoZWNr
ZWRfbXRybC54bWztVctu00AUvW7ivGja9JWC1EoGAYtCHD/ruAvUAgsk6BKVlkVwE9NYdezIcVoW
LKgqpO5Y8wP8A7t+QPkMlkhskLqDO864sd0kLRJLpjqd8Zk75557k3hSkINmAYCBJTjNANwCOhiA
DzAYWUQJcRNxG7GCWEM8R2whdhEu4j3iBPFxAuATC/AZ8QXxFXGG+I74gfiFuIP5eISKSKcdo21C
JtMyrb2WDyx7aDX9FhLdhmGbr8LFNhSLB5Z52HE9fyuImJoKn5/1j+bzby3bfuLarge5XMfwW08N
34BCwfcMp2sbPqpFHrbpgQ270zLg6PzofJOraLzwkPzjbE5UcC3gssEJdJWc7WBFAscGVa4tVblC
a4fb5AKLeixskCCaqiLyoqAouiTWNLW/KwWbNV1VBa0mSmqfkS7lDGwkaouqcVGR4PxlnQsnEUuX
HJFjlZijgLnsqHJhKdqjWIlcTKgvUhkhF2sqHLPH7P/G/vvG4rc1iFN5AYeoSmpN02Pt5RVJVsRV
UdY0klPBIH1VWNVlZfxmpBu8IiqCLguiptaCsMHj+M2YcWQlWZQEUdREnXROECVFUOV+2deIiKmh
b/RZkxSJhkqyimXosq6o8tUBo6obV9yo2kjRMn4p+lP4GQxndyCbNZym51pNfFPuuu/qTYu8KqFU
Ig+W45hevW16e2aTUm7PH1Dl8q7v1Bsts7FP9npOsMQNlg1WOO95bq8DKyst3++sVatd5NtGl6dJ
+Ybbrhqd/apndquhkXzearhO3enZNt4W5LWOd8KB2fDxNY93FZODGs4pYJiXDMNsI+6mGOYeYiLN
MClEGsEidhCvEWcIYErBnbaI+I1jCucFxATyJxGeDBI3j38svRMX6DyLyGHqWcox9AxyLMNRvSEc
O+DSAOuPCZdJcKGP5YiP+RE+ytRHmXKpiNa3sxePCJcewuVjOU83CFdIcMTHG3r3J32kEj7mqI+5
IT4Afq4nfRCO6PvI3Y/oL1L9dEJ/hurPUC470Foiy4X+PhRpXJHG3YjlxA362Sdzhnyy1rAHD67R
g2mae/ove0D0q0N6kNQvUf3SFT2YpHGTkbqqI+pN1hXyyyP45G+DGfFb+gNQSwMEAAAAAAgAIQgh
Aqo9tJ4uAQAAsAIAAEEAAAByZXMvZHJhd2FibGUvYnRuX2NoZWNrYm94X3VuY2hlY2tlZF90b19j
aGVja2VkX210cmxfYW5pbWF0aW9uLnhtbI2RQU7CQBSG/0ehnRoVYojRhOjWkEi3hrVL3XgBHNqJ
NNIZUgZ1hxfwANzCi3gPb6GvYRomBBJe82Umf/PeN50GEPhuAIQefgEcwRUB99hUxJwxV8wNM2Qe
mWfmi1kxzaaWhYIQWSnf5XiqEMdS54W0udGIIqmz0uQZ2u11qrLbN5VaU6LTGZuPUa61KkeFKl9U
5iKzsJuo359YOxsmyTydqELOB27gIDVFImevSanmSS2J4zw1eqQX0ynC0EqeYPmMnyTQ5TUA0YqI
fhhQBxecnTN/XIH73gbnd15eVZP3XX7Iuxdy7wVvnxAtq74Hzi69vtj1Nby+qsSaQNROb9YpaBm4
s23Pqh29Axyhc4Q7HCeeo7fHcX2Ao+UcrR2OY8+xPSvYuvv6jmnPP/kHUEsDBAAAAAAIACEIIQKH
7VpJvwIAAMAGAAAjAAAAcmVzL2RyYXdhYmxlL2J0bl9yYWRpb19vZmZfbXRybC54bWyNk8tu00AU
hs/UjpOmJL2lF1CRDAIhtYnjpkkTVyy4LZAQYoV6YRHcxNRRkzhypu0OskACiRfgQdixYVXxDLwM
/LbH9aWpxESfPPPPOf+ZmcxIlKNfChGjDbIlojskGiP6TFHLggWwDu6BTbAHXoF9cAxG4CP4Br6D
Djy0GaIWeANswMEn8AX8AD/Bb/AHyPLQHFikKLbVO7E5ZTIXvS63IYw7Zt86CDuHVCic96yLkePy
fT+iWAzHL4PU2dkPvX7/udN3XMrlRia3X5jcpLm5MXedUyuYCEeBRz7PXXM47psclWKDQ5pcTi5f
q7qmlysNTVc7aqWmNXe3DWOnrrdqZUyo3kS5ptV2Wrq+2zC2W4EShOv+XJShxgP9mCj2mrM3VUk4
N6KF6MFkzDoRGoRVrhKO4lsxfIe6ZjT1xm6tWRf1IJfrml4z6jvNWgPlPMG4qhaPVyvxQD+oEkVX
rln7k4kcIUX2iSQ1Ye9HXYUfUTZrDruu0+tSqXTMh23X7PacNnfazrA94G6fVlenyW0dl6Pr8PaJ
65yNcDm8vndBcN0CaXPT5ny0V62OO7Y1MMeaqKN1nEHVHJ1WXWtcDWvLsp+bz7u94UnbOeOWS/Pz
0SCwVpRzq8Nx5WjCcvQYb0Mixt4yxg7BA4mxh2BGZkwCMsgABWTBEXgHiC3478/jL9o8vitgBvrX
mO612+iX8MuI97sivt4bzqH8gtCYyIGWYarwm6JlIk1G95mnKSnNW8d7dDZi6yiJdUipdSyKdSwK
bS7hNXnqabdSmuffgnZ3ij9L+a8J/zVxPhzf+7G8VZEnp/LWRd660NCnotCKQpuN1uVv1dPyybN4
Ion/Kl0z1NN7CM/u0X+c3ZJYz5LQpGRtX5NTWui/NeUM0v7Lwn9ZaNkp+/XOpSDiCrF9bd2w3/S+
Qn3jBj19l9kNd/8fUEsDBAAAAAAIACEIIQJUB4SDLQEAAKgCAAAzAAAAcmVzL2RyYXdhYmxlL2J0
bl9yYWRpb19vZmZfdG9fb25fbXRybF9hbmltYXRpb24ueG1sjZHBTsJAFEXvUGgHNhiDqAnRrSGR
bg1r48qlezLSCTTaTjMddInf4M4/8Gf8B/9ELjINDYGE15x0+tr77sttAInvBiAwwC+ADnwJ4B7b
isgpuSI3ZEweSEk+yCdpNnOVaUiZWPWunl812m2Vp5lyqckRRSpPrEkTdLubrk5u3/TUGcvvEuMm
M2sWBYbDuXPFOI7L6Vxnqhx52WhqslgVL7HVZVyN6nRsms8mZuG05dztw6RQbo4wdMrOtOOOQqLH
HQMI8SWE+CEQJ7hgr0/+WAHvIWmwf1frr6vJc4+X8HmEm4j+30senxAt17pH9i5rurbXNWq6Kk/q
gqjyrM3qQywDv9vurMpjcISH9B5yj8d5zWNwwOP6CI+W92jt8TireezOCnayrzIWB/7JClBLAwQA
AAAACAAhCCECL9aPlaYCAAB4BgAAIgAAAHJlcy9kcmF3YWJsZS9idG5fcmFkaW9fb25fbXRybC54
bWyNlMtu2kAUhs/E5hIIlzQhdEElq6qqKMLGcSDgLqpepW4qpYuqSSrVccEJVoBBZpK0Uhesqj5I
d32BPkEWfan22D5g44DUQZ9m5j+XOceMLUEWvqQBGNTgSAK4DzQYwDeIRgYpQ2jfRUzkNXKEfEIG
yFfkO/IOY2trAI+Rp8gx0kM4coP8RH4hv5E/iCyP7KED6XTfcS/6AlKpG7cn+lAoXLvOzZh74kOw
LxZn+zeh4/r6uTsYvOQD7kE2O7ZF/5UtbMjnJ8Ljl05omO3CHLmc8OzRZGAL5zi+OYHp7fT2raJr
el1tabrSVVRDax/um+ZBU+8YdTQovqFuaMZBR9cPW+Z+J1RCdz2wRRFK3DHwiXzvZPZN6kLmVlSI
HhpjqRdcQzd1HnAab8UMMjQ1s623Do12k85Dud7UdMNsHrSNFh7nC+b8tLi/osYdAyc18lbvpA6M
CzEkRekXgpSF9IHX3P0UMhl71PO424NK5bMYWZ7dc7kluMXPz62h8AZQrS7VLR2vR48L68LjV2O8
Hv7avyJ4vUJpb68vxPhJozHp9p2hPdHoJK3Lhw17fNnwnEljdrosB7G5nOeOLix+JRwPSqVoE6ZO
p6+drsBLB1OWhSa+CxIw9p4xdoKsyYxJiIykkDSSQU6RjwiwcvB++fzFUcB5C1lD/UdM90cV19v4
S9H7uUVzEcnisUXSGMWglmIK5VuiSZEm4/KFr8kJza/jDBe1WB33qA4pUUeJ6iiRtr6Qa/rc13IJ
zc/fQe3Bkvwskb9C+Sv0fATOD2Nx2xQnJ+J2KG6HNPz0wQZpG6RlorqCVrdCe/xZPJPov0qeOdOT
Pcx6e/QfvZWpnjLFndE3N9lb8plvUtwmaaklffj95skvH6t3d0UfyXpnem2FnryjbMWd/gdQSwME
AAAAAAgAIQghAtIDkZgtAQAAqAIAADMAAAByZXMvZHJhd2FibGUvYnRuX3JhZGlvX29uX3RvX29m
Zl9tdHJsX2FuaW1hdGlvbi54bWyNkcFOwkAURe9QaAc2GCRGE6JbQyLdGtbGlWu3ZKQTaLSdZjro
Er/BnX/gz/gP/oleZBqaBhJec9Lpa++7L7cBJL5agMAIPwB68CWAO+wqIgNySa7JlNyTkryTD9Ju
5yrTkDKx6k09vWh0uypPM+VSkyOKVJ5Ykybo97ddndy86rkzlt8lxs0W1qwKjMdL54ppHJfzpc5U
OfGyydxksSqeY6vLuBrV69k0X8zMymnLubuHWaHcEmHolF1oxx2FxJA7BhDiUwjxTSBOcM7eGfll
BbyHpMX+ba2/qTbPQ17C5xFuI/p/L3l8RLTe6B7Yu6jpul7XqumqPKkLosqzNusUYh343ZqzKo/R
ER7Se8g9HsOax+iAx9URHh3v0dnjMah5NGcFjeyrjMWBf/IHUEsDBAAAAAAIACEIIQKqfZHt2wMA
AEAWAAAnAAAAcmVzL2RyYXdhYmxlL2ljX2xhdW5jaGVyX2JhY2tncm91bmQueG1sndhNa1NZGAfw
c/Oetol9s402UVtfWmtsmtzkJrGMFmdkxlJx44x0I4Y0eoPtJKSXBkoXIwyFQQZcTEHcdFMQ18J8
gIHZzYCCCxcuBD/AwHyAcf7nnuekpfRsnlv+ufmf5+aeX0raRYIiJhbHhLBEWrSDQlwVdFhCvBUH
RxwZQiaRAnIduY3cRxrIFvIL8gJ5hfyO/Im8Rz4j/8pb4p5JJINkkQVkCVlBXKSL7CC7yD7yBvkD
eYd8Qv5B/kMSASHSyBXkGvIt8gPyEPkV+Q2JRNxG87HriXC421z1XJFIbDYb3Xar4933ezKp+3fq
wnj8UXNt7evWWqsjYrF2zXO/qXk10d+/4XVaTxpqoJu6x/DwnfnsvJufr2wi7lU8bImBASzmq8so
OKlaULVA1VbVplpUtUi1pGqJqqOqQ7WsaplqRdUK1aqq1aro65NVNTnLV7Pzy3jAAlWgKlUyodp+
tXUt+rWoa8mvJV0dvzq6lv2qTAW5UaG3kXxWlV0RbTm1e1Pbn9p6WpTTYm9a9KdFPS3Jaak3LfnT
kp46cur0po4/dfS0LKfl3rTsT8t6WpHTipriFydb79Kq31SNRms/rnZazVUxO+t6XvtaLrdRdxvr
tY05GszVW+u5WvtJrtPYyOmLQyH5ccJncrNR9/ApwvGTFRMzOH9vWdYKEghZVhAJIWEkgkQRYQ2K
FK6LIF9wXMZ5Fglg3Tu0Lo8sno/iJ0R/s7N0lrOYEGFrTa1Zx6wFDtbw8g835VrwyJrcc5n+F+g9
r9CegUN7hg5el/n541df5FoYiakE5TlI7+vovfT7Sh6zR+j4PdJ6Te4xTXtM01rk0HU42XIteuh9
/f3X8g1tSRosI0zLCFlGGJYRgyXFtJwmy2mGJWWwZJiWNFnSDEvGYJliWs6Q5QzDMmWwTDMt58hy
jmGZNliyTMsUWaYYlqzBkmdaLpDlAsOSN1gcpuUSWS4xLI7BssC0zJBlhmFZMFgWmZZhsgwzLIsG
yy2mJU6WOMNyy2BZYlr6yNLHsCwZLHeZln6y9DMsdw2We0zLAFkGGJZ7BssK05IgS4JhWTFYHjAt
SbIkGZYHBkudaTlBlhMMS91gcZmWQbIMMiyuwbLOtAyRZYhhWTdYOkzLKFlGGZaOwdJlWk6S5STD
0jVYtpmWMbKMMSzbBstTpmWcLOMMy1ODZYdpSZElxbDsGCzPmJZTZDnFsDwzWJ4zLRNkmWBYnhss
u0xLhiwZhmXXYHnJtJwly1mG5aXBsse0TJJlkmHZM1j2mZbzZDnPsOwbLK+ZlotkuciwHN0zeOT7
Jv29kmX4Hup/UEsDBAAAAAAIACEIIQJnk0MEwAIAACQGAAAnAAAAcmVzL2RyYXdhYmxlL2ljX2xh
dW5jaGVyX2ZvcmVncm91bmQueG1srVQ9b9NQFL1OnI+2NBSJgaGlRmKqnBc/fzw7DFQiDCAlW1HF
husaEjUlUWK1IgtVJyY2fhoS/wbOzbMbN2phwdHxvTn367xr2VVq0vM6kUG7RCbRI8ovg+gDra4N
0rFngAu8BN4Cx0AKTIGfgKgSBcAhEAPfgR9AvT5MR5+GGdVql6PTbEjb2xej9HI6mWXHy/+tVvH/
jU7c2Pg4Go97k/FkRs3mNM6Gr+Mspq2teTabnKU6UPzTPZpNLjn6Mk3p5GTgSVt5outGiWM7lhK+
3ZbSkq6QcDwhk1C4dtsVynIVGOEXduxFyOFbXzqhLZ2Iu4zbHtJl/6btgq6Pro8GKhCe7QciQoon
IruthEocbu2gpcPTHNG1cPO4u0yYZ85lrsuetDhgIwNDQCkRJmjjsbrIYrF+4XZFaDs6q71Mu5mE
W8heoJvxvB7OEPFBPDeyYEL2I+13ba8r3FwzJPc8hU5+V/gcl8gNlHCWfn7eoa96IavKA6FEZV5Q
WsJi4LPeIOSprC/C9iEpuBEX8R7cRG8Eqlk6PxNEHX1SiQXm+VIvK7RcfSg/4XOiFBHXlvouop4f
aGUB1Pg+qrUAqySmX/IXA+UL9W+V8/+hTSnWo7VhU8VYqyShX/IXZJpxPM2o0Yg/n84mo1Pa3x9m
2fRFpzNPhul5PBd5QCST884y9+DgbxnTs84snXeKdqbJ7xNeyos0yfAaEV0ZTbJh3xmG8R6omIZR
BUygBtSBBvC0Zhhk7NAT5OKzQb9xPYBtLb8Zt/kt2G2gAj4r8XztwH+Mn5l/X1q55ViTqGaMNWfc
wVVWHMp/vWKuusbxzD64Rmnmw3xmpTTTXNVhVOMrc7X8eweuyraan2u9F8/4Brt3x4za3TP22BYz
NvMZm3lefZW3W9Q2bp3r6rClawqO13ijb11Hde15FHs37nlOxj3P9Q9QSwMEAAAAAAgAIQghAuTs
K5TWAQAAnAQAADMAAAByZXMvZHJhd2FibGUtdjIxL25vdGlmaWNhdGlvbl9hY3Rpb25fYmFja2dy
b3VuZC54bWyFkr1vEzEYxl/3PpM0/aBBojRCLF1SKTewRKgTEwNLQ7pz5I7k1OR8unOlbq36Z1Ss
SCw03QoMzIx05K+B5y52allX1dFP5zx+n9f269cinz7bRIy6NGJET0kOzDO6Hw5o03L9BdgHB+AV
OARvwTH4AFJwBi7BAtyCX+A3uAN/wdpaEpHjFNMwi/Ed8xnPyXXzMEpOC7LtWfxJkGUJnmE1TyZT
gdWPXAg+p0YjSYtYvCtDms1qPqwifL/6M4Kp1aqmb5YOzwvTKOfY0vPGPE/jvKBebypE9joIivE0
nodFX4b0x3wehNlJkMdFoGyOU6XDwRIRl/myMIqSdFIeOcmyWazdpeAzODAumE8DfP8QY1eMsS/g
K/gGrsEC3IBb8B38AD8BsS16Bt8O+Iexju9GWTPoA00vxxPMO/gx+U5VnFz38Yp75JwrX0fzba18
bOUjzdfHbuocuzXnEJpejk2Zz9bO4Wv5jsg9L7VGjdbUtKHUWoam7vBc23On5u7s3ldecVWzPc3X
rvFZ2n7H2M+Sdzd9Kl9X0zuPvEGLXKbymT5Vy5eavl1TS1vL917WyNG0kdTcmjjPiFNnMfdUullj
y+gD9d7sgf5Q8Wa/WUZfq/5lD/T7f1BLAwQAAAAACAAhCCECwfK+XPsAAAAUAgAAIAAAAHJlcy9k
cmF3YWJsZS9ub3RpZmljYXRpb25fYmcueG1slVBBTsMwEJyNA8klKIKKVoIX9JBcK86IE39AJl7U
iKSJYiO4wTd4AVd+CBvqUCsSB9Ya2Rp7ZryrkGIRAYRLfAJI4IuADQ6VCy4EBfY8CxpBllmnHd/1
A1vLBmlqBv2s7xtGnvNL7W604eunQbu62yFJ9M4MXW2wXm+d66/K0lZbbrUt/EVRdW2p+8dS/Mrp
cRzXjlvxttxw5boBeCP5t+R/gOidiDJFBMqxEu5M8CWlZI8FkfCbgB/rWM4LWeT7+3nn71PpnnBC
o+5WuPNAd+R1UaDDQXc67vF+fL9eD0helf/b3GvKWP4jY+LCDA4y5l5qNpepf/pjXt9QSwMEAAAA
AAgAIQghAkugLrP7AAAAFAIAACQAAAByZXMvZHJhd2FibGUvbm90aWZpY2F0aW9uX2JnX2xvdy54
bWyVUEFOwzAQnE0CySUogoKQ2hf0EF8rzogTf0AmXqkRSRPFRnCDb/ACrvwQNtShViQOXWtka+yZ
8W6MDIsIIKzwBSCFLwI2OFQhWApK7HkWNII8t047fugHtpYNsswM+kU/Noyi4Nfa3WnDt8+DdnW3
Q5rqnRm62mC93jrX3yhlqy232pb+oqy6Vun+SYmfmh4nSe24FW/LDVeuG4B3kn9L/ieIPogoj4lA
Ba6FuxB8S8WyJ4JI+E3Aj3Uq54Us8v39vvP3mXRPOKNRdy/cZaA78boo0OGgOx/3ZD++Py+D9C32
f5t7TRlXR2RMXJhRBRlzr3g2l6l/+mdeP1BLAwQAAAAACAAhCCECKmgfMrkAAAB0AQAALQAAAHJl
cy9kcmF3YWJsZS9ub3RpZmljYXRpb25faWNvbl9iYWNrZ3JvdW5kLnhtbHWPQQ6CMBBF/1gRliRq
YownYEE3LoxbFy49A0ESjGAJZa8H8ATuPad+TAnE6DQv05npb38VAjQCCFa4A5jABXtr9BGQkCzJ
nhyI59k8qTLm1BSmhu8nl2NtTkdEUd401VZrm+ZZmdjYDeLUlDqpzrrOrO4O99dYU7DGTYLPWw8R
eRJIiAXrKXkxRsyKjNjfDPptjLmfcYnzrVxuZ/xDKAPdfKDzfuik18kO3lU5H9869eWv8yF/fL8B
UEsDBAAAAAAIACEIIQKbfkdArAAAADABAAAlAAAAcmVzL2RyYXdhYmxlL25vdGlmaWNhdGlvbl90
aWxlX2JnLnhtbHWPwQ6CMBBEZylCj5gYo9GjJw6Us9+gH1GBRIIIodz14H/rECEaE6d52e1s2+0q
aKQCCLZ4AJhhFL0UHwVkTjZkR5RyXQat+/JSHJu8QBjaa941ZY4gOJV9bVvE8bnv270xLjsXtXXJ
eCLJmtrYtjJd4cx0i7qLRsS4FsoTgURYcb8kT8pj9IlH//DlD1LMF1ze+F9/jENNc5oK4c1/jzV5
0ZCrnx7TW/Kn9wtQSwMEAAAAAAgAIQghAqTfIofgAAAA5AEAACMAAAByZXMvZHJhd2FibGUvdG9v
bHRpcF9mcmFtZV9kYXJrLnhtbHWQzWrCQBSFzzXmZxkwBQvuuhPqbKX0SQpdjEkgUnXCjF3rc7gv
5MH6HnpCJyYEe4ePO3OSc5g7ARL8CiBYoAF48kXtHX21ekqeyQt5JR9kQ8LQVbou2XOzMxZRZHWx
/XaIY30orNkW3OXGHkrrsFxWx2P9ppTLq3Kv3cr/ssrNXun6S9nSqc7WJzuz4xk4S4KM/SIiP6Qh
kBRzajNyZQXtnciE+nqgtxVxn3GJnyv0vf2W/I1492UDX/zAJ71PPhGeAn+Psa/Lexro0wd5k0Fe
jeieN/YFo3m7ueSfd7gBUEsDBAAAAAAIACEIIQJojcSg4AAAAOQBAAAkAAAAcmVzL2RyYXdhYmxl
L3Rvb2x0aXBfZnJhbWVfbGlnaHQueG1sdZDNasJAFIXPNeZnGTAFC+66E+pspfRJuiiMSSBSdcKM
XetzuC/kwfoeekInJgR7h487c5JzmDsBEvwKIFigAXjyRe0dfbV6Sp7JC3klH2RDwtBVui7Zc7Mz
FlFkdbH9dohjfSis2Rbc5cYeSuuwXFbHY/2mlMurcq/dyv+yys1e6fpL2dKpztYnO7PjGThLgoz9
IiI/pCGQFHNqM3JlBe2dyIT6eqC3FXGfcYmfK/S9/Zb8jXj3ZQNf/MAnvU8+EZ4Cf4+xr8t7GujT
B3mTQV6N6J439gWjebu55J93uAFQSwMEAAAAAAgAIQghAnpffui5AAAAdAEAADkAAAByZXMvZHJh
d2FibGUtd2F0Y2gtdjIwL2FiY19kaWFsb2dfbWF0ZXJpYWxfYmFja2dyb3VuZC54bWx1j00KwjAQ
hd8YawNuVFyIeIIuzMaFeAGXniHUQsWflKYH8ACewL3n1FdNrYhO+JjMTF7yoqBRCSCY4QKghxDs
LdCGJgMyJWuyIVHkc1tkzKk7uBJxbE/b0u22SJK8qoqVMT7Ns6P18zCYp+5obLE3ZeZNc7i9xrsD
a5xFP9+6isiNQAaYsB6SO6PDrEiH/eVHv44u92MuCb5VyPVMv77w1o0+dNEPnbQ66aMnKvj41qkv
f40P+eP7AVBLAwQAAAAAAAAhCCECBBK/vQ4BAAAOAQAAJwAAAHJlcy9kcmF3YWJsZS1sZHBpLXY0
L2ljX2NhbGxfYW5zd2VyLnBuZ4lQTkcNChoKAAAADUlIRFIAAAASAAAAEggEAAAA/MdG3AAAANVJ
REFUKM+N0i1OA1EQAOBvIYgqDDTBgKyooIZU9QANJ8CQlNSR4FCQIEgFBoMpKDymAoXjBFDHj0GR
wAkI2WUQbBC0j+08NcmXmXmTYYbIUNe3gMKVxxTsi/Ldpat1hTb2falPA3MYo41bmU4KvXqyiS1E
uuGx3KVw+t8f13xWEbhQWK9CS96N1apYV2Fk/nfJPdtWJ1lPYaSGzLBc74PmX7Yjd69lKAw07QqH
k9U6XoRwXubhaNpsi858yN3Ys5FCsOLEcznVwc+ppKKhYdm1t1luzjcHIjxCPGTXHAAAAABJRU5E
rkJgglBLAwQAAAAAAAAhCCECBBK/vQ4BAAAOAQAAKwABAHJlcy9kcmF3YWJsZS1sZHBpLXY0L2lj
X2NhbGxfYW5zd2VyX2xvdy5wbmcAiVBORw0KGgoAAAANSUhEUgAAABIAAAASCAQAAAD8x0bcAAAA
1UlEQVQoz43SLU4DURAA4G8hiCoMNMGArKighlT1AA0nwJCU1JHgUJAgSAUGgykoPKYCheMEUMeP
QZHACQjZZRBsELSP7Tw1yZeZeZNhhshQ17eAwpXHFOyL8t2lq3WFNvZ9qU8DcxijjVuZTgq9erKJ
LUS64bHcpXD63x/XfFYRuFBYr0JL3o3VqlhXYWT+d8k921YnWU9hpIbMsFzvg+ZftiN3r2UoDDTt
CoeT1TpehHBe5uFo2myLznzI3dizkUKw4sRzOdXBz6mkoqFh2bW3WW7ONwciPEI8ZNccAAAAAElF
TkSuQmCCUEsDBAAAAAAAACEIIQJ6zKEcxwAAAMcAAAAtAAMAcmVzL2RyYXdhYmxlLWxkcGktdjQv
aWNfY2FsbF9hbnN3ZXJfdmlkZW8ucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAABIAAAASCAQAAAD8
x0bcAAAAjklEQVQoz9XRsQnCYBCG4Uf5iziBEBsbe8kCtindwGwijuAGCqJlVnAPGxuLTGAVtIqB
kPCn9a767l7uPu7405iAmb15T7dy8G5E7jOQOZIAAk7OnTk7hSBRhl/p6d6BNkiU8hDxfJQyjUAp
ccgY6KaOQ1eFujW+tewAa3BpZDZ4zKx9CyuLnmUvj9EP/gIBNSlMnXkCCwAAAABJRU5ErkJgglBL
AwQAAAAAAAAhCCECesyhHMcAAADHAAAAMQACAHJlcy9kcmF3YWJsZS1sZHBpLXY0L2ljX2NhbGxf
YW5zd2VyX3ZpZGVvX2xvdy5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAASAAAAEggEAAAA/MdG3AAA
AI5JREFUKM/V0bEJwmAQhuFH+Ys4gRAbG3vJArYp3cBsIo7gBgqiZVZwDxsbi0xgFbSKgZDwp/Wu
+u5e7j7u+NOYgJm9eU+3cvBuRO4zkDmSAAJOzp05O4UgUYZf6enegTZIlPIQ8XyUMo1AKXHIGOim
jkNXhbo1vrXsAGtwaWQ2eMysfQsri55lL4/RD/4CATUpTJ15AgsAAAAASUVORK5CYIJQSwMEAAAA
AAAAIQghAtpEdZ3JAAAAyQAAACgAAwByZXMvZHJhd2FibGUtbGRwaS12NC9pY19jYWxsX2RlY2xp
bmUucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAABIAAAASCAQAAAD8x0bcAAAAkElEQVQoz93PoQ5B
YRgG4EcWBLPZBJukcAGS7dQTFEFR3JBOEEwzRXMhkhkbgSbwz9kcycHcgTd9e/d84eWfk8uuqq5I
XdnDydrK3P6T1swkUhMDkcjAWCoxVXuRvourhVQ7e2tJLd1c9CEvCJo6P6inIQjyEAs27s4qGSo5
SGwF8auKHY0UvyYVDO3e5H/zBBVJKctOJju9AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLaRHWd
yQAAAMkAAAAsAAEAcmVzL2RyYXdhYmxlLWxkcGktdjQvaWNfY2FsbF9kZWNsaW5lX2xvdy5wbmcA
iVBORw0KGgoAAAANSUhEUgAAABIAAAASCAQAAAD8x0bcAAAAkElEQVQoz93PoQ5BYRgG4EcWBLPZ
BJukcAGS7dQTFEFR3JBOEEwzRXMhkhkbgSbwz9kcycHcgTd9e/d84eWfk8uuqq5IXdnDydrK3P6T
1swkUhMDkcjAWCoxVXuRvourhVQ7e2tJLd1c9CEvCJo6P6inIQjyEAs27s4qGSo5SGwF8auKHY0U
vyYVDO3e5H/zBBVJKctOJju9AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQL/zLuVCwEAAAsBAAA3
AAIAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX2FiX3NoYXJlX3BhY2tfbXRybF9hbHBoYS45LnBu
ZwAAiVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAQAAAC1+jfqAAAAGG5wT2wAAAAAAAAAAAAAAAAA
AAAAAAAAABgAAACTtWHlAAAAdG5wVGMABAIPIAAAADAAAAAAAAAAAAAAAAAAAAAAAAAAOAAAAAAA
AAQAAAAFAAAACwAAAAwAAAAHAAAACAAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAAAAAABAAAA
AAAAAAEAAAABAAAAAQAAAAEAAAABAAAAAcL2BVkAAAAuSURBVCjPY2RQZ/jIgBvwszB8ZHiBRwED
EwMBMAAK+AaBGz4NxoBiYeDHK88PAM41BEJYuS4lAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQK4
2Vxq1gAAANYAAAA1AAIAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX2J0bl9jaGVja190b19vbl9t
dHJsXzAwMC5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAAgAAAAIAgEAAAA2XOyfwAAAJ1JREFUeAHt
1DGuAjEQBNFnJyCBtPYF4FCcn5QYeQ7Az9GwDhz+rQ4tlSZwt4SDMsmEqkz01YSzZpOnOduh4uEl
DJFkCC8P8isKTp4+hshj+Hg6oeSC5m24uWjJ+Rc3w1v7LdgMYUPJ34Vh2xOE0FGVr1R0IeaC9vOC
dgj+kWD+kZa/8qRMd1dd+0p3dc/LtF7n9UFZn7T1UV2Y9YM/h1t994BkuwEAAAAASUVORK5CYIJQ
SwMEAAAAAAAAIQghAooD6BhBAQAAQQEAADUAAwByZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfYnRu
X2NoZWNrX3RvX29uX210cmxfMDE1LnBuZwAAAIlQTkcNChoKAAAADUlIRFIAAAAgAAAAIAgEAAAA
2XOyfwAAAQhJREFUeF7tlDGOwjAQRV9CAdI2CVfjLrAtnAVR7mHoaalI3CJiezYaIZRETmzJLfMr
K/7P35FnCNS3iogiVVJE8CWR2rClntGWzfLpsOOOoaENqMFwZwfhFAWw5obgkLD0y401UIQBNQ/d
5gOyCB1CQz0PqGgR/MzZV54KqJYShAEvhAuwTwM43NTOmRVwiAMMglXI2F4CJ1231LEET66KGNuP
75VZ/okNwh646PZPeLV3Cm3jgAOw4oxM7B6fdgXhBMBfLwZ2SQGY902PwE+voV1SEzg6RTC2pwM8
XhG/vT72KSD+lJ2CHIJMAFVaMzksdtxYinsMEuS3c/5AyR9p+UM1f6x/6x/s5xtZSQPd4wAAAABJ
RU5ErkJgglBLAwQAAAAAAAAhCCEC85p0/kQBAABEAQAANQAAAHJlcy9kcmF3YWJsZS1tZHBpLXY0
L2FiY19idG5fcmFkaW9fdG9fb25fbXRybF8wMDAucG5niVBORw0KGgoAAAANSUhEUgAAACAAAAAg
CAQAAADZc7J/AAABC0lEQVR4Xt2VMU7DQBBF33pXVMRVuEWUW3CHFG5RfJ7kECm4R6RcAClUHMES
kukYvqxpkFfIMFSZ34z+/P3esXfH3Hokx5+WFjIeZMrvbLLLC61Q3DKzJFx4T8czVwbhqqwT48ZL
lu94w/jE+BCmTMxuiUUCjphw4YkND8JG2WXijvCzQQMcMN7pZ7VerHFwVTUy0GGMPAJFaEhCM+WI
HTE6V1Y3v+IVowfuSN+rYqDHpFjVGyn+/DOJZi5w9ux7KPUGThj7etnZPSYV5FoDmReMbf01ObvF
pMpAmhu0DIys6x06u2ZkoP0Xg3ALwZcY/ozhgxQ8ysHLFLzO4YESHGmhoRoc65Efy23HF4RTcaFS
DvxpAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLUJNgcZAEAAGQBAAA1AAEAcmVzL2RyYXdhYmxl
LW1kcGktdjQvYWJjX2J0bl9yYWRpb190b19vbl9tdHJsXzAxNS5wbmcAiVBORw0KGgoAAAANSUhE
UgAAACAAAAAgCAQAAADZc7J/AAABK0lEQVR4AdyRtVkEcRTEZw13aAKrggpwTdBeLoUe0BaI8AqQ
jS5dEtzlz+9jMhxC3nzvbmxd/30i42+HpkpMJVj6u9MkritVA0h9StwfjYt1mtCacp2CHDaB4xP/
6PARlRX0zF4DszLuD05BrAUFsKcpdagNdMD2hEeir08Qs/MUzzX7LpvFDaRufTgJO0HpSj2wjI3U
CCIr3CvSCTc/vvl65VTmYFVsnzZ1DDZhduZIc1ofPkjq61M3L8GfWP+W7JL6HtKPH2CJ2E8/AHsA
z4B/BRyGNNCi/cEDYB4Qd8Okddgja8BwGNJAK4FF70/QoFNdqQ3WqMJf/xVmBa5Ir2g1vIyqBlDu
BcoDkfJopDwhUZ6UKc9MlGdnygsUyos0woUq3Yp1zIpleAMASAi/IXAdpO4AAAAASUVORK5CYIJQ
SwMEAAAAAAAAIQghAjWrN4byAgAA8gIAADoAAAByZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfYnRu
X3N3aXRjaF90b19vbl9tdHJsXzAwMDAxLjkucG5niVBORw0KGgoAAAANSUhEUgAAABsAAAAbCAQA
AAAn3TzeAAAAGG5wT2wEAAAABAAAAAQAAAAEAAAAQYJaQf8AAAAa+XlaAAAAEG5wTGIEAAAABAAA
AAQAAAAEAAAAnFWhNwAAAGRucFRjAAQECSAAAAAwAAAAAAAABAAAAAQAAAAEAAAABEAAAAAAAAAA
AAAAAgAAABkAAAAbAAAAAAAAAAIAAAAZAAAAGwAAAAAAAAABAAAAAAAAAAEAAAABAAAAAQAAAAAA
AAABAAAAANbnse4AAAIJSURBVDjLnVS/S1thFD33e6mmiSJCioOlAYtLxUkacOti9g4OxX/DPyHg
n5DFxamgg4OLm9VVKUKgi4haCy46iE3id78fp8PLw6gvGnrf8OC+c+553z33fsB/heQlKTC9L0QU
DlGHCZPXMkDhKUQC8LNa/fzmo4zxrzu9OJSLLJ+vI0yAy1pn27aV2WPbne3LGsCEkk8ykNuGBqVG
9erUqVOvUanhtgGhySHSQNobjurVaXxQ06hOvWN7A0LzrBHAXUOp+ojyQFXlXSPF9SvhZtF6Dbmk
lBisv1lMsYDJ3CuumgTM9xGAgCYprmZOG4Ai4XCmsMSsSH4YorB0OCOBkgINUKnJOMJArVQvyHil
luJ79YuzArw2RBQUZ3vSvdfYcCOc4Xq0+/vhaBnOACBwfUa8eDIAEOL6LMX3aAfHoSPJi6ejJKFz
cIyHHtBg9GrX0/oBZlNpvefVLkb77SbsfjNQZKAeRQL3m7CPEJsJSq1mpHX5M2ldZKuJ0ubThZ0b
wfTJDqne+scbYL168mQH03MjOX+xUEL1aN3FSEcbrLfeehscI108Wkd1oTRgUetlTK2tnO91u56R
kZGe3e753toKpurlftIT/vLbrRFMfPv0df79h9GS7fz5vd36/gu3y7rVfdHTzaRexgQmUcE7VDCJ
iXr5WSMG3ZM/klYCAPPhSxjqnhwu/gHbEY7BZUSSVAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC
fCd7LDkDAAA5AwAAOgACAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19idG5fc3dpdGNoX3RvX29u
X210cmxfMDAwMTIuOS5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAAbAAAAGwgEAAAAJ9083gAAABhu
cE9sBAAAAAQAAAAEAAAABAAAAEGCWkH/AAAAGvl5WgAAABBucExiBAAAAAQAAAAEAAAABAAAAJxV
oTcAAABkbnBUYwAEBAkgAAAAMAAAAAAAAAQAAAAEAAAABAAAAARAAAAAAAAAAAAAAAIAAAAZAAAA
GwAAAAAAAAACAAAAGQAAABsAAAAAAAAAAQAAAAAAAAABAAAAAQAAAAEAAAAAAAAAAQAAAADW57Hu
AAACUElEQVQ4y52TzUsbURTFz3uTSbSmShRJKBZiK2IhOwXbRcFt/4C4dJldF+3SVdB/QovoPhXE
hXbl1pVZuRAqVkSoFEzVJCR5933cLiaaD8cYOm8zXM5vzsy5Z4D/ukTYkAVkUQLArIMT/FgR6R4U
vBspNCzs/WTdT7hF2wNj8S2SNcIWJudm429l3FWrZ0fFxXMW637OhLkCyMt8FDiaL2+riub7oyrl
7aN5IB/Ny1Ao58O7XiWjmZgsadKkyRJrJnO9Ci/nPwZFzoe829JMhjQ54ofjSJPRfLcFmfO7IsxH
gdKKZqIOpIWS5tJKoGtLDzh9r4hcKBSATtHph0ALSAC4kUDyq/ThwvcIQMBJP/kl0AaxS6Aw1bgl
ftIr8OPGbWEq0MugKZk5b6SHV9PPG8nMBfom9mIKgHumiK6pa2IAxLDoq8BiOLhrYrX6U7XurH2t
3sIYuLrgPjDG1UWglwAcvL1jXRUS3ANiIXV17xjeQwbZKBKX+5aVeXoByli+3Efic+zh27IWtLNp
bQ8/FtLanU3QR9M2XYgjVVxzrHR4J5V2XFxDaiHe+TQvNY6Zk11mMsp0/gHKkGE+2cVMahxe11uk
B0YnkDncIOtYs7LKKKOMspodkz3cQGZ0Ij0QEm9yKJXG9PLS2UG9ZtmxY8eW67Wzg+UlTKfSyaHW
itp3JV4NYqwUU7FPb7LvJl/HBlX9/PL7yY9fMTWmUPpdbwUmunrgTw/fvfwTATf74yCSZqTyswzd
nvLjZkj4iYHRWCRipeeM+atuGtDP1ry/6x80D7wnWADfCwAAAABJRU5ErkJgglBLAwQAAAAAAAAh
CCEC+o5VT9gAAADYAAAAPAABAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19jYWJfYmFja2dyb3Vu
ZF90b3BfbXRybF9hbHBoYS45LnBuZwCJUE5HDQoaCgAAAA1JSERSAAAAGAAAABgIBAAAAEp+9XMA
AAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAANgdGGQAAABUbnBUYwACAgkgAAAAKAAAAAAA
AAAAAAAAAAAAAAAAAAAwAAAAAAAADAAAAA4AAAATAAAAFQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAEAAAABAAAAAavzs8EAAAAbSURBVDjLY2AYBaNgFIwCUgAjw3/SNDCRagMAZPwBA5ESvRoA
AAAASUVORK5CYIJQSwMEAAAAAAAAIQghAvmeOQutAAAArQAAADwAAgByZXMvZHJhd2FibGUtbWRw
aS12NC9hYmNfaWNfY29tbWl0X3NlYXJjaF9hcGlfbXRybF9hbHBoYS5wbmcAAIlQTkcNChoKAAAA
DUlIRFIAAAAgAAAAIAgEAAAA2XOyfwAAAHRJREFUeAHt0acBAkAMheHHaTSOOe4kA6BY7GZgDDoM
wQB0mOLHUOMSQ/2i0/XO/v7oY8iHGXCkS+ca/gIn1gxpKYYZCzJ7hjSjBWYS2T2FKZDMFN4Ckpki
VCBROLinoFJ1Q4l/xE4RR2FJT3Ek2jT0pv7+zrmeb0WqoRowAAAAAElFTkSuQmCCUEsDBAAAAAAA
ACEIIQIkI2Q1pwAAAKcAAAA2AAMAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX2xpc3RfZGl2aWRl
cl9tdHJsX2FscGhhLjkucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAAAEAAAABCAAAAAA6fptVAAAA
GG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAANG5wVGMAAgIBIAAAACgAAAAAAAAA
AAAAAAAAAAAAAAAAMAAAAAAAAAAAAAABAAAAAAAAAAH/////vFZcuAAAAApJREFUCNdj+A8AAQEB
ABu27lYAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAgOdq7HeAAAA3gAAADAAAwByZXMvZHJhd2Fi
bGUtbWRwaS12NC9hYmNfbGlzdF9mb2N1c2VkX2hvbG8uOS5wbmcAAACJUE5HDQoaCgAAAA1JSERS
AAAABgAAAAYIBgAAAODM70gAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAAmQAAAMZQsLsAAABU
bnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAgAAAAQAAAACAAAABJkzteWZ
M7XlmTO15ZkzteVOM7XlmTO15ZkzteWZM7XlmTO15f8/tz4AAAAhSURBVAjXYzTe+nQmAxbAxIAD
IEtshWL8OliQ2N5E2QEA6l8EKXZojMYAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApV4w3jTAAAA
0wAAADQAAAByZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfbGlzdF9sb25ncHJlc3NlZF9ob2xvLjku
cG5niVBORw0KGgoAAAANSUhEUgAAAAYAAAAGCAYAAADgzO9IAAAAGG5wT2wAAAAAAAAAAAAAAAAA
AAAAAAAAAMwAAAA6g08rAAAAVG5wVGMAAgIJIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAA
AAIAAAAEAAAAAgAAAATMAJnMzACZzMwAmczMAJnMzACZzMwAmczMAJnMzACZzMwAmczxjbTZAAAA
FklEQVQI12NkmHnmDAMWwMSAA9BDAgBGGQI9i6hzZgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC
+DLGDs8AAADPAAAANQACAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19saXN0X3ByZXNzZWRfaG9s
b19kYXJrLjkucG5nAACJUE5HDQoaCgAAAA1JSERSAAAABgAAAAYIBAAAAErFJ8MAAAAYbnBPbAAA
AAAAAAAAAAAAAAAAAAAAAAAAQAAAAJ0MRqgAAABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAA
AAAAAAAwAAAAAAAAAgAAAAQAAAACAAAABEDMzMxAzMzMQMzMzEDMzMxAzMzMQMzMzEDMzMxAzMzM
QMzMzI5INrcAAAASSURBVAjXYzzjwAAHTAwMlHEAUn4BGA/BTi4AAAAASUVORK5CYIJQSwMEAAAA
AAAAIQghAqjIGXLPAAAAzwAAADYAAQByZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfbGlzdF9wcmVz
c2VkX2hvbG9fbGlnaHQuOS5wbmcAiVBORw0KGgoAAAANSUhEUgAAAAYAAAAGCAQAAABKxSfDAAAA
GG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAADMAAADkhknaAAAAVG5wVGMAAgIJIAAAACgAAAAAAAAA
AAAAAAAAAAAAAAAAMAAAAAAAAAIAAAAEAAAAAgAAAAQzmZmZM5mZmTOZmZkzmZmZM5mZmTOZmZkz
mZmZM5mZmTOZmZnptpxzAAAAEklEQVQI12OcacwAB0wMDJRxAD9LANhr7vfdAAAAAElFTkSuQmCC
UEsDBAAAAAAAACEIIQIWAMm62QAAANkAAAA/AAAAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX2xp
c3Rfc2VsZWN0b3JfZGlzYWJsZWRfaG9sb19kYXJrLjkucG5niVBORw0KGgoAAAANSUhEUgAAAA0A
AAApCAQAAABE32vXAAAAGG5wT2wAAAAAAAAAAAEAAAAAAAAAAAAAAIAAAABFKTk/AAAAVG5wVGMA
AgIJIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAcAAAAIAAAAEwAAABSAAAAAgAAAAAAA
AAGAAAAAgAAAAAAAAAGAAAAAgAAAAAAAAAF1XRQ2AAAAHElEQVQ4y2NkaGDADv4xMeAEo1KjUqNS
o1JYAQAPFQHQHk6ohAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECW3fY7NkAAADZAAAAQAABAHJl
cy9kcmF3YWJsZS1tZHBpLXY0L2FiY19saXN0X3NlbGVjdG9yX2Rpc2FibGVkX2hvbG9fbGlnaHQu
OS5wbmcAiVBORw0KGgoAAAANSUhEUgAAAA0AAAApCAQAAABE32vXAAAAGG5wT2wAAAAAAAAAAAEA
AAAAAAAAAAAAAB8AAACgCsjNAAAAVG5wVGMAAgIJIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAMAAA
AAAAAAcAAAAIAAAAEwAAABQfAAAAHwAAAAAAAAEfAAAAHwAAAAAAAAEfAAAAHwAAAAAAAAG9VHEv
AAAAHElEQVQ4y2NkkGfADv4zMeAEo1KjUqNSo1JYAQBwfwFwhFzZKQAAAABJRU5ErkJgglBLAwQA
AAAAAAAhCCECr9/+xR0CAAAdAgAAOwACAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19tZW51X2hh
cmRrZXlfcGFuZWxfbXRybF9tdWx0LjkucG5nAACJUE5HDQoaCgAAAA1JSERSAAAAQAAAABgIBAAA
AOC9M88AAAAYbnBPbAgAAAAIAAAACAAAAAAAAABBglpA/wAAAOuAJ1cAAAAQbnBMYggAAAAIAAAA
CAAAAAAAAADmsL1mAAAAVG5wVGMAAgIJIAAAACgAAAAAAAAIAAAACAAAAAgAAAAAMAAAAAAAAAoA
AAA2AAAACgAAABYAAAABAAAAAQAAAAEAAAAB//7+/gAAAAEAAAAB//7+/gAAAAE9FxstAAABRElE
QVRIx+2WTW7DIBBGH2P8lyzSTa7Ro7VnrXKRbqoqioEuGMCx1KoLT7rpIAE2lr7ngZkB/u2Pzf3i
zb6WvpNztXer+b6yibSab2SzsOB0LDD7iCcgkkgkHXXF188Eh9Ah2jttewAU4UDUPhHzote/FBX2
2jLIfgBZeGFhwRGIQMRlTzgEz8iRE+fLa/yMyah9vL1w5sSREY/gyj7nf+8ZGeOFk2EMvMszV67c
WPJWeKgIPQOzqTw8MeuGxHwKGoCnZ+JgnnkORAKBkM+X1PDrGBiZzQFmRoYaZ0jNAB2egckcYGLA
05UIax4QRbC24T7IpSbiEgnW1iuAK/mPjQ+sbZPkmgfKUbS2luZZAzQI+wvAnYr8XK3t7wOyKRmP
AGjleAXQKpa15ZJcEWRVsSOBmznATe8DiiArxwSWhwBoHcyPX2qixHHKVdg5AAAAAElFTkSuQmCC
UEsDBAAAAAAAACEIIQL45KvQCAMAAAgDAAA5AAAAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX3Bv
cHVwX2JhY2tncm91bmRfbXRybF9tdWx0LjkucG5niVBORw0KGgoAAAANSUhEUgAAAEAAAAAgCAQA
AAAIlLYPAAAAGG5wT2wIAAAACAAAAAgAAAAIAAAAQYJaQP8AAADtjFGpAAAAEG5wTGIIAAAACAAA
AAkAAAAJAAAAVxLycgAAAFRucFRjAAICCSAAAAAoAAAAAAAACAAAAAkAAAAIAAAACTAAAAAAAAAK
AAAANgAAAAoAAAAWAAAAAQAAAAEAAAABAAAAAf////8AAAABAAAAAQAAAAEAAAABKOEN8gAAAi9J
REFUWMPFl82S1CAUhT8ImdiV0hkX8wi+qT6M7vVl3FpurdFJd4AALrghdJeuBOemOl1ZncM59w94
4VDphQnol1bAXMmhbvVphJL+/l0sEHCFEmDV+Kip/FJNQqUaXKPk0RWVNtCJSJInHiRMlQ2KAY2W
t25MIBKJBCJRvvccUAoE0jBgMBghoRoRSAK+sbERgAhEVDZEoTFMzDzw+P19XFOniOu3DzzywMyE
yRor8X7AMDIxha966ld00Q7vsFg8G4FIMiX9DHdMnHrCg544VaZIH1CiwcjE3L3zzJINOcOSviFw
6k7gxMTIsKe4LhYMYkLvmLiTKlPHLMgEsgb9CYwMtwTqSugdY33+QwFVVOgdQ/Ff7Q1YVST+BwFV
Y+qrGaiaz8A/rEAVWrEglQndf0FK1YQAdDWf496dukZG2TGTrvgkIqE7gVD2Aq4tSHlcOtcT3TkZ
yOmwYJc/EPDYz5+c7wXv/ZePWDxBdMgrmcpN+BUzr7nnLfe8YZaerZu47rFcWPjJEz944hcLK46N
YMpwDHgsKwuahGNlbEjAc+HCMwuraJAzQXbCfWGynNEkPCtLmVn/Wnb5cI4LFxbOWFlGyj6QFdhw
0hw2Vs6MGHQjBSIbHotl5YzFsV0rkESBXbBVRoZqRCBXmMdjcUWBdNyMchHu/14GpmpgwH68JFW2
4atCrK5mES0UAgOuLOWt1vJ9MQ/yLveC42Z03IcyuD4GRgMC2Ygozov/JPgNYNB44wiwabQAAAAA
SUVORK5CYIJQSwMEAAAAAAAAIQghAuPowlKfAAAAnwAAADwAAgByZXMvZHJhd2FibGUtbWRwaS12
NC9hYmNfc2NydWJiZXJfY29udHJvbF9vZmZfbXRybF9hbHBoYS5wbmcAAIlQTkcNChoKAAAADUlI
RFIAAAAMAAAAIAgEAAAAjBJRIQAAAGZJREFUeAHl0LENxSAMhGEmoKJNl6UYgFFpqJiGiuh7xVMi
pfAE+UufdWdf+jaKpluWrin3+DRsN9tw/reHy1RlWTVdhpI023Q8todpa0lHfSVW9GQhv4SMFQux
VRgenRs+GFfyVX5XSaINzoAAmgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECdFf5LZEAAACRAAAA
QQACAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19zY3J1YmJlcl9jb250cm9sX3RvX3ByZXNzZWRf
bXRybF8wMDAucG5nAACJUE5HDQoaCgAAAA1JSERSAAAADAAAAAwIBAAAAPx8lGwAAABYSURBVHgB
ddAHEQUxCAbhDyVYiMaLrZwOpLzee52dvsAPQEiTsrRUJikgNMPa4cbarAnSsHd4YW9I+rP6patT
Dj8olj/F8q/4O+p/+P91QzP/OPDrJV0KjmX2ca08DG3rAAAAAElFTkSuQmCCUEsDBAAAAAAAACEI
IQJfolmnxQAAAMUAAABBAAAAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX3NjcnViYmVyX2NvbnRy
b2xfdG9fcHJlc3NlZF9tdHJsXzAwNS5wbmeJUE5HDQoaCgAAAA1JSERSAAAAEgAAABIIBAAAAPzH
RtwAAACMSURBVHhejdKxrYQwFETRI7kF3I23CBowRWK6gRAagIgA/2iFVl/IvJte6UkzA0AnG61O
p9Uo6/xckEx29cZukoRb6c0u9ReXRS8Ayaw+MEvQKa5H6VJEskN9xiEzqg0KW1PaOJvS+Up6+a40
pfIygtgO82UtBL2lVTDB599UDpPPrQDRoHxHpxhEgD/hvv67cTdGtgAAAABJRU5ErkJgglBLAwQA
AAAAAAAhCCECKj7y2MsAAADLAAAAOgADAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19zY3J1YmJl
cl9wcmltYXJ5X210cmxfYWxwaGEuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAACgAAAAwIBAAA
APFi5CsAAAAYbnBPbAAAAAAFAAAAAAAAAAUAAAAAAAAA/wAAAGs0v2sAAABEbnBUYwACBAMgAAAA
KAAAAAAAAAAAAAAAAAAAAAAAAAA4AAAAAAAAAAAAAAoAAAAAAAAAAwAAAAkAAAAMAAAAAAAAAAEA
AAAADcXVFQAAAB5JREFUCNdjYKA+YPy/AJvgf0xBJmzaWRgWMtAFAAB1sgRHoOBUTgAAAABJRU5E
rkJgglBLAwQAAAAAAAAhCCECEfctgsIAAADCAAAAOAADAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2Fi
Y19zY3J1YmJlcl90cmFja19tdHJsX2FscGhhLjkucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAAAoA
AAAMCAQAAADxYuQrAAAAGG5wT2wAAAAABQAAAAAAAAAFAAAAAAAAAGAAAACOF06ZAAAARG5wVGMA
AgQDIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAOAAAAAAAAAAAAAAKAAAAAAAAAAMAAAAJAAAADAAA
AAAAAAABAAAAAA3F1RUAAAAVSURBVAjXY2CgE2D8n4ApyMQwkAAAylkBY8cWm4sAAAAASUVORK5C
YIJQSwMEAAAAAAAAIQghAk7fcqBHAQAARwEAADQAAAByZXMvZHJhd2FibGUtbWRwaS12NC9hYmNf
c3Bpbm5lcl9tdHJsX2FtX2FscGhhLjkucG5niVBORw0KGgoAAAANSUhEUgAAABIAAAAYCAQAAABd
XGW6AAAAGG5wT2wHAAAACwAAAAgAAAALAAAAAAAAAP8AAADZ9o8qAAAAUG5wVGMAAgQGIAAAACgA
AAAAAAAAAAAAEAAAAAAAAAAAOAAAAAAAAAAAAAACAAAAAAAAAAIAAAAWAAAAGAAAAAAAAAAAAAAA
AAAAAAEAAAAAAAAAAM2QILwAAACOSURBVCjP7ZCxDcIwEEXfuSJtCjZgRySmgQUyQ8aImIAU9EQi
jyJB2JEbWsRZ8kn+X+/OH365YmlGRfN7ksGeB1FQdtw2LI/q6H09o3oSk/h2GuJFfep6nxe5NIVh
p05Oare+5CYWcGOvam/zGWW+mElsHRxsS4v5j0zMHIAribkS5iZSq4lnNErKvwB4AXm2dTQxBPin
AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLzPy6XiwEAAIsBAAA2AAEAcmVzL2RyYXdhYmxlLW1k
cGktdjQvYWJjX3N3aXRjaF90cmFja19tdHJsX2FscGhhLjkucG5nAIlQTkcNChoKAAAADUlIRFIA
AAAYAAAAEAgEAAAApi13HgAAABhucE9sBQAAAAIAAAAFAAAAAgAAAEGCWkD/AAAAY8qcaQAAAFxu
cFRjAAIECSAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADgAAAAAAAAKAAAADQAAAAAAAAABAAAADwAA
ABAAAAAAAAAAAAAAAAAAAAABAAAAAQAAAAEAAAAAAAAAAAAAAAA56vjFAAAAxklEQVQoz52SMW4C
MRREn404QcqISFSUnCE3gKtEymE4AW06CgrOkS4poogiF9i1/SjQJsB6IcnrbM8f6XsG/o8jcO7a
T7Oa3btxaTQYa/IIPtmoxY6ibp0cX/vuz2oyfQ8Uk0l9c3oxYgTnNhazlzTqDsBw7r9SW2u06vKo
gggQsmMeu1OVBRA4kdxx3131CMAMyFz1HKAb+OIDsB4Q8Ar87OAotOyAMmj8cmb352+9Edx7L7gb
1XioyCvlS+7duBgs3285AB05/KcU3VCPAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQIICX2ougAA
ALoAAAA3AAAAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX3RhYl9pbmRpY2F0b3JfbXRybF9hbHBo
YS45LnBuZ4lQTkcNChoKAAAADUlIRFIAAAAMAAAADAgEAAAA/HyUbAAAABhucE9sAAAAAAAAAAAA
AAAAAAAAAAAAAAD/AAAA2B0YZAAAADhucFRjAAICAiAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADAA
AAAAAAAAAAAADAAAAAAAAAAKAAAAAf8AAADYKIkTAAAAGUlEQVQY02NgGOaA8T8LDgmG/9glmHAZ
BQB8hQIHPRGCfwAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECvvxNIcsAAADLAAAAOQADAHJlcy9k
cmF3YWJsZS1tZHBpLXY0L2FiY190ZXh0X3NlbGVjdF9oYW5kbGVfbGVmdF9tdHJsLnBuZwAAAIlQ
TkcNChoKAAAADUlIRFIAAAAsAAAAFggGAAAAu2V+ygAAAJJJREFUeAFioDVIqO12IITR9dDDUQJA
DGi3jqoAhgAwCldZhEVYBBFE0EgEEUQRQQOoYNf5z4GH+7xvANsLvdyrI6mxbhwJwQDre5UmxvIU
WMOhWnDSgTnWcqQWHFYD59XAVQfm2EcAXm6ELzitBvargT89mKPjRHBWgN+JYAco8jeFBwQ5mmPB
8ogD0NQzf7/XAJtb2OKiDM1mAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJAQrxANgEAADYBAAA7
AAAAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX3RleHRfc2VsZWN0X2hhbmRsZV9taWRkbGVfbXRy
bC5wbmeJUE5HDQoaCgAAAA1JSERSAAAAFAAAABgIBgAAAPpL3XYAAAD9SURBVHgBYiAEEmq7OYC4
FtBaXdhEEAYBFCZyEmebwR26uCjurmXgUA9WAA5dnKxEdu7Nuets8sX3rfxWEB/o9yJyAa/gop9Q
DCeQGqeI9RI8hNsg6OKwm1AUewghTYTYR7ST4BYykDYy2G73ZhsIIR0KsYloo2ACKUiXUkjUxobh
QnqU0UYx5uAF0qdnOBpcgGcQ9LSlwUeIkQcN/hsG/zQYGAYDDXqGQVeDH4bBTw1eGQavNTgL1yDm
akuDg3g2CL5oq7haRuH3EQswXruel5DpcR2vNtu+lhF0+WariLbaFyfwAq/Nun3DVKfHgIM53OAH
fsEv7jAPp9G9WfinT6rWROObAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLY5RBZugAAALoAAAA6
AAIAcmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX3RleHRfc2VsZWN0X2hhbmRsZV9yaWdodF9tdHJs
LnBuZwAAiVBORw0KGgoAAAANSUhEUgAAACwAAAAWCAYAAAC7ZX7KAAAAgUlEQVR4AWMgFSTUdjsQ
gxkGHCAc/J8M/B6I1wNxAhALDH4HYzq+YOg4GIHnDyEHIxw9dByMwAFDzcH3h5qD/w+sg0cdPOrg
UQePOvj9UHPw+qHm4ISh5mABKieL/fRoABVQ0cEG9GpmzqeCYxNg5g0FRycMVB8vAIjvk5JmKUkG
AHkP6iO4Nv3LAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJNcMp3tQAAALUAAAA9AAMAcmVzL2Ry
YXdhYmxlLW1kcGktdjQvYWJjX3RleHRmaWVsZF9hY3RpdmF0ZWRfbXRybF9hbHBoYS45LnBuZwAA
AIlQTkcNChoKAAAADUlIRFIAAAAMAAAACwgEAAAA4Xmk1AAAABhucE9sAAAAAAAAAAAAAAAAAAAA
AAAAAAD/AAAA2B0YZAAAADhucFRjAAICAiAAAAAoAAAAAAAAAAAAAAAAAAAAAAAABDAAAAAAAAAA
AAAADAAAAAAAAAAHAAAAAAAAAAHqaxNCAAAAFElEQVQY02NgGOaAkeE/dgkmXDoAMUcBA8r1FdUA
AAAASUVORK5CYIJQSwMEAAAAAAAAIQghAtomb8WyAAAAsgAAADsAAgByZXMvZHJhd2FibGUtbWRw
aS12NC9hYmNfdGV4dGZpZWxkX2RlZmF1bHRfbXRybF9hbHBoYS45LnBuZwAAiVBORw0KGgoAAAAN
SUhEUgAAAAwAAAALCAQAAADheaTUAAAAGG5wT2wAAAAAAAAAAAAAAAABAAAAAAAAAN4AAABbNpxQ
AAAAOG5wVGMAAgICIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAEMAAAAAAAAAAAAAAMAAAAAAAAAAcA
AAAAAAAAAeprE0IAAAARSURBVBjTY2AY5oCR4R6JOgAq5QDgzpy+JAAAAABJRU5ErkJgglBLAwQA
AAAAAAAhCCECnCCZaLIAAACyAAAARAAAAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY190ZXh0Zmll
bGRfc2VhcmNoX2FjdGl2YXRlZF9tdHJsX2FscGhhLjkucG5niVBORw0KGgoAAAANSUhEUgAAAAwA
AAADCAQAAAANKia5AAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAAOG5wVGMA
AgICIAAAACgAAAAAAAAAAAAAAAAAAAAAAAABMAAAAAAAAAAAAAAMAAAAAAAAAAIAAAAA/////z0p
/Y0AAAARSURBVAjXY2AgFTD+/49dAgAvNQIABBSC5AAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC
zOeRr7IAAACyAAAAQgACAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY190ZXh0ZmllbGRfc2VhcmNo
X2RlZmF1bHRfbXRybF9hbHBoYS45LnBuZwAAiVBORw0KGgoAAAANSUhEUgAAAAwAAAADCAQAAAAN
Kia5AAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAH8AAAA1RK5fAAAAOG5wVGMAAgICIAAAACgA
AAAAAAAAAAAAAAAAAAAAAAABMAAAAAAAAAAAAAAMAAAAAAAAAAIAAAAAf////9BwS7YAAAARSURB
VAjXY2AgFTD+r8cuAQAjtQGAulzWCQAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECkr5Koj0BAAA9
AQAAJwABAHJlcy9kcmF3YWJsZS1tZHBpLXY0L2ljX2NhbGxfYW5zd2VyLnBuZwCJUE5HDQoaCgAA
AA1JSERSAAAAGAAAABgIBAAAAEp+9XMAAAEESURBVDjLvdQhS4NRFMbx3wbGCYYFYdHgqsGoiAqC
QUyiQbAo5iWDfhCLVZCBMNAmBkVBQXCigiJrsqZFy7ZjeZGJzr0rO7cdnj/3PPc+99KfOhTJatlL
Azx/AyGM/ifNghqmZWTsY7I78IgxcIqJ7sA5psANxrt7GNb0aVDenXCcxvaJsK0qVOXTAKvJCaWU
M6AmPKSVw5pQ7wXIOBPKvQRkxJuw0wuyqKllva1TcOldRSm52F+1Kdp2KXhqy9jB38iGhlCWT+RX
ipbtCo1Og815FepehGtDSTdEZy95lWSMLbk0AKy4F8KHIyUz3QGyllz8eFrIpEjyvFlFObcW+vFf
fAHVmGKtX9oKTgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECkr5Koj0BAAA9AQAAKwACAHJlcy9k
cmF3YWJsZS1tZHBpLXY0L2ljX2NhbGxfYW5zd2VyX2xvdy5wbmcAAIlQTkcNChoKAAAADUlIRFIA
AAAYAAAAGAgEAAAASn71cwAAAQRJREFUOMu91CFLg1EUxvHfBsYJhgVh0eCqwaiICoJBTKJBsCjm
JYN+EItVkIEw0CYGRUFBcKKCImuypkXLtmN5kYnOvSs7tx2eP/c89z730p86FMlq2UsDPH8DIYz+
J82CGqZlZOxjsjvwiDFwionuwDmmwA3Gu3sY1vRpUN6dcJzG9omwrSpU5dMAq8kJpZQzoCY8pJXD
mlDvBcg4E8q9BGTEm7DTC7KoqWW9rVNw6V1FKbnYX7Up2nYpeGrL2MHfyIaGUJZP5FeKlu0KjU6D
zXkV6l6Ea0NJN0RnL3mVZIwtuTQArLgXwocjJTPdAbKWXPx4WsikSPK8WUU5txb68V98AdWYYq1f
2gpOAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQKhoRzWzgAAAM4AAAAtAAAAcmVzL2RyYXdhYmxl
LW1kcGktdjQvaWNfY2FsbF9hbnN3ZXJfdmlkZW8ucG5niVBORw0KGgoAAAANSUhEUgAAABgAAAAY
CAYAAADgdz34AAAAlUlEQVR4Xu2UsQmAMBBFr3QD57K2snAOwUWcQRdwBtex0ftCyF1CwOg1Sh48
iJD810lUKHyOmp3Z9aF4i40kHXu8FBtJevIXp0zdO2w4BnG+kIFcwgDGox2rgBuPdiwCmzhHOxaB
UEUJwIXdxbfCIoCNhnxEYRUALqKQgTXTMAAQUbTkLz4VG0kqdqT4P3NXvMXGjzgBrR+V3nKeMtQA
AAAASUVORK5CYIJQSwMEAAAAAAAAIQghAqGhHNbOAAAAzgAAADEAAwByZXMvZHJhd2FibGUtbWRw
aS12NC9pY19jYWxsX2Fuc3dlcl92aWRlb19sb3cucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAABgA
AAAYCAYAAADgdz34AAAAlUlEQVR4Xu2UsQmAMBBFr3QD57K2snAOwUWcQRdwBtex0ftCyF1CwOg1
Sh48iJD810lUKHyOmp3Z9aF4i40kHXu8FBtJevIXp0zdO2w4BnG+kIFcwgDGox2rgBuPdiwCmzhH
OxaBUEUJwIXdxbfCIoCNhnxEYRUALqKQgTXTMAAQUbTkLz4VG0kqdqT4P3NXvMXGjzgBrR+V3nKe
MtQAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAjA8lb0IAQAACAEAACgAAAByZXMvZHJhd2FibGUt
bWRwaS12NC9pY19jYWxsX2RlY2xpbmUucG5niVBORw0KGgoAAAANSUhEUgAAABgAAAAYCAQAAABK
fvVzAAAAz0lEQVQ4y+3SoUpDARSH8Z8YZjIZxKZgujDcA2xiMAhitO8dfABfYLiiMBgGk33NcMFk
ExbMKlgULHqD3qnHcDfwzvsAC/u383G+c+BwmGcWslCqlu3Y1bBm1Y8XT25duZZVCRuOtC0Jd+69
YsW6BB/6Oh7+Tq7pGgkhHJZ2HozpyInaBCaGQu5U+k/YF26cyYWhpICp8K6Oy0phgLo3IS1gSyZc
6MiFvZKwLXzrORcyrQkulPCla3Hqisc+Rbkdmp6ltipPv2ngUXP+g7OUX30aRmxLcKEqAAAAAElF
TkSuQmCCUEsDBAAAAAAAACEIIQIwPJW9CAEAAAgBAAAsAAIAcmVzL2RyYXdhYmxlLW1kcGktdjQv
aWNfY2FsbF9kZWNsaW5lX2xvdy5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAAYAAAAGAgEAAAASn71
cwAAAM9JREFUOMvt0qFKQwEUh/GfGGYyGcSmYLow3ANsYjAIYrTvHXwAX2C4ojAYBpN9zXDBZBMW
zCpYFCx6g96px3A38M77AAv7t/NxvnPgcJhnFrJQqpbt2NWwZtWPF09uXbmWVQkbjrQtCXfuvWLF
ugQf+joe/k6u6RoJIRyWdh6M6ciJ2gQmhkLuVPpP2BdunMmFoaSAqfCujstKYYC6NyEtYEsmXOjI
hb2SsC186zkXMq0JLpTwpWtx6orHPkW5HZqepbYqT79p4FFz/oOzlF99GkZsS3ChKgAAAABJRU5E
rkJgglBLAwQAAAAAAAAhCCECt1X62dcAAADXAAAANQABAHJlcy9kcmF3YWJsZS1tZHBpLXY0L25v
dGlmaWNhdGlvbl9iZ19sb3dfbm9ybWFsLjkucG5nAIlQTkcNChoKAAAADUlIRFIAAAAIAAAACAgA
AAAA4WThVwAAABhucE9sAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA2B0YZAAAAFRucFRjAAICCSAA
AAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAEAAAABgAAAAQAAAAGAAAAAQAAAAEAAAAB/w8P
D/8PDw//Dw8P/w8PD/8PDw//Dw8PqnDDuwAAABpJREFUCNdjlGBiYGBgYPjH8p0BApgYyGEAAIWM
AiF8E18TAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQI43g643wAAAN8AAAA2AAEAcmVzL2RyYXdh
YmxlLW1kcGktdjQvbm90aWZpY2F0aW9uX2JnX2xvd19wcmVzc2VkLjkucG5nAIlQTkcNChoKAAAA
DUlIRFIAAAAIAAAACAgCAAAAS20p3AAAABhucE9sAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA2B0Y
ZAAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAEAAAABgAAAAQAAAAG
AAAAAQAAAAEAAAAB/x1RZf8dUWX/HVFl/x1RZf8dUWX/HVFlyNSgGQAAACJJREFUCNdjVIvKZWJi
YkAF//79Y/n+/QcDNsDEgAMMqAQAyIIG5fvZLkYAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApTR
NcHXAAAA1wAAADEAAgByZXMvZHJhd2FibGUtbWRwaS12NC9ub3RpZmljYXRpb25fYmdfbm9ybWFs
LjkucG5nAACJUE5HDQoaCgAAAA1JSERSAAAACAAAAAgIAAAAAOFk4VcAAAAYbnBPbAAAAAAAAAAA
AAAAAAAAAAAAAAAA/wAAANgdGGQAAABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAw
AAAAAAAABAAAAAYAAAAEAAAABgAAAAEAAAABAAAAAf8YGBj/GBgY/xgYGP8YGBj/GBgY/xgYGPyB
k6gAAAAaSURBVAjXY1RkYmBgYGD4x/KdAQKYGMhhAACICwIqry7rEwAAAABJRU5ErkJgglBLAwQA
AAAAAAAhCCECau4f7d8AAADfAAAAOQACAHJlcy9kcmF3YWJsZS1tZHBpLXY0L25vdGlmaWNhdGlv
bl9iZ19ub3JtYWxfcHJlc3NlZC45LnBuZwAAiVBORw0KGgoAAAANSUhEUgAAAAgAAAAICAIAAABL
bSncAAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAAVG5wVGMAAgIJIAAAACgA
AAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAQAAAAGAAAABAAAAAYAAAABAAAAAQAAAAH/Jmd//yZn
f/8mZ3//Jmd//yZnf/8mZ381gcbUAAAAIklEQVQI12PUy29nYmZmQAX//v5l+fHjBwM2wMSAAwyo
BAD0eQceIsspQAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECC4OjLmIAAABiAAAAOgABAHJlcy9k
cmF3YWJsZS1tZHBpLXY0L25vdGlmeV9wYW5lbF9ub3RpZmljYXRpb25faWNvbl9iZy5wbmcAiVBO
Rw0KGgoAAAANSUhEUgAAAA8AAAAPCAIAAAC0tAIdAAAAKUlEQVQoz2MQRAISRtb4uQzEKwWSDMQr
haomUilINfFKES4Z9eUw8CUA1mE7Pv8TFdkAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApuU1A4+
AQAAPgEAADsAAQByZXMvZHJhd2FibGUtbGRydGwtbWRwaS12MTcvYWJjX3NwaW5uZXJfbXRybF9h
bV9hbHBoYS45LnBuZwCJUE5HDQoaCgAAAA1JSERSAAAAEgAAABgIBAAAAF1cZboAAAAYbnBPbAgA
AAAKAAAABwAAAAsAAAAAAAAA/wAAANFu2J8AAABQbnBUYwACBAYgAAAAKAAAAAAAABAAAAAAAAAA
AAAAAAA4AAAAAAAAEAAAABIAAAAAAAAAAgAAABYAAAAYAAAAAAAAAAAAAAABAAAAAAAAAAAAAAAA
tsi/9QAAAIVJREFUKM/l0DEKwmAMhuH8/yJdu3iC3lHwNHqBnqHH6BU6OEtBHodWrbZFumoCISQf
7xcS8cuRXq20sLadJMU+rlNyiF10E5Yc4YjOZcwOhwWsE26M9Ty7U5IkNXo96mHyyckRCg1oFMNk
bpcjlFqtckXylFWqd8nsgY8rvrxRXjX637gD17VXodz5oB4AAAAASUVORK5CYIJQSwMEAAAAAAAA
IQghAooL4OAQAQAAEAEAADcAAQByZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfYWJfc2hhcmVfcGFj
a19tdHJsX2FscGhhLjkucG5nAIlQTkcNChoKAAAADUlIRFIAAAAYAAAAGAgEAAAASn71cwAAABhu
cE9sAAAAAAAAAAAAAAAAAAAAAAAAAAAgAAAApiqxqwAAAHRucFRjAAQCDyAAAAAwAAAAAAAAAAAA
AAAAAAAAAAAAADgAAAAAAAAGAAAABwAAABEAAAASAAAACwAAAAwAAAABAAAAAQAAAAEAAAABAAAA
AQAAAAEAAAAAAAAAAQAAAAAAAAABAAAAAQAAAAEAAAABAAAAAQAAAAH0jH8+AAAAM0lEQVQ4y2Nk
MGD4wEA8EGBgUGAgBSgwMZAIRjVQokF4NJSI0PB2NJToqoGFQYCkckMAAKs2AuCHteQOAAAAAElF
TkSuQmCCUEsDBAAAAAAAACEIIQI5cOVV4wAAAOMAAAA1AAEAcmVzL2RyYXdhYmxlLWhkcGktdjQv
YWJjX2J0bl9jaGVja190b19vbl9tdHJsXzAwMC5wbmcAiVBORw0KGgoAAAANSUhEUgAAADAAAAAw
CAQAAAD9CzEMAAAAqklEQVR4Ae3WwYnDMBBG4c+xBUl9riXkFiNUTbpwXYGgdLBjLRiWZd67Srzj
/JIk+YFZGXA2xORilIvJAMWqetpiPVWr4iATeOk++kE/uheYhMxYde+hwFu3YhZSsOm63V21BVZ3
u67bUI4H4g/x++BDw00JvKH9LlCxiFhQM5CBDGQgA/840HC1BF7R/ujJ3D00NbB5BEf/zNly/vA6
fzqeP37Pn+9JknwBxyoaWnLzfHIAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApJpKROUAQAAlAEA
ADUAAgByZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfYnRuX2NoZWNrX3RvX29uX210cmxfMDE1LnBu
ZwAAiVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAQAAAD9CzEMAAABW0lEQVR4Ae2WPW7CQBCFP7yx
gSongAJSchvfB8RxaGggKXOMSOEnHAPFgz1ZN9YKR2hZLVR+r3/fzNNKO9xQp06dDCn+NtylHgn3
KqGHv0jJWTJn4eE5S3JS/+kBVigl6ukSZQXgs4UBcpTiTis5YHzKgUUNQP1NgbIAUn+AeJZTUYYB
Cs/4M5W1PAIgKGtm7FF+4wMEZcMQGLNDYwMEZUsfA4yiApzpM16AN35CK2reyI3pJxxQLkjIM62s
zy1E4cRPOdbxYc+0XnrPjDWKXE2fXcUHAZRvxsCQTYMQlHcGTjmChgN2jABDny2KICgfDFrTa3hF
R6YO4r/uwwEIdcCBCWDI+LTO2uWEAwqUS7NFwqt14k4fA+AiUlI3PhZAkaYot5xYgGaLE2Prkzt9
FICD+LJ24yMB3K+lonzkl1neiNfIP1r4BvHPlviH19NPx/jH7/PP906dOv0B0/x9/+8p+10AAAAA
SUVORK5CYIJQSwMEAAAAAAAAIQghAt/BZdLQAQAA0AEAADUAAQByZXMvZHJhd2FibGUtaGRwaS12
NC9hYmNfYnRuX3JhZGlvX3RvX29uX210cmxfMDAwLnBuZwCJUE5HDQoaCgAAAA1JSERSAAAAMAAA
ADAIBAAAAP0LMQwAAAGXSURBVHgB7NK/SmNRFMXhb59zQW0MAf88Qt5FrNKq4MsEFOxjL1j4GOJL
qKCCELBIkWoUdPY0t5BpzqhhbPzt6sBir7vW3X744b8S72bJhKoTAEKnLsumqABWDQysAqiKL1IF
Bsamrtybm7t3ZWpsgFC/VgxbJmbSb6mf/jUzscVnywoFB57eLX+xsPDyzuTJAYr4zMVUp9KrN+nG
kR0jmzaN7DhyI715lU5VIT6+/kJ6lu7sWUEACKzYc9crLj5qUTCVfknn1lF0qiKEouoUrDvvVVMU
/0jFYf9tJ/3y8DfRm5z0ykNU2gS2zaR01rj1ouJMSjPbCE0qJlK6NWwGLxi6ldKEdobA0KOU9tFp
0WFfSo+G7QwVYyldW2vLEVhzLaVxO0OHqZSOUdGm4lhK03bmwKWUdj9ksCulS0Q77oP0bISCNgUj
z9JDq9bAwFxa2ECgTWDDQpobfL/B8ita/k/+3jP9034dFAAAwFAE7d9ainfzOwzjh8ZRwWHnca2E
A5QJpI+zBYcXTkcavzjf9QPiXyi/9wJF0f95KppffAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC
vykUmzMCAAAzAgAANQABAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19idG5fcmFkaW9fdG9fb25f
bXRybF8wMTUucG5nAIlQTkcNChoKAAAADUlIRFIAAAAwAAAAMAgEAAAA/QsxDAAAAfpJREFUeAHs
1L1Ks1kUxfHf85GoIAQdUF4s0uQK5iYEy1SjKHghthG8gtiIYulliPdgCiEwSsBCEAt90eiZw67C
K0z8wsr1r85isfY5m4fHj75VPyom+PLqSq2YONeqrxpTqgDMamVmAVRKn1TcU0tX35mhm8zQmb6u
lnjb5xbDkp6R5EWaIJ+M9Czx0WUVSmy5nih/cJt5mBhybQul4iNfTGVfMvYsGehZ1fFXpmNVz0Dy
bCzZV0X+3fUnkt+SC/9o+lPN7F6IhJP3jijRl2IZx+bDqTUyzUwjUysx71ik9FF6oypsi7vZQ6kK
JhWOEnsiaTtc01Vg2UiSHBE1Zbhtm3Yym9oowq9wFNmR5XCnqkJPkgy0iCJ+OYxVvGSSB4fZIQZr
GUS+95Y3FFhwKUnWEbv2t6soH3vKjGPIVXYp1ViP/KUFFNPv3434uRmUWPGv5DFqAy8epeyuoMSM
8/C7099Qox/hXdQqHEhROEk4DlCpsRteH/X0FZ1GeA0NtN29+lEk4bjTJlJr4Z2imFY/Zyi510ED
G5Kx9JpwN4hUx71kaA7F/w9ouZHcWkQTO5In6TXh7hCpRbeSG61vGfBf+/VNAAAAhDDQv2sksN0U
JHyBAEYElgzOFDwasApgdsCuQeCAyMShD7AFgBdARwC/At9BAQEVKqWjAYhRrxCTK9BoAAAAAElF
TkSuQmCCUEsDBAAAAAAAACEIIQJLMSpFSAQAAEgEAAA6AAEAcmVzL2RyYXdhYmxlLWhkcGktdjQv
YWJjX2J0bl9zd2l0Y2hfdG9fb25fbXRybF8wMDAwMS45LnBuZwCJUE5HDQoaCgAAAA1JSERSAAAA
KQAAACkIBAAAAAJpyH0AAAAYbnBPbAYAAAAGAAAABgAAAAYAAABBglpB/wAAAGKXeCUAAAAQbnBM
YgUAAAAFAAAABQAAAAUAAADdjhsyAAAAZG5wVGMABAQJIAAAADAAAAAAAAAFAAAABQAAAAUAAAAF
QAAAAAAAAAAAAAACAAAAJwAAACkAAAAAAAAAAgAAACcAAAApAAAAAAAAAAAAAAAAAAAAAAAAAAEA
AAAAAAAAAAAAAAAAAAAA+y4omgAAA19JREFUSMfllT9sE0kUxr+ZWcd2IGSVcJA4Flgi6C4S0Qn5
hKBLkwYdVNBT0Z5wh2hcUUEBBdJdd21oEUJEQhT8lXKRThEKBAUuFIbInO0ELO++nZlHsXGwk7Wz
dnk306x29/3me2/mewP8T4fo/pkF5GMxtP3XF55hWMF9rlaUC4mijP++OZxO6v5wLmsRFFPvfx7O
J38SY0jC50/+642//vz7F4/FeOKy7kHtnCo6wGKmds17RYa4bRrvVe3aYgYoOnMqbsIOi3yiesUr
E5MlS5o0BRRQQJo0WbLEXrl6JZ9gUXRiAYHFTH2emAxpMmR3qLRb77k+H2qNAVw97q0QE+2CtYOJ
2FtZPb4HdE4Bzya8lYCJuuCakwL2Vp5NhHEdzuhFBVV/EDAFMYBMTEHA9QdQF1WH8/17AtgsUHwg
h/9uFsLYiAMM3M/SOnHXGu6uKdP6/WwYH47th18VcOqSOASzl0l3GNqIQ6cuhfFtHmchkEmvvnCm
2UL25FsrpF46drrUYIRukttq+eFJdYLRk0YAEAx14uFJcJMlv6sdygvRY9rN1MVQ/nvGW8jHAAan
+u+Rg1Mho217ADXeP7I1tgUpk6LvPi6TkUhN/atsjd1CzgBolPtHNsohY4fK6tv+ka2xTaQFlpcM
oPrZG4PlpZDRfkMOpA9/nN//o+3ZPVJ+fTM+21gH7Uj8tmiU1+4JcI8XKrPA2r1G+bbYteOVAPLG
Xa8iFXqBslRe5cZdyEoQ8fXcIIYXrmv2dfzm5mvNC9cxfG4wekXpupgsPbGxob62XHqCSddts0xr
oV0PG4Wrmx8cxTpGztpRmx8KV7Hhes3djnDW5AGMFc7W1iz7uvsN6WvLtbXCWYxNHujevWR2BNkL
M6WXlgPra99EpGt8HVjLpZcXZpDNjux96NTEaPrIwPSjm/WqZW3J+rp1ktXWcr366ObAdPrIxGg8
c6ic6x5F7vzs0zuVd2QNG7Zs2bJhw2Qr757eOT+LnHs050YBo6sgM6nE8HrSE6MHf5s6MzWWGzoo
k9b/8vnTP8+Xby3/+znFh/1goxS5LaJjC3RG0vv2l5MeQ0Bt1cvCgFPiB7/+tdKAjjaF6NpZVWZA
ptyElzAq7A+poBZYr0QwnT0m4rRsiG2VDAvGf2B8AzrBBKPEtJkMAAAAAElFTkSuQmCCUEsDBAAA
AAAAACEIIQL7h1nu2wQAANsEAAA6AAAAcmVzL2RyYXdhYmxlLWhkcGktdjQvYWJjX2J0bl9zd2l0
Y2hfdG9fb25fbXRybF8wMDAxMi45LnBuZ4lQTkcNChoKAAAADUlIRFIAAAApAAAAKQgEAAAAAmnI
fQAAABhucE9sBgAAAAYAAAAGAAAABgAAAEGCWkH/AAAAYpd4JQAAABBucExiBQAAAAUAAAAFAAAA
BQAAAN2OGzIAAABkbnBUYwAEBAkgAAAAMAAAAAAAAAUAAAAFAAAABQAAAAVAAAAAAAAAAAAAAAIA
AAAnAAAAKQAAAAAAAAACAAAAJwAAACkAAAAAAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAQAA
AADGTgEqAAAD8klEQVRIx9WWz2sbRxTHvzOzO1pb/iHbhQarIaIOKYli1yWnHkL2ECiFHNpTKbm4
l0ALSekxh4DzB/TYFkqg9Sn0llCTUAIhJiSHHuK6xS4VxLWTxrWDE9mqVtLO7MzrQXK0sizL0qHQ
ebCH2ZkP3/fevDcD/B8GO+CK6pdi366QDAzsAh8VwDYDgEEC1sy3FgRqB94T5zvTXlY2/8rKac93
wFrJYS3m+JS7Et2LJpJfj2cme96Sr5PHKmqj/MfKL5/99mvgOxnnew3bPgxVIM9K3wNm0uuXSwtK
a4qb0qWF9cszacD3shK8fTYYuO+dciGfXlLrmrRVVkUNZrXVpNafXoI85fpeOygD9z3w66OF25pq
MKuowWqzmgq3r49W17eGMvD3E+APjwZLmpRWZhcsbkZpTcHSw6PVPS1TlZVwZtI1ILU1rSlYmknD
ycq9kQwi40EWZw8IrEGLP0JmPIi9oHzKAzYvdgCsQTcvAlMeeJNG34Hz1eHKM01NCdnPrKbKsy8P
w/GdHZ08how+PC9GyRyg7mNSyIjRj88jqiN3tgs4kMGcfIdsswv7Dsu4mk+egUIEU1fJLnCEdyfc
cUJHGqs64Y7fnUB4oXaUaooSHEhPMgemcyQMc9KTVUYMOcKAvuPdt92+41VGzPFtBpE4xLru44lD
ENuswfGAgVOie5WUAA8aVBIAHqnukZEC3+md9QPDypvdI8ub9bTWkHkCNh53j9x4XGXEkEULMb9o
DETH1xRBGDO/CFG0jdXjIonXXt4YyNqOq4fzwuLwB9hEAB2PpfWBfO4WA3Wokoghdwt5H7CNbYNy
CuLKzfJz3pnrxEX5+ZWbEDkF2oVc02O4s/LoGgfZDoiW49G1OytjWNPNUjj6UxmcfDJnKTxgEw61
pSdzOJnKoL+eAR7LnIpKqExd3Vp2HTIHUGhcZ2t56ioqUQmqrlHEFykMyd/Lf/985t3ksIkY26cr
ERnXyf/5xec3VobCQgEKdu/ql0gNjuGEf3b1gaXIhlFomu/x0IRRZC2tPvDP4sTgGFJouCHZrnhK
JAeGKz1Kzn7kf9I7QmRYYxCYEMRY6cW97879IJVXLrxE0KiRNSUpgWQi1ZPcik6/MX3u7fcG3nQa
ghOZwvLCT9Oz9/9KOeUg3EKAsNHp5mgJSPSib2igKHTUM/DpsdPHjhzpGxHSqOKL1dX7uW9y5YLr
9Jl8AUWUoGDaPwY5XHjoTSQHe/NCG9hXDxSCBXfFkNkuhQFKqEA3p4W1aNMCEh48eP2yRxInDgDM
MltW/yhUUEEFCmavSmP7PKodOHDhwgUHBwPBwkJDQyNC1Opxvf91w18ZAwPVoFX7L8e/Jy/ZwPJ4
3XAAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAkBgGIniAAAA4gAAADwAAwByZXMvZHJhd2FibGUt
aGRwaS12NC9hYmNfY2FiX2JhY2tncm91bmRfdG9wX210cmxfYWxwaGEuOS5wbmcAAACJUE5HDQoa
CgAAAA1JSERSAAAAJAAAACQIBAAAAEsJUBMAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAA
ANgdGGQAAABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAEgAAABUAAAAe
AAAAIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEAAAABAAAAAYZMhvoAAAAlSURBVEjH7c5B
EQAwDMOwrPw5dyTSnwTA5wQAgBMv2wlN66gW+uT8AQW71/5KAAAAAElFTkSuQmCCUEsDBAAAAAAA
ACEIIQJnFj7OqwAAAKsAAAA8AAAAcmVzL2RyYXdhYmxlLWhkcGktdjQvYWJjX2ljX2NvbW1pdF9z
ZWFyY2hfYXBpX210cmxfYWxwaGEucG5niVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAQAAAD9CzEM
AAAAcklEQVR4Ae3N0QmDAAAD0Xx1hFKnFhzLAdRtIg4ghisISi6/gafWWmsvybPP0vWCi30PsPgb
fDGwUiIFfpRIAVEiBiCRA4AAQE4wABAAOIgtJwggDxEBAEDIcAEBAEDI/xMjBxJi8gcAYE8GChQo
UKDADkShcBs8bqENAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQIkI2Q1pwAAAKcAAAA2AAEAcmVz
L2RyYXdhYmxlLWhkcGktdjQvYWJjX2xpc3RfZGl2aWRlcl9tdHJsX2FscGhhLjkucG5nAIlQTkcN
ChoKAAAADUlIRFIAAAABAAAAAQgAAAAAOn6bVQAAABhucE9sAAAAAAAAAAAAAAAAAAAAAAAAAAD/
AAAA2B0YZAAAADRucFRjAAICASAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAAQAA
AAAAAAAB/////7xWXLgAAAAKSURBVAjXY/gPAAEBAQAbtu5WAAAAAElFTkSuQmCCUEsDBAAAAAAA
ACEIIQIJok2O9AAAAPQAAAAwAAMAcmVzL2RyYXdhYmxlLWhkcGktdjQvYWJjX2xpc3RfZm9jdXNl
ZF9ob2xvLjkucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAAAkAAAAJCAYAAADgkQYQAAAAGG5wT2wA
AAAAAAAAAAAAAAAAAAAAAAAAAJkAAADGULC7AAAAVG5wVGMAAgIJIAAAACgAAAAAAAAAAAAAAAAA
AAAAAAAAMAAAAAAAAAMAAAAGAAAAAwAAAAaZM7XlmTO15ZkzteWZM7XlAAAAAZkzteWZM7XlmTO1
5ZkzteXnOY6LAAAAN0lEQVQY02M03vp0JgMBwMRABCBKEQsafysDA8N/BgYGRgYGBm9cJv1Ho7Eq
YkSjsVrnTVvfAQAh9wbHmEJmMQAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC3i+xgdQAAADUAAAA
NAACAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19saXN0X2xvbmdwcmVzc2VkX2hvbG8uOS5wbmcA
AIlQTkcNChoKAAAADUlIRFIAAAAJAAAACQgGAAAA4JEGEAAAABhucE9sAAAAAAAAAAAAAAAAAAAA
AAAAAADMAAAAOoNPKwAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAD
AAAABgAAAAMAAAAGzACZzMwAmczMAJnMzACZzMwAmczMAJnMzACZzMwAmczMAJnM0A51zQAAABdJ
REFUGNNjZJh55gwDAcDEQAQYVcQAAOAXAkP8vKt+AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJh
SNOR0AAAANAAAAA1AAEAcmVzL2RyYXdhYmxlLWhkcGktdjQvYWJjX2xpc3RfcHJlc3NlZF9ob2xv
X2RhcmsuOS5wbmcAiVBORw0KGgoAAAANSUhEUgAAAAkAAAAJCAQAAABKmM6bAAAAGG5wT2wAAAAA
AAAAAAAAAAAAAAAAAAAAAEAAAACdDEaoAAAAVG5wVGMAAgIJIAAAACgAAAAAAAAAAAAAAAAAAAAA
AAAAMAAAAAAAAAMAAAAGAAAAAwAAAAZAzMzMQMzMzEDMzMxAzMzMQMzMzEDMzMxAzMzMQMzMzEDM
zMyvy/ejAAAAE0lEQVQI12M848CABpgYGAalEAC4ZgEeWWYRTAAAAABJRU5ErkJgglBLAwQAAAAA
AAAhCCECeqQf4NAAAADQAAAANgAAAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19saXN0X3ByZXNz
ZWRfaG9sb19saWdodC45LnBuZ4lQTkcNChoKAAAADUlIRFIAAAAJAAAACQgEAAAASpjOmwAAABhu
cE9sAAAAAAAAAAAAAAAAAAAAAAAAAAAzAAAA5IZJ2gAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAA
AAAAAAAAAAAAADAAAAAAAAADAAAABgAAAAMAAAAGM5mZmTOZmZkzmZmZM5mZmTOZmZkzmZmZM5mZ
mTOZmZkzmZmZyDVdZwAAABNJREFUCNdjnGnMgAaYGBgGpRAAjfMA3q+LGjwAAAAASUVORK5CYIJQ
SwMEAAAAAAAAIQghAlgZjOLkAAAA5AAAAD8AAwByZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfbGlz
dF9zZWxlY3Rvcl9kaXNhYmxlZF9ob2xvX2RhcmsuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAA
FQAAAD8IBAAAAKUpS00AAAAYbnBPbAAAAAAAAAAAAQAAAAAAAAAAAAAAgAAAAEUpOT8AAABUbnBU
YwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAACwAAAAwAAAAeAAAAH4AAAACAAAAA
AAAAAYAAAACAAAAAAAAAAYAAAACAAAAAAAAAATKWtOEAAAAnSURBVEjH7coxAQAgDAOwgvIJ34GF
8id3Tiadvampqqqqqqqq6kd9MSIB+vtjU60AAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAhsKi9Hl
AAAA5QAAAEAAAgByZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfbGlzdF9zZWxlY3Rvcl9kaXNhYmxl
ZF9ob2xvX2xpZ2h0LjkucG5nAACJUE5HDQoaCgAAAA1JSERSAAAAFQAAAD8IBAAAAKUpS00AAAAY
bnBPbAAAAAAAAAAAAQAAAAAAAAAAAAAAHwAAAKAKyM0AAABUbnBUYwACAgkgAAAAKAAAAAAAAAAA
AAAAAAAAAAAAAAAwAAAAAAAACwAAAAwAAAAeAAAAHx8AAAAfAAAAAAAAAR8AAAAfAAAAAAAAAR8A
AAAfAAAAAAAAAfqf0fgAAAAoSURBVEjH7coxAQAgDAOwgpH5VzkslD+5czLp7E1NVVVVVVVVVT/q
A050AZyyK5E8AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJHKFwy4gIAAOICAAA7AAIAcmVzL2Ry
YXdhYmxlLWhkcGktdjQvYWJjX21lbnVfaGFyZGtleV9wYW5lbF9tdHJsX211bHQuOS5wbmcAAIlQ
TkcNChoKAAAADUlIRFIAAABgAAAAJAgEAAAA3Fj3yQAAABhucE9sDAAAAAwAAAAMAAAAAAAAAEGC
WkD/AAAAGFoe1gAAABBucExiDAAAAAwAAAAMAAAAAAAAALXNxGQAAABUbnBUYwACAgkgAAAAKAAA
AAAAAAwAAAAMAAAADAAAAAAwAAAAAAAADwAAAFEAAAAPAAAAIQAAAAEAAAABAAAAAQAAAAH/////
AAAAAQAAAAH/////AAAAAYkeTAMAAAIJSURBVFjD7ZgxjtswEEXfkJS9gLHFAnuGpMhlcoYU2+x9
co10AXKQHCVNViRTmCKHpAwEKbQTwCPIkGEX//HPUDOEe9zjHv91yD/88j6R/06mTN/kcKw8fcu3
f5fdZynSRUHIO6x4u9vnACGTfNm5OBiirXreuToE6eQ3ya7e4KofxwFsa56ARK63hsgAoUuhJt3h
8PVJOvlyQP5vQhOJRCaSkILRpVAY1n+T7tVn8+O4Im5rHklEHIlILI5c/yO6EgRH4MQDFx554vnl
Y/6R12whfufvXz7wzBOPXHjgRChZodYetfaBQMhf+WzoLfBNXllZWYsPafOhT54inoUl/+RiCOCX
fOKNtwqRSknXIm4InsDC2ZR8uHCupX2VLm0Xai54HIGFE2dzTc+5yvekqjnPDtgFuGZ+JOEqAm54
gfmKYC1OLAQ8vu8QnHqNOeXBYg5gKQDbq5XZAUoRe4JJB0JR53RjMzogdTO1FqGsv+w5QG3X2lZq
D8CXBBLd1LhhXGkI1qKXz+hA60W3UrYH4Lre+EYKbQ21mANoym6kkAyNnbVwZffRWtU2yuSERQdk
HoLd7h/tHgLJbMytedRe7CpzasLM3SxqLZIa6NVQ74ZJtI3S9gBmBAWgj5CSWYCk5OexBvqDjGgO
ICqEvO/ARpmIrOYA1orQnQy5oUxSOX+x6ECsw7xK8D9VwF8NykPyFgAAAABJRU5ErkJgglBLAwQA
AAAAAAAhCCECMwuCPUoEAABKBAAAOQADAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19wb3B1cF9i
YWNrZ3JvdW5kX210cmxfbXVsdC45LnBuZwAAAIlQTkcNChoKAAAADUlIRFIAAABgAAAAMAgEAAAA
RB+3RAAAABhucE9sDAAAAAwAAAAMAAAADAAAAEGCWkD/AAAAHVBTVwAAABBucExiDAAAAAwAAAAM
AAAADAAAAP8be9wAAABUbnBUYwACAgkgAAAAKAAAAAAAAAwAAAAMAAAADAAAAAwwAAAAAAAADwAA
AFEAAAAPAAAAIQAAAAEAAAABAAAAAQAAAAH/////AAAAAQAAAAEAAAABAAAAAYlen5UAAANxSURB
VGje7Zldbtw2FIW/K1GacVwEyIP3kFU0D1lRu45kIwGyhO6jzVuNeAdJPfohbx50SZHSFGlQQKaB
iJDHGGCAc+65/4Rn/og+cwINPwn8JPC/HnclLOTf4uVAXPpfvy+CuIAuGWR5IvNq9qnXaSQCGXhB
EnzZkTkSvBb/KZpB14KAyAZ8Y69coXMceE2gg705Cd3HgBhwoUGKv09FIKAogQZFUAJCyF3IZfaP
8LdnpXAcgRV+SEdMh8YoCJorsMBvEVoaWlr7jCTkYAKawHsCHo83M/pEIZEVhBZHz5lbXvKKu4+/
Dn9pJc/w6cMb7njFS2450+NoozlX714svVi+w13+OL2up1yNf57eMjOZEosyCqgrsv5CocPR9xXB
h+41feFeFgF5DEQFHI6eXmrCj2AENB2ftxKSFGhxdPScq2t6zgZ/cZ8Fc5aFxNJla8HcV0egt1zU
4hGamIWarNdZnMjR4ThVR+BkyBaUCXVTtBBRgY6uOgIdHc6qU1aTmqKFWwO5RgKuKKvsCTSFBnUS
aLPWpogB2SjgKhy93LXGptmk25VEbc8V99kH8VqN65uVY2MpGdo0tOQKRB3qIyC7pl5KF5Ls1Epg
19Y3u53DsZ3/j7RDOS753l6ovo2jfm+xpZt2lQopbAb6rQKanVAd/FDgKxTQ3TBdLwG2u6FmI4+m
Mbo+An4dJFcazc7LbBMQKkOfTcK6D+LtGmNmfrivicDDPTNzQcKI5FloWSN5PDPTb+//fqhFhfvP
v79jYraNhOa7uXUWbunoOXHmhhtu+YVbXnDDmRO97WKaQwqcmheMjAxceOQfvvKFrzzyyIWB0RYs
AXW6YIouZPZnYqBFLHhmxicgMDMyMBjoqdAgRYLLysLiXzMTjsE6UmVmMvsfSyBqMHLhwsDAzMSc
thKb7bTa0jT+cBmcA56Jkc42dkd0SXHr4/FMTKbChZHxWhS4ooAt0kWQC/yumEY5gABZNpzMnUcu
jOZEIS9oLku1guAzGwdmOhyd7amPa7IDajvpyRxnNAXWVEquANn1gU/feDrmtGhvDmuz15rkU1KJ
b16NIwFVkV3/E/0wvyPgQAIUdwOzZaV1Nx2dPnMhRZICC52WubILjoA3Q+vWhWIe8pY8l4Cu64op
JO/PK3FxS1nvJZ8mOit83RN4htes3wAQx5eUqE6xuwAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC
uVXOhskAAADJAAAAPAAAAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19zY3J1YmJlcl9jb250cm9s
X29mZl9tdHJsX2FscGhhLnBuZ4lQTkcNChoKAAAADUlIRFIAAAASAAAAMAgEAAAAtqPi4QAAAJBJ
REFUeAHt0qERxCAQRuGVVJKJp4HINEcXFEMTiHQQhcC8mx3EZXKI/zyffgMMu7b8beEkU+l0Kpnz
N9govBW2Z3JwM3NzfE8ZSSMRCQQiiTYyxmkU3MVuD+xcuDKe69pIXlnDnUbGJZsg4bJRcXEaRVw1
Oi5Mo4DrUiRdJz1c+gLhM6WxCAMWVkVdOt2yfAD9jke8STLLMgAAAABJRU5ErkJgglBLAwQAAAAA
AAAhCCECQh0XIcQAAADEAAAAQQAAAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19zY3J1YmJlcl9j
b250cm9sX3RvX3ByZXNzZWRfbXRybF8wMDAucG5niVBORw0KGgoAAAANSUhEUgAAABIAAAASCAQA
AAD8x0bcAAAAi0lEQVR4AY2SwQ3DIAxFH8oObENHyAZlybrThBsjcCIH6KGpYqmysP/1ySD/xzWB
yBOh0ulUhEwkoGYj8aIxmFcGDeHBdiM7xw0osLB/sUCiMI0UEgEiwjChgRAh05h2aGTUHnsXlblI
hXMJnR6oO59zfdx1AtcxA4ljVcuyYK2K/Kny/qmipcuWdB/A4P6aTVfqewAAAABJRU5ErkJgglBL
AwQAAAAAAAAhCCEC+Z4IWBABAAAQAQAAQQABAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19zY3J1
YmJlcl9jb250cm9sX3RvX3ByZXNzZWRfbXRybF8wMDUucG5nAIlQTkcNChoKAAAADUlIRFIAAAAb
AAAAGwgEAAAAJ9083gAAANdJREFUeAGl1MFtwkAQheFP8mUl3ygE05OpAeggcIurQe4EDraoASl7
sAybIwKRON78//npyd6Z8UJQ2TjqRTdR72ijEvxIodLoDNKTg06jUnhDqXY2Sm8dndVKLywcXKVf
vTpYPDftRWnS6OPRWKgnmx6NtQJYOkl/9mQJwadxRmzUCFQ6aZadiq1hZmywpZVm23LJiF2IGbHI
LSN25yunLfPbMv9k3rvtcqaktyJoMmYydwOy923Odu+V/74lUFpPXK61Mv9OviVY2Wn1oruo19pZ
CZ74Bm5PO+B1Vzn1AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLh2kaszQAAAM0AAAA6AAAAcmVz
L2RyYXdhYmxlLWhkcGktdjQvYWJjX3NjcnViYmVyX3ByaW1hcnlfbXRybF9hbHBoYS45LnBuZ4lQ
TkcNChoKAAAADUlIRFIAAAAPAAAAEggEAAAALpdMhAAAABhucE9sAAAAAAcAAAAAAAAABwAAAAAA
AAD/AAAATcFXeAAAAERucFRjAAIEAyAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADgAAAAAAAAAAAAA
DwAAAAAAAAADAAAADwAAABIAAAAAAAAAAQAAAADQeXOCAAAAIElEQVQoz2NgGKqA8X8Dfun/+KSZ
8BtOmTQLQyPDsAQASm0ECxVKRtUAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAtu6hAPEAAAAxAAA
ADgAAQByZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfc2NydWJiZXJfdHJhY2tfbXRybF9hbHBoYS45
LnBuZwCJUE5HDQoaCgAAAA1JSERSAAAADwAAABIIBAAAAC6XTIQAAAAYbnBPbAAAAAAIAAAAAAAA
AAgAAAAAAAAAgAAAAHCWCOIAAABEbnBUYwACBAMgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAA4AAAA
AAAAAAAAAA8AAAAAAAAAAwAAAA8AAAASAAAAAAAAAAEAAAAA0HlzggAAABdJREFUKM9jYBiZgPF/
Az5pJoZRgAUAANNsAYPSwPVgAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQI+5eyNWQEAAFkBAAA0
AAIAcmVzL2RyYXdhYmxlLWhkcGktdjQvYWJjX3NwaW5uZXJfbXRybF9hbV9hbHBoYS45LnBuZwAA
iVBORw0KGgoAAAANSUhEUgAAABsAAAAkCAQAAADS8YmmAAAAGG5wT2wKAAAADgAAAA0AAAARAAAA
AAAAAP8AAABUJEB4AAAAUG5wVGMAAgQGIAAAACgAAAAAAAAAAAAAGAAAAAAAAAAAOAAAAAAAAAAA
AAADAAAAAAAAAAMAAAAhAAAAJAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAAANY8bZkAAACgSURBVDjL
7dOxbQJBFITh2TPExHRAA5RBkyagBVqgBAqgA3SBWflzcBIgsI8jtLT/RvtWo5n3njZpNBpJdHao
HqnY6RLlWVSSxCd6X3enx3bMrSjm9rhcnS7Ymyu/ON1iJhYO16gVB4vhZbS/xNIRVcXR8qUoSXwk
Vk7gZDVUpkx0llg7O1sPt6mrmCU2NmOi8kePkpTy/f7yu/YFGv+JH9T6kQmFYMQnAAAAAElFTkSu
QmCCUEsDBAAAAAAAACEIIQKvHqr05AEAAOQBAAA2AAMAcmVzL2RyYXdhYmxlLWhkcGktdjQvYWJj
X3N3aXRjaF90cmFja19tdHJsX2FscGhhLjkucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAACMAAAAZ
CAQAAAARMV8ZAAAAGG5wT2wHAAAAAgAAAAcAAAACAAAAQYJaQf8AAAAAMVy1AAAAXG5wVGMAAgQJ
IAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAOAAAAAAAAA8AAAAUAAAAAAAAAAIAAAAXAAAAGQAAAAAA
AAAAAAAAAAAAAAEAAAABAAAAAQAAAAAAAAAAAAAAAOlPIA4AAAEfSURBVDjLzZQxboNAEEX/spJR
UrpNLuFDWLJcJUVin8XkRm7skyAfASlpXSbBBl4KQEDAZleylEwF2uHp/2XmS/+8sBIha3YkpJSV
krBjTVieu0HmHICCbhXAgbkDiEAiAiAn64AKMnIAorLvupINcCZjuDLOwOaKIqzEAn6poGctAxYX
QBgJSwwXlTSKIMaW3wxpeXaA1KCntp7uVb14zMVr+yWoLZmcUDNJxgFhJM0ITV7bCloHUz14YB41
bbrbpia69zB1p0nPlCTppC8PzKdOfQySjnqvnkY3RtKHjk13hTFgTarYAxObFGsY+uFbD1PDvTea
4mqOl447tRxbzshhw6ORzHHKm7eRvLlZ+rWyeNXJ4m8S9qycs/hP6wdcz/shV61UOgAAAABJRU5E
rkJgglBLAwQAAAAAAAAhCCECXHjfW74AAAC+AAAANwADAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2Fi
Y190YWJfaW5kaWNhdG9yX210cmxfYWxwaGEuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAAEgAA
ABIIBAAAAPzHRtwAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAANgdGGQAAAA4bnBUYwAC
AgIgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAABIAAAAAAAAADwAAAAH/AAAAxMqt
twAAAB1JREFUKM9jYBgFo4DxPysRihj+E1bERIx1RCkCAAZkAgrVxsUbAAAAAElFTkSuQmCCUEsD
BAAAAAAAACEIIQJDxdOgFgEAABYBAAA5AAMAcmVzL2RyYXdhYmxlLWhkcGktdjQvYWJjX3RleHRf
c2VsZWN0X2hhbmRsZV9sZWZ0X210cmwucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAAEIAAAAhCAYA
AABtNH0cAAAA3UlEQVR4AWKgF0io7Qa0Z15FEMMwEBUEQwmEQAgEQzEDQzCEQDAUQxAE3V7V3/Wu
3Zn3v/MS9wVU0IE9E/n2oGQCBQxgThQR/geoFw4o4jAE7F18q4QGLLSIw3xgoUWg0LwvRhEjvAiU
yftSFDHCi0CRaV+IIgqgCD87UIRRBEVQBEVQBEXcuqukiPXDIjoPXHvqN13Q2gdZ4l7POcrbqT1F
hJe2CtK3PuZonLnh8iWNxlgpPi+jiSesjCq/FpROT5xAB5jlZ+NLa3tAQJa/if8hGawXDmodFDDJ
G7MBKNLzCBZnnE4AAAAASUVORK5CYIJQSwMEAAAAAAAAIQghArfAIb6MAQAAjAEAADsAAQByZXMv
ZHJhd2FibGUtaGRwaS12NC9hYmNfdGV4dF9zZWxlY3RfaGFuZGxlX21pZGRsZV9tdHJsLnBuZwCJ
UE5HDQoaCgAAAA1JSERSAAAAHgAAACQIBgAAAJ7RimkAAAFTSURBVHgBxddDkmxBFMbxerWSZ00f
2sMat23btr2ktm2soG1bX0bUaWcxcSL+49/1zTQ4OjGV7eWowqByAJage3OlqtACQp9VKBvNYRCn
XFloJrrjoFSWaDTVCkrdoTRRaBIf5eLJzqLx1lEunuAoGo1uHUCpWxRrLxrBQR3Bo2xFQ9CNAJS6
QWHWUBO6EohSV8jEQz+hfQkotceM1+gH1C8RpfqY9RwOV4BSIc/PdlkhvMRMBnsqRCkvBrdrgFsZ
PKwBHmTwlgZ4k8E3GuBrBl9qgC8YvKoBXmVwpwa4i8E1GuA6Bv/VAP+jz+aMQnSWmQQHKYSDX/8W
exWgg8hILuHf0LFE9BT95K1CfNCtBPQWBZLDwxMIF4gm2brS9EcnAtAT/pny8Z9oxAl0HP12dDdh
RCFo3g5wEYUjo6jNmwtqQP1oA12Z20ADqAm50SrS2jwA5f43UmWqeV8AAAAASUVORK5CYIJQSwME
AAAAAAAAIQghAmu8Jd8GAQAABgEAADoAAAByZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfdGV4dF9z
ZWxlY3RfaGFuZGxlX3JpZ2h0X210cmwucG5niVBORw0KGgoAAAANSUhEUgAAAEIAAAAhCAYAAABt
NH0cAAAAzUlEQVR4AWKgFCTUdgPasRMaiEEgCsMrASmVUAlIQAoOkICESkDKSEDC7iQ9Jufe9E3S
1+Q38JX7/ueaVrR4w3wAiNeJlrVwbQira5EQViGEVQlhZUJYMyHWhBBWIsSaEMKaCLGWCbHWCLFF
CEIQghCEIMTbiReIBoZYvEAUXrxWiAiGCJ4uXh2EUL29SWS+Uq0QQet8xD1/rRD82oDfQfqQx5gB
GBWP4H9k4BEAGLMmf0Ko49eE8SDpB5A6fIsEgExa1tqL3WDR0tkj4AGLDPL4NVgpyAAAAABJRU5E
rkJgglBLAwQAAAAAAAAhCCECPxB8dLoAAAC6AAAAPQADAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2Fi
Y190ZXh0ZmllbGRfYWN0aXZhdGVkX210cmxfYWxwaGEuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERS
AAAAEwAAABAIBAAAAF7NjOkAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAANgdGGQAAAA4
bnBUYwACAgIgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAYwAAAAAAAAAAAAABMAAAAAAAAACgAAAAAA
AAABDPjs9QAAABlJREFUKM9jYBgFIxQwMvwnRhkTcaYRqQwAdlwBBRn4hIwAAAAASUVORK5CYIJQ
SwMEAAAAAAAAIQghAkQ3bynAAAAAwAAAADsAAQByZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfdGV4
dGZpZWxkX2RlZmF1bHRfbXRybF9hbHBoYS45LnBuZwCJUE5HDQoaCgAAAA1JSERSAAAAEwAAABAI
BAAAAF7NjOkAAAAYbnBPbAAAAAAAAAAAAAAAAAEAAAAAAAAA/wAAAEO4VAsAAABAbnBUYwACAgQg
AAAAKAAAAAAAAAAAAAAAAAAAAAAAAAYwAAAAAAAAAAAAABIAAAAAAAAACgAAAAAAAAAAAAAAAQAA
AAEF0Ur5AAAAF0lEQVQoz2NgGAUjFDAy/CdGGRNVLQUAdg4BAzTO1I8AAAAASUVORK5CYIJQSwME
AAAAAAAAIQghAtJaBLuyAAAAsgAAAEQAAgByZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfdGV4dGZp
ZWxkX3NlYXJjaF9hY3RpdmF0ZWRfbXRybF9hbHBoYS45LnBuZwAAiVBORw0KGgoAAAANSUhEUgAA
ABIAAAAFCAQAAADiFHT/AAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAAOG5w
VGMAAgICIAAAACgAAAAAAAAAAAAAAAAAAAAAAAABMAAAAAAAAAAAAAASAAAAAAAAAAQAAAAA////
/xhG5ewAAAARSURBVAjXY2AYfIDx/3/CigBHlwIAcnMd+QAAAABJRU5ErkJgglBLAwQAAAAAAAAh
CCECXcbTqrIAAACyAAAAQgACAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY190ZXh0ZmllbGRfc2Vh
cmNoX2RlZmF1bHRfbXRybF9hbHBoYS45LnBuZwAAiVBORw0KGgoAAAANSUhEUgAAABIAAAAFCAQA
AADiFHT/AAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAH8AAAA1RK5fAAAAOG5wVGMAAgICIAAA
ACgAAAAAAAAAAAAAAAAAAAAAAAABMAAAAAAAAAAAAAASAAAAAAAAAAQAAAAAf/////UfU9cAAAAR
SURBVAjXY2AYfIDxfz1hRQA2FwGAHUCxLgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECik4/A9gB
AADYAQAAJwABAHJlcy9kcmF3YWJsZS1oZHBpLXY0L2ljX2NhbGxfYW5zd2VyLnBuZwCJUE5HDQoa
CgAAAA1JSERSAAAAJAAAACQIBAAAAEsJUBMAAAGfSURBVEjH3dY9aBRBFADg784IwdNwNomNNhZB
0ELwQBARrAwWIhYRQbCxshN/KsHOQgtjYaNnkU7FlKlSWNiJaKOiSIyW/gSCpzGoeRY3nnsxmttd
q8wUy85jP2bevn0sq36c8llk5ld3rSsCPe9i2vNiHqCaru+XiR0sAs2AYyoqKup+YKeBotD2dDfn
MdbYkx96AnZ31u+DffmTPWhRaOnv5CeEB/l39M5L1OxPq0cgT45+j6tCuIWqZiqAs0WghhBa6m4m
5oZKsep+IYSnZRlOZ6q6BEPNh//BwAUhzBss2wNq3gjhTvl2cjgd7mh56p4QPhouC9VNC2HaUFmq
YV4ID63/I7bWda8903Tc5l4y9T1RQ0uYia4e+sqYjf+mTlpMBxz+K9Oekyvt6oRvQpg1uoS5rOGc
SZ+EsLDyAQ9ppUdv25Rhfo2+tNLD2JE+5LCQrle64j1DDBjP5OORDUUhGDHToVqaDnQack6IfufN
ZnbWMuWS0fxQu+LPeLvM648iNd9nxLi5LuZLO1SkgVXtstc2W23BmGur/AfrJw/f1bLvmRupAAAA
AElFTkSuQmCCUEsDBAAAAAAAACEIIQKKTj8D2AEAANgBAAArAAMAcmVzL2RyYXdhYmxlLWhkcGkt
djQvaWNfY2FsbF9hbnN3ZXJfbG93LnBuZwAAAIlQTkcNChoKAAAADUlIRFIAAAAkAAAAJAgEAAAA
SwlQEwAAAZ9JREFUSMfd1j1oFEEUAODvzgjB03A2iY02FkHQQvBAEBGsDBYiFhFBsLGyE38qwc5C
C2Nho2eRTsWUqVJY2Iloo6JIjJb+BIKnMah5FjeeezGa212rzBTLzmM/Zt6+fSyrfpzyWWTmV3et
KwI972La82IeoJqu75eJHSwCzYBjKioq6n5gp4Gi0PZ0N+cx1tiTH3oCdnfW74N9+ZM9aFFo6e/k
J4QH+Xf0zkvU7E+rRyBPjn6Pq0K4hapmKoCzRaCGEFrqbibmhkqx6n4hhKdlGU5nqroEQ82H/8HA
BSHMGyzbA2reCOFO+XZyOB3uaHnqnhA+Gi4L1U0LYdpQWaphXggPrf8jttZ1rz3TdNzmXjL1PVFD
S5iJrh76ypiN/6ZOWkwHHP4r056TK+3qhG9CmDW6hLms4ZxJn4SwsPIBD2mlR2/blGF+jb600sPY
kT7ksJCuV7riPUMMGM/k45ENRSEYMdOhWpoOdBpyToh+581mdtYy5ZLR/FC74s94u8zrjyI132fE
uLku5ks7VKSBVe2y1zZbbcGYa6v8B+snD9/Vsu+ZG6kAAAAASUVORK5CYIJQSwMEAAAAAAAAIQgh
ApYF46v+AAAA/gAAAC0AAQByZXMvZHJhd2FibGUtaGRwaS12NC9pY19jYWxsX2Fuc3dlcl92aWRl
by5wbmcAiVBORw0KGgoAAAANSUhEUgAAACQAAAAkCAQAAABLCVATAAAAxUlEQVRIx2NgGAWjYDgC
RhQeP4MOAyuROn8zXGH4iF3KmOEDw38S4AcGY4RmJiSDYhn4SfINP0MsdoM4SQ4YhA4FFizSCUQY
sQCFp8CwH5k7E+p3YgBE5UyoMfcZ/jNRHO8KDPsZFFDDiAJjKDVIHmYMAwMLRQa5Y49+isCoQTjA
WYav1DLIC2YUpV47BDOK8jCCGoUtQTqQYdQ2bAbtJ8dVyF77Q7IBCB2HkA3aTmRZhCiTtuOqRYwZ
dEgw6ArD2RFR0wIAmL4+emDBbhEAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApYF46v+AAAA/gAA
ADEAAwByZXMvZHJhd2FibGUtaGRwaS12NC9pY19jYWxsX2Fuc3dlcl92aWRlb19sb3cucG5nAAAA
iVBORw0KGgoAAAANSUhEUgAAACQAAAAkCAQAAABLCVATAAAAxUlEQVRIx2NgGAWjYDgCRhQeP4MO
AyuROn8zXGH4iF3KmOEDw38S4AcGY4RmJiSDYhn4SfINP0MsdoM4SQ4YhA4FFizSCUQYsQCFp8Cw
H5k7E+p3YgBE5UyoMfcZ/jNRHO8KDPsZFFDDiAJjKDVIHmYMAwMLRQa5Y49+isCoQTjAWYav1DLI
C2YUpV47BDOK8jCCGoUtQTqQYdQ2bAbtJ8dVyF77Q7IBCB2HkA3aTmRZhCiTtuOqRYwZdEgw6ArD
2RFR0wIAmL4+emDBbhEAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApRztqd3AQAAdwEAACgAAABy
ZXMvZHJhd2FibGUtaGRwaS12NC9pY19jYWxsX2RlY2xpbmUucG5niVBORw0KGgoAAAANSUhEUgAA
ACQAAAAkCAQAAABLCVATAAABPklEQVRIx+3RMUubURTG8Z+thFqKSBWtm1DJ7iBaiCDVD+Di0rUt
bg7FwU5FHQyIc+Pe3W/QorUVcXJSaakgRFRsQ9XB0uE65I0m8Y3JotP7nOne8/C/zzmXRIkS3Yea
atw/MWxUr6e6PfPIiT/27Fi3Jt8YutO0r/4LNWvDlI7bE/X44JVUdDqyace532jXKq1fV9S78Mmc
/bgkjy34V/bufGze92WOC1kt1YZBP68MBUEwGwt6JwjOrrw/DBQbD8CEFc/BmpcW6+5xyYhvoNeq
iRKoT04KBa8N+dLQl3yW8UYBKTl9RdC+A5DyC21e1MUM6sa2ZnBwvfS0vCA4N+M4mv5tLGI86v6V
dSoI8tLlhhKqVMs3/wM89LHCV4WpRO0Zu3WwjK3amCJq06HZGlkqc03a9T0ekyhRorvUJSOdgVa/
HvvVAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQKUc7andwEAAHcBAAAsAAMAcmVzL2RyYXdhYmxl
LWhkcGktdjQvaWNfY2FsbF9kZWNsaW5lX2xvdy5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAAJAAA
ACQIBAAAAEsJUBMAAAE+SURBVEjH7dExS5tRFMbxn62EWopIFa2bUMnuIFqIINUP4OLStS1uDsXB
TkUdDIhz497db9CitRVxclJpqSBEVGxD1cHS4TrkjSbxjcmi0/uc6d7z8L/POZdEiRLdh5pq3D8x
bFSvp7o988iJP/bsWLcm3xi607Sv/gs1a8OUjtsT9fjglVR0OrJpx7nfaNcqrV9X1LvwyZz9uCSP
LfhX9u58bN73ZY4LWS3VhkE/rwwFQTAbC3onCM6uvD8MFBsPwIQVz8Galxbr7nHJiG+g16qJEqhP
TgoFrw350tCXfJbxRgEpOX1F0L4DkPILbV7UxQzqxrZmcHC99LS8IDg34zia/m0sYjzq/pV1Kgjy
0uWGEqpUyzf/Azz0scJXhalE7Rm7dbCMrdqYImrTodkaWSpzTdr1PR6TKFGiu9QlI52BVr8e+9UA
AAAASUVORK5CYIJQSwMEAAAAAAAAIQghAn4RjDfUAAAA1AAAADUAAgByZXMvZHJhd2FibGUtaGRw
aS12NC9ub3RpZmljYXRpb25fYmdfbG93X25vcm1hbC45LnBuZwAAiVBORw0KGgoAAAANSUhEUgAA
AAwAAAAMCAAAAABzHgM7AAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAAVG5w
VGMAAgIJIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAYAAAAJAAAABgAAAAkAAAABAAAA
AQAAAAH/Dw8P/w8PD/8PDw//Dw8P/w8PD/8PDw9Mnfy/AAAAF0lEQVQI12OUZmGAgT8sXxgQgIlh
oDkAMPICKWGiO+gAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAiXnWVDhAAAA4QAAADYAAAByZXMv
ZHJhd2FibGUtaGRwaS12NC9ub3RpZmljYXRpb25fYmdfbG93X3ByZXNzZWQuOS5wbmeJUE5HDQoa
CgAAAA1JSERSAAAADAAAAAwIAgAAANkXy7AAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAA
ANgdGGQAAABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAABgAAAAkAAAAG
AAAACQAAAAEAAAABAAAAAf8dUWX/HVFl/x1RZf8dUWX/HVFl/x1RZS45nx0AAAAkSURBVBjTY9SM
LWBlZWXADX7//s3y5ctXBkKAiYEIMKqIiooAFzYG7XhynNYAAAAASUVORK5CYIJQSwMEAAAAAAAA
IQghAp++LMLUAAAA1AAAADEAAAByZXMvZHJhd2FibGUtaGRwaS12NC9ub3RpZmljYXRpb25fYmdf
bm9ybWFsLjkucG5niVBORw0KGgoAAAANSUhEUgAAAAwAAAAMCAAAAABzHgM7AAAAGG5wT2wAAAAA
AAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAAVG5wVGMAAgIJIAAAACgAAAAAAAAAAAAAAAAAAAAA
AAAAMAAAAAAAAAYAAAAJAAAABgAAAAkAAAABAAAAAQAAAAH/GBgY/xgYGP8YGBj/GBgY/xgYGP8Y
GBgabKysAAAAF0lEQVQI12NUYWGAgT8sXxgQgIlhoDkANmUCMiLHaNwAAAAASUVORK5CYIJQSwME
AAAAAAAAIQghAtCM1qHhAAAA4QAAADkAAQByZXMvZHJhd2FibGUtaGRwaS12NC9ub3RpZmljYXRp
b25fYmdfbm9ybWFsX3ByZXNzZWQuOS5wbmcAiVBORw0KGgoAAAANSUhEUgAAAAwAAAAMCAIAAADZ
F8uwAAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAAVG5wVGMAAgIJIAAAACgA
AAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAYAAAAJAAAABgAAAAkAAAABAAAAAQAAAAH/Jmd//yZn
f/8mZ3//Jmd//yZnf/8mZ3/TbPnQAAAAJElEQVQY02M0LOpiZWVlwA1+//7N8vXrVwZCgImBCDCq
iIqKAHlFByb+dt3tAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLxwdhuawAAAGsAAAA6AAMAcmVz
L2RyYXdhYmxlLWhkcGktdjQvbm90aWZ5X3BhbmVsX25vdGlmaWNhdGlvbl9pY29uX2JnLnBuZwAA
AIlQTkcNChoKAAAADUlIRFIAAAAOAAAADggCAAAAkCq6hgAAADJJREFUKM9jEMQAEkbWWAUZiFQH
JBmIVIeiFL86hFKC6qBKiVEHUkqkOnRvjQYWfscAAHaCMAW251wUAAAAAElFTkSuQmCCUEsDBAAA
AAAAACEIIQJoyCi9WQEAAFkBAAA7AAAAcmVzL2RyYXdhYmxlLWxkcnRsLWhkcGktdjE3L2FiY19z
cGlubmVyX210cmxfYW1fYWxwaGEuOS5wbmeJUE5HDQoaCgAAAA1JSERSAAAAGwAAACQIBAAAANLx
iaYAAAAYbnBPbA0AAAAOAAAACgAAABEAAAAAAAAA/wAAAJjFj3oAAABQbnBUYwACBAYgAAAAKAAA
AAAAABgAAAAAAAAAAAAAAAA4AAAAAAAAGAAAABsAAAAAAAAAAwAAACEAAAAkAAAAAAAAAAAAAAAB
AAAAAAAAAAAAAAAAGAbYtwAAAKBJREFUOMvtkrENwkAMRd8dpKbOBlmAMbIkFFkhKzBCBsgGUQpy
4lFEIIRCCB3FPVc+69s+25DJZAAwgNFGTb6T1Ma4Jj+ro9cXG9XTI/ViRYOFrTo9K01qa2H4IAIw
ggcvz1aTevEwR9aajGBppyaT2ll+FQG4Ayt7VXur+WXLVPfg0cHB4+xtXccerK2XRWH1jwIh3H49
gLhhEJnMX3AHcrmRCb/6eu8AAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAti556YYAQAAGAEAADgA
AQByZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX2FiX3NoYXJlX3BhY2tfbXRybF9hbHBoYS45LnBu
ZwCJUE5HDQoaCgAAAA1JSERSAAAAIAAAACAIBAAAANlzsn8AAAAYbnBPbAAAAAAAAAAAAAAAAAAA
AAAAAAAAMAAAAPYz5jQAAAB0bnBUYwAEAg8gAAAAMAAAAAAAAAAAAAAAAAAAAAAAAAA4AAAAAAAA
CAAAAAkAAAAXAAAAGAAAAA8AAAAQAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAAAAAAEAAAAA
AAAAAQAAAAEAAAABAAAAAQAAAAEAAAABUpPW1gAAADtJREFUSMdjZLBh+MJAPuBhYDBgoAQYMDFQ
CEYNGDWALgbIjobBqAEMDAyPR8Ng1IChYQALAw9F9TMPABqzAySZNXPHAAAAAElFTkSuQmCCUEsD
BAAAAAAAACEIIQJXbNPqGQEAABkBAAA2AAAAcmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY19idG5f
Y2hlY2tfdG9fb25fbXRybF8wMDAucG5niVBORw0KGgoAAAANSUhEUgAAAEAAAABACAQAAAAAYLlV
AAAA4ElEQVR4Ae3YMY6DMBCF4c+UIQIOkFwhysUj5VwoTaBKg7dMzbCStav5X238a2g8T/IXSJIk
KQdymE7X8nwBvSGYHpS4PTdPs8U7kMXs6YYuev3dS7WpwWyql3tMoeCh+hwS+KgeKJHrz2bVZgv/
gs2mmp33KxQM3qpqcXEyGnZkdHKxqKq34ZjA9wPHzwcnMKFTdqTDZPktgTE0gTEFUiAFUiAFUiAF
UiAFUuCfCLR/lrdfTFZXvcm4I5Pe1XpM4LucrpZA1vhy2n49b19QtK9o2pdULWq6BkVle5IkSZIf
wTnx8rqsL2cAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAiOxbQywAQAAsAEAADYAAwByZXMvZHJh
d2FibGUteGhkcGktdjQvYWJjX2J0bl9jaGVja190b19vbl9tdHJsXzAxNS5wbmcAAACJUE5HDQoa
CgAAAA1JSERSAAAAQAAAAEAIBAAAAABguVUAAAF3SURBVHgB7dg/qjIxFEDxkxmtFPFP4yrE7Wnl
Z+FuBEt7LV3JYKOdvEnuQ1I8+FJE42WCkHthOjk/ncaEMmXKlCnzDWM+2I+nosr5eQPAgFHiDgAw
6XpYcKDhzi1h7zQcWABVan7JFcEhiesQrizTCAbYIzxwH+wDYQ+YlPyQJuX7B79BwxAw7wNG3FQA
N0ZdAyxtToD16VyAH4QjOw/pGuDzJ2bAFsF1DfD5CdAH1gi2C0CYr6m7A4T5HnXnryDI/0NoEU1A
i305v0FocZoA/7Rv5pUAzxV2HH3s9bweQNgCM07PYJA/Mw3zegCLsAL6wMQT4nltwBqoqf8I/+Xr
MK/9CjZATQ+Ycn7G43lNgA0J8bweQHC0nuBzjLlwYRzNqwFCwpx5PK8GCAgVBkMVzWsCAkI8rwoI
CJG8OiAgBPmOAILDIqxYIVhcnr/lzj9zngscLv/B5PsB+Q+n+Y/n+S8o8l/R5L+kyn9Nl/+iskyZ
MmXK5J1f4sJvbKit+WsAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAlFd+SKLAgAAiwIAADYAAABy
ZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX2J0bl9yYWRpb190b19vbl9tdHJsXzAwMC5wbmeJUE5H
DQoaCgAAAA1JSERSAAAAQAAAAEAIBAAAAABguVUAAAJSSURBVHgB7NSxilNbGAXgb+8dBg1qM1PJ
FMI0gq1gOTAvot2A+gJT5QHyAqYXGy19DlNYaCFaBSFYBILOGU6S/zYbLpeLXM9JrkGYdaqz+de/
1r/X3ts1/mRc4xrXSH9/v1u4GMhARTZQfoeRrFBRDN1xx/Afa/n/FM/gpjMjb7wzs7Aw884bI2du
Uut2jiRLuG/si/jJ98XYfbV616lzbKIRwtqlxloVtta4rP+NiWMUaZfT89g3YeNKW2U3GktLjU1d
aV3ZCN88Zle7kHFgImy0VkKYe+WpUyeOHDlx6qlX5kJYaW2EiQPk7afnlrdCq7UWPjh3iPSvukPn
PghrrVZ46xbStvIHVX4lfHfhBlK991mS5PouJNxw4buwqhYOtrOQ8UKV98lD5J8er6TIeOiTasGL
bWIoeCKsrISpuxj8xzzJAHdNVZ4nKH23/56vQit8dIyBX8EAxz5W5lf3+sWQMalNfnj0y/Jq5SM/
KnuC3Ef+gUZYCRed5NXqi8puPOhuoWAsXAnvDZE6Bzj0vnYYo3Snf65beN55fpVxXjt87jpCwZmw
EeaOkHRFwpF57XKG0s39SLgUXva+yRkva5cRBt3cvxYa4VmvAFTWs9rlNVIX+WIqrIVTFH1QcFq7
TBWkLkdwJoTGyVYRnGiEMDPsZuC2hRCWDpH0QcKhpRAWbu/dwJ8Twf4P4S6v4fM+13D/D9H+n+K/
2rGDAgAAAIaA/VuLcR9KbPAx4nPsD4m/ZP6U+lvuxcSrmZdTr+c+ULhEAyIVyHQ+VPpU62O1Z2Ym
ISvFWapyoqAAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAmL9NrIRAwAAEQMAADYAAQByZXMvZHJh
d2FibGUteGhkcGktdjQvYWJjX2J0bl9yYWRpb190b19vbl9tdHJsXzAxNS5wbmcAiVBORw0KGgoA
AAANSUhEUgAAAEAAAABACAQAAAAAYLlVAAAC2ElEQVR4AeyUwUpbXxDGf95oQoMWXZVCIS4LXQnu
3OUx2kXVgvgAde0DZKkL786uXOiyT+Gi2ShEF/5xEeJCUFSMITc5HYaPG27R0ttE/xRyhkNOZr75
5sycO8N4jdd4jde/vCYG8tKBC0wSZXSRaQovcZGIAlp2KvPapJzRRc8YXOSvqLLJAT9ocm3StNOB
aapmEe45yh7ZhvfU+I/wuJilZgihR/3q8I6YBw/Uo02HHkHSo0Nb/x+IDcnIvgjlA5+5JNCnQ1dh
+7S5MWnTl6ZLx8+XhmZUVYiAIrEH7JJ4oAu+scYSFeZMKnZaM82F2xK6fomYoryHzB6m+e7Zdb3I
R3xhVpYsbtYsRwR6jg3mNS3LUOGLCp8QuOUrpUzfm2TmQskQtwQSXaEoliHKv0NQRicsaBKIUuHT
f5oCC5ykPjvDPEMBWCaQePaHvAEmFW4iMwujjB5DHqZ+y2L6q/LP0yJ4Jse8HRClv1PMmEwBZK2G
PpZni3mxkb/8sUjuWBQxmgkzrLBPgyuThp1WTKPeF3KRO3nHYssd/oOPncT2hhd/MBM+ck5A3a/T
uWnV+0JvyPvBmCDK//41Ah3bdUoe2rbLtodMvC37Jj07JX6JbSHwXaIuhpoYc71/mTOVcDXNPwK2
CJoIWek5dgtHyWNVDGeUxZoj/6qTBlrMydm0fCIo219EVQmGMKQ85miJpZqjBrr9JoG27V0gSmfi
qQgfEVlO8fknr12xbIo1xxPs6/3W5WpbUyH8RtT5qce6WPZzPIHKXVdGS0CkvfdHF9hj4LEklrqe
Jccn2HTCeyppcxVpiO4JkbVBMW3YCveub1LOd4EZrt3xRp+g67hSzz8hsl4ZUj7mfeP6a+n+/wv8
bMcOCgCAYRgE+neNjPuAha1tgn8C/wn9GPpF5FexP0b+HPtA4iOZD6U+lvti4quZL6e+nntB4RWN
l1Re03lR6VUtlNWemZkA/kP8b4ysgLIAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAvWnKeP2BQAA
9gUAADsAAgByZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX2J0bl9zd2l0Y2hfdG9fb25fbXRybF8w
MDAwMS45LnBuZwAAiVBORw0KGgoAAAANSUhEUgAAADYAAAA2CAQAAAAmTKJWAAAAGG5wT2wIAAAA
CAAAAAgAAAAIAAAAaZGIQf8AAADzvzqNAAAAEG5wTGIHAAAABwAAAAcAAAAHAAAAXjlvOAAAAGRu
cFRjAAQECSAAAAAwAAAAAAAABwAAAAcAAAAHAAAAB0AAAAAAAAAAAAAAAgAAADQAAAA2AAAAAAAA
AAIAAAA0AAAANgAAAAAAAAAAAAAAAAAAAAAAAAABAAAAAAAAAAAAAAAAAAAAAHPJ1EUAAAUNSURB
VFjD7Zg/bBRHFMa/N7O39vnsBP/FFywIsZEhRAJkUIRdxJGIRIq4o0FIIAoK06RIRcN2FCRKhMBF
aCKXpgECpMBJLKEksixEECESYEHQEZvAGYztu/PM7MxLcQZsfHe+4y5FosyTVtrVzvz2e/P2zZsB
/m//tkalvh0s6hEwAK48jAKKy3oacCMObuGZ6BX94ilP2oCLQ1JRIAkRGDAA+iT6cdUqCUzb79S3
meyzIAIX2JWBtDJogr42wEB9X/cbPfJd+TatRhRAhv+yf9jfZ346/3P/U+BQ5C0uBpj/Q0TgBwK4
uW32hEpoNmxYL7LsvUrMnri5DQhE4EOUGAXPUb1e4APXNswNKmVYs3ba6FBb7RbM6lAb7TQbVmpu
8NoGIPB7vdJx1OsNSVCyX00b1k6H2mrOY1aH2hlW08l+0JAsFUeHIqCh2plBszBUXtBzczrU1vDM
4FBttncJqoAr9elhzdoUULRcodGcHr5SDxSrjvZIiFO1qcuaszNSgjltNKcun6qF2COX48RyWL2A
238ysgshvJIzjIcwsmv/Sbj6IuKSAh9IHtasw5I0LbZQc/IwEPgr4AIPuLdRJQ2X6MClzmSVvLcx
O1p+N9IEAc1HqJHD1/s5F5wZUmPzEeBmIVceigC3diijy9H1XJu5tSM7Ym5l1AVg9QHhoRxdC9qE
t/oA0JUv+wYCdLQlkzDl6mLN2hnOJI62gAKRU1lcgvd2yzbmMnUBADHLtr3d4LjMBaN6Ahp6CLAV
qQEsoaEHqKeXn75I2YCD720quVQosFJ6m+APuJxuHOHNtd66isLWba4d4RywgMBdUdlSSZhs6YqC
A8r5U9d5IlrJ0k1E67y8/5kSla4U1ZIcsgT2xLn5SqLc/BOXExYwxJgxydLKzgKNAZMcMxABL4Mx
OiiRnk9QxWCE+UQi3UG8XBnxPkJq7g7AFYExAzN3kNpHxDnmbIohxsccSFYk8qXD3TGIKc4ZIDcs
IseuqodEFXAkE6mHx64icsPmziCuh0YePBoWYFc2ywk8Gh550EMjudMV2IXgS2eMFWU7UkhjL53J
jpjvHa+tAfH7Z0NWYTmrmQpDvn8W8bYGePlrEGsUwtMDelrKMuaNpdTTpwcQGrV0uXrFYSl0VJ99
/BGv/cA5Eq89X+KX4wcvdHAiVXhtFKhpXIP28XOOlXktFxrH4+fQ3rgGNa+WwK9+vYO2KZjdweRo
xOOS12y2EW9ydHcAY1PQWDGqCVWtzVjfvXNi1LEKSyh+nAodT4x278T61mZUFbcuCkSb4mjv3D5+
wbJxRQGdCo2zPH6hczvam+KI5thFQObM15y2NTLtjv+wc3btVr/agR3lX8EdO6KIMHPff/n+FyYt
089moFBCYpCIxVqbOtFxsO/2RWUsG9ZOhSp8scl1z+8NW1bm9sWDfeho6oy1IgZZ6mmBRBVizW/O
SCU/23qgb92H0RYBxssjDwKB4JB5dP/Hb85//muVfcM+foYUVL6Ap4Jz5yPaUGtisw7ivdZPt2zb
0vhOXdxv9KqAUOmp2cmpu9euf3X9t4dwdSKSejKHTKEYpBU3dz6iq2IyOkWwYNTU1azxaySQtn/q
2TTSIMhGtpnpFDLQCAtlHioiNj348Guq66qlnyT9sg/7aGKrZ+fT89DQCFcKiqKOk0CQ8LIWkyyY
AGJyKYtwwSy4/OOkJec9oBdXgMFwL67/wBHg0j6VKYz+E+1vt5jHGjnGKsEAAAAASUVORK5CYIJQ
SwMEAAAAAAAAIQghAj+iejDDBgAAwwYAADsAAQByZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX2J0
bl9zd2l0Y2hfdG9fb25fbXRybF8wMDAxMi45LnBuZwCJUE5HDQoaCgAAAA1JSERSAAAANgAAADYI
BAAAACZMolYAAAAYbnBPbAgAAAAIAAAACAAAAAgAAABpkYhB/wAAAPO/Oo0AAAAQbnBMYgcAAAAH
AAAABwAAAAcAAABeOW84AAAAZG5wVGMABAQJIAAAADAAAAAAAAAHAAAABwAAAAcAAAAHQAAAAAAA
AAAAAAACAAAANAAAADYAAAAAAAAAAgAAADQAAAA2AAAAAAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAA
AAAAAAEAAAAATqn99QAABdpJREFUWMPtmE1oXFUUx//n3vte3nwYiW2sMW1JSrXa1iqMohUEXVho
S9yJCLrSLnQnuOlKBUWkohtR2pKdKIIFaUsLVdSCxYWEYotRbKo1sZU2jdHEee/N/Tou5jWZZt6k
mWRw5Tsw8Jh374//Oefee+4B/n8aHwItb1i73zaO4IbfjsHqSggEVCjNxkQ8wgAY878rhlEdskVu
lpEY5RGXaSGgIjdT6kfdDy7D8Upgog7bKZ06YaHBkBvKlXBAAhfciP7lHzgQwh1K2uMug/nlwOqO
E4+qUJ5I4Z5evfeBNdsLd6lB6qUiwDFP2l+Tny5/++Z3H1+F3BFp97WFz5zaZuIISARDxUoAOnHf
1DvJec2GDRvWmV17S85PvXPiPlAlGCoigIRoL1cJAmog2lECPr1j+qCODWuvvTbaaKed9tprp502
2mivvWEdTx/89A5gR2kggmoHRxBQawtPFiB/25NOGtZeW+00tzCnrfaG08kLz0M+WVhbaIUTudkn
KmHke+XU/tsPyFXsAMicL+fnkAA7uar/4NT+Xhn5SgixlIVPEJBrC+h6v2fmmGVtFlHUrNBYnjn2
fg+61hbyYkfNa2qjSsVGefiTwi62kG0Fm+FIJceeeGrMRX7MLrb2CASBcFsJ4q8DhrVZsqZGM4b/
OgCxrYRFnUkQUENFYGKPZm2XheL6yIk9wFCxdV4SCHIggjq+Kb1kuI1YNcXOcHrp+CaogQiyUZu4
XtmdEnb7y7KP3SLZd6NHsJN921+GvVO2ViZ3dkF+WanFmrVfti6uj67FX1bqM+YpI5CScFufFQXY
5R2ODXNZUdj6DJzKdSMBW8QRt+u28lDuUm/blUD5iV23HXFbxPwCa5i2V8C8cr/awB2BMdSGV+6H
6RV525VYJ+H7HibAdqROsYS+h+HXNWx0DdxRRlTa1GZdsuhJWdqEaJSblVGFRrjcrQY7CVOD5e4R
rlBTzFICPRSp1R2FrX4owlyBdA2WvZYDKna0vCyWg8YNf05ZjSC07HQ1qyVEbYGyehDFtPdJJ1E+
mfaNhOtW1Gljpqjt2qjV2UYwU6dNXlnAY7xepkk8QeCOwJgJ8USarJdjcwfovDLuJyTT5zvpxunz
SPpp3lMNsMsOwfcjDtSRNCHp8P0IgssuD4ZZh+C1M8mE6ETUWKA2/toZBLMuJ2bwk26Afr7y++cE
9itmecL4Fz9fGaBJl5XkC7LRGwPx0WGTCrlCbSykST86DGFM40WjIWbwF02PfOPs+FGxQm3sBcaP
vnG2R14087oWwGC1Bt4aTq7KlWhjKZOrbw0DWsPmwwCGq+pbaXjs5HtYSZIwcPK94bFbqarhwPm1
voeDvhKXw92Hzh1Sgpd1iLJV4tyh3YfK4ZUYGi4/ZnWcRc3GIT24b+KbQLFrG+UCNfHNg/tCsjFq
sNffQ3NgaUK1meTxveOnQslu6ZsXM7tQjp96fO9MQrU0aYbl7haOwnDaffjVzlVrNgPs6cbXH2Yv
SIofPnvk1T9iZfQsqlgQsWZY9qeDCojePXnP5OC9UdGDPbU+wT17okCkfx95+7H9ylutZ1Ft1tVC
WR3HVOr68MzZk9uiWzaEAROYPXieyQwPJiKhhNU/HX3x1ddPdQdprKuoIoVp7htQfiGOLhRQROnm
UszGP3f3C7s2Plrql1nnIWuDQABwqF4c+/qDY8M/BqJIf1dRRYwEtYUubN2aICgEiFBCVCrKaMbC
9q9+afP2bWsGb+qLemQEuDSdnv3j8q/fnnl39OJVqG7l0mqMNFNl89YptayNJAJEdSt1yXAGMLCI
osItYbcEZtyfOk2QQiHohtPVGtLMTJ6qGzVdBBRCROhCiDAMC4GSMSUN0xSoyNYlRmtoaNSQYsEG
tfR2EmX6AoQIEUBBQYYCxAQQg7WHg4WFgYaGyTTxchtl9U6PmjM5d09mMK7B6uZaa1p6C1BkGiVE
dm0VADwYDAcPl+m54bG01FKb5uzafYvngLy0buN//PwLzB71U6Iq9j0AAAAASUVORK5CYIJQSwME
AAAAAAAAIQghAv87ZmPlAAAA5QAAAD0AAgByZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX2NhYl9i
YWNrZ3JvdW5kX3RvcF9tdHJsX2FscGhhLjkucG5nAACJUE5HDQoaCgAAAA1JSERSAAAAMAAAADAI
BAAAAP0LMQwAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAANgdGGQAAABUbnBUYwACAgkg
AAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAGAAAABwAAAAoAAAAKwAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAEAAAABAAAAASkseVsAAAAoSURBVFjD7c+BCQAwCASx1/13bqcQFJIFjksA
AAAA9qi82UBPH9wPfJjNAQdCZLiUAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLU08+g5AAAAOQA
AAA9AAAAcmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY19pY19jb21taXRfc2VhcmNoX2FwaV9tdHJs
X2FscGhhLnBuZ4lQTkcNChoKAAAADUlIRFIAAABAAAAAQAgEAAAAAGC5VQAAAKtJREFUeAHt0LEd
QUEAg/GzAKjfEAClN4MZYQB6rdoEDGAFAacTgBzknwW+X4KZmZmZ2T2QYYEr3hvQwyZtQI6TJWbn
pwtoBL0YsIoJ9VQBfQxFL5CAHFVMNC+QgBBQFb1AAnZ0L5AA3QskgLygC9C9QAJ0L5AA/QskICZM
FS+QgJgwFrxAAnQvoIx8t3KIBC9wohe4z39hjnLKF9boohBSQQlZ+BZmZmZmZlsfxncCjokHfwAA
AABJRU5ErkJgglBLAwQAAAAAAAAhCCECJCNkNacAAACnAAAANwADAHJlcy9kcmF3YWJsZS14aGRw
aS12NC9hYmNfbGlzdF9kaXZpZGVyX210cmxfYWxwaGEuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERS
AAAAAQAAAAEIAAAAADp+m1UAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAANgdGGQAAAA0
bnBUYwACAgEgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAAAAAAAAEAAAAAAAAAAf////+8
Vly4AAAACklEQVQI12P4DwABAQEAG7buVgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECVjnivfQA
AAD0AAAAMQACAHJlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfbGlzdF9mb2N1c2VkX2hvbG8uOS5w
bmcAAIlQTkcNChoKAAAADUlIRFIAAAAMAAAADAgGAAAAVnVc5wAAABhucE9sAAAAAAAAAAAAAAAA
AAAAAAAAAACZAAAAxlCwuwAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAA
AAAEAAAACAAAAAQAAAAImTO15ZkzteWZM7XlmTO15QAAAAGZM7XlmTO15ZkzteWZM7XlA7LJ5wAA
ADdJREFUKM9jNN76dCYDCYCJgURAew0sWMS2MjAw/IeyGRkYGLwJ2fAfB5t6fmDEwcbpB+8hFg8A
KsUGzf6JNMoAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAqaIp4TWAAAA1gAAADUAAQByZXMvZHJh
d2FibGUteGhkcGktdjQvYWJjX2xpc3RfbG9uZ3ByZXNzZWRfaG9sby45LnBuZwCJUE5HDQoaCgAA
AA1JSERSAAAADAAAAAwIBgAAAFZ1XOcAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAAzAAAADqD
TysAAABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAABAAAAAgAAAAEAAAA
CMwAmczMAJnMzACZzMwAmczMAJnMzACZzMwAmczMAJnMzACZzDSFMqEAAAAZSURBVCjPY2SYeeYM
AwmAiYFEMKphpGgAAB/tAklP02w7AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLqA81U0QAAANEA
AAA2AAIAcmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY19saXN0X3ByZXNzZWRfaG9sb19kYXJrLjku
cG5nAACJUE5HDQoaCgAAAA1JSERSAAAADAAAAAwIBAAAAPx8lGwAAAAYbnBPbAAAAAAAAAAAAAAA
AAAAAAAAAAAAQAAAAJ0MRqgAAABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAA
AAAABAAAAAgAAAAEAAAACEDMzMxAzMzMQMzMzEDMzMxAzMzMQMzMzEDMzMxAzMzMQMzMzEtAsM8A
AAAUSURBVBjTYzzjwIAVMDEwjEqgAgBIDwEkLVjXTgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC
4cZERtEAAADRAAAANwACAHJlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfbGlzdF9wcmVzc2VkX2hv
bG9fbGlnaHQuOS5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAAMAAAADAgEAAAA/HyUbAAAABhucE9s
AAAAAAAAAAAAAAAAAAAAAAAAAAAzAAAA5IZJ2gAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAAAAAA
AAAAAAAAADAAAAAAAAAEAAAACAAAAAQAAAAIM5mZmTOZmZkzmZmZM5mZmTOZmZkzmZmZM5mZmTOZ
mZkzmZmZLL4aCwAAABRJREFUGNNjnGnMgBUwMTCMSqACAP1NAOSPAcSXAAAAAElFTkSuQmCCUEsD
BAAAAAAAACEIIQLM8FtY7AAAAOwAAABAAAEAcmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY19saXN0
X3NlbGVjdG9yX2Rpc2FibGVkX2hvbG9fZGFyay45LnBuZwCJUE5HDQoaCgAAAA1JSERSAAAAHAAA
AFQIBAAAADsPnx4AAAAYbnBPbAAAAAAAAAAAAgAAAAAAAAAAAAAAgAAAAGzhjc0AAABUbnBUYwAC
AgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAADwAAABAAAAAoAAAAKYAAAACAAAAAAAAA
AYAAAACAAAAAAAAAAYAAAACAAAAAAAAAAUTz4V4AAAAvSURBVFjD7cuxDQAgDAOwlMt5HMEHlcps
767szN2clU+iKIqiKIqiKIqiKIqi2HtB3gMkNQbc2QAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC
mJ9FMOsAAADrAAAAQQABAHJlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfbGlzdF9zZWxlY3Rvcl9k
aXNhYmxlZF9ob2xvX2xpZ2h0LjkucG5nAIlQTkcNChoKAAAADUlIRFIAAAAcAAAAVAgEAAAAOw+f
HgAAABhucE9sAAAAAAAAAAABAAAAAAAAAAAAAAAfAAAAoArIzQAAAFRucFRjAAICCSAAAAAoAAAA
AAAAAAAAAAAAAAAAAAAAADAAAAAAAAAPAAAAEAAAACgAAAApHwAAAB8AAAAAAAABHwAAAB8AAAAA
AAABHwAAAB8AAAAAAAABjPqERwAAAC5JREFUWMPtyzEBADAIA7AyI/hXCQ52cCd/Kp2LeTkSRVEU
RVEURVEURVEUxb8F5FwBxlfkpzAAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApNw8p3GAwAAxgMA
ADwAAwByZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX21lbnVfaGFyZGtleV9wYW5lbF9tdHJsX211
bHQuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAAgAAAADAIBAAAAHP9ujUAAAAYbnBPbBAAAAAQ
AAAAEAAAAAAAAABBgtpA/wAAALB/rEoAAAAQbnBMYhAAAAAQAAAAEAAAAAAAAADWzq0rAAAAVG5w
VGMAAgIJIAAAACgAAAAAAAAQAAAAEAAAABAAAAAAMAAAAAAAABQAAABsAAAAFAAAACwAAAABAAAA
AQAAAAEAAAAB/////wAAAAEAAAAB/////wAAAAGfqufYAAAC7UlEQVRo3u1ZO44UMRB9VfYOwRIg
IbQBRHsEJFKIuAjpXoGcE0CKxE3YkDMgcpK9wHS7COx2+1PuQQiJtumyenrGmuQ9v1dVtoEjjjji
iCOO+G+D/sI/9h3yJ/BI/U27JUcaM3KZjEugKJmpadgjATl0qWDLJbjrd4oEUEIF7dYYkkH2T/5N
IcGq8FPYBICzuVIT+1HAQsEC24FU4MksVfAXoOXgOF+qYR8EpGvtwYsySrIyBZTi96A5ea9Do+7f
un8FL1HwDgIHggMgIC0N2ioHrKD9Y7L3QsReFSBwAfgMiW8Kz0pGRYBuAAYH8BxGqoS9ESAJASlU
B4nIJPo/vG0lfo7AGRb07und65cf8ASmswbojIdv7z/ef3mAgBJCCgWYrMJz+GQwDBgG5tPbV3e4
BXfXARo8fv7i2c/P37NuQEIuiKipEP4K3oJxBZavuO24Ef5Bb+BwhsMEhxkOLtYHQLQkSIUGbrre
CdzABJ1z6AuQ9wY283+uAIMTLK67JuAajzDF9LdkAWr1AWX+t2qf0FdYABMEDEnqV1MB5FMfLE5B
Ab3HCQyHORREbwNq7QXyMuiJ6F8BAgMJHc3SxUjdCKWVwMLAwuKEqwEUQJiA8EiCVBByY0sDvgr0
HiYgSdcfWiu8MMNJAhxBAVcAzsECngakxZDVXeDC1SgKoGz1m0lwWX8KsrGDlEEHCwcO+1nOt8Ss
nPCknQB3T8AqffU8iysDcFEI+7eAiRSsOYByBWhnQutBWO8KIK0D1AmgQv6jJMHcBqQTQMUdwAZr
XUWJZNMClHUEFBzTOwGcFXi0FJBSkFMxggKaR/mcFUBUMhmBAB0LbVWBceArrt+qAmuIcq3Ya9R3
g79BAIaBfwEJF38pL5hc9+Dd9t0gq0xJZoTeV18a6FQLpGvvR/8KSO8CqiXlAnpNxAgK0LBtKsDF
MXdPwJyg2VRAywRjWKCpaKsCFzjMYEwDbIcnTJgxB1QVEazmTDdkDnBaXfsFBRYyk7gi054AAAAA
SUVORK5CYIJQSwMEAAAAAAAAIQghAkt1QD0IBgAACAYAADoAAgByZXMvZHJhd2FibGUteGhkcGkt
djQvYWJjX3BvcHVwX2JhY2tncm91bmRfbXRybF9tdWx0LjkucG5nAACJUE5HDQoaCgAAAA1JSERS
AAAAgAAAAEAIBAAAAHjft/QAAAAYbnBPbBAAAAAQAAAAEAAAABAAAABBgtpA/wAAALxnQbYAAAAQ
bnBMYhAAAAAQAAAAEAAAABAAAACG1/q0AAAAVG5wVGMAAgIJIAAAACgAAAAAAAAQAAAAEAAAABAA
AAAQMAAAAAAAABQAAABsAAAAFAAAACwAAAABAAAAAQAAAAEAAAAB/////wAAAAEAAAABAAAAAQAA
AAFpy87/AAAFL0lEQVR42u1bPXIlNRD+WtKzvQVsERIAGRFn4RKkREvCGYiIKKI9AUu0yV6AvQEX
YKv4SdnC6+cZSQRqSd2Sxq4iWc3YMzXvjcfj5/d9/avuHuCBbxQfOAEGjwQ8EvBIwCMBD3hzG8GB
7o8fkyGJ/++OQRgcgKcNyDQt+Hjn9S0CGugkjjENMxKgoUdxDO93G/BJHdTRQROac+wgb8Gmel40
QMAnhpzPqKFiRhKieq0E5B3lp4YON7BrDd7wuWmomY8ADTOo93ROvRdwjfwzRMOgqbwbvippeP+e
QFt/ln1g4AERxO/pav0bNgPXST/Dr0faKx2kzGEWDdAqn+CnPZNiEPg7j53gAL5l8BYGBCv0YC4K
Kvwse4+IAM8UgOEPKHCD3LBK3cJ89dFPX3/yzH6wvxwvXP/5w7PnP79lYVUaNlOcbPdJ2hYGDub3
bz79jk47zXOXN99//iMCVgR41grpDyKUTzcAq3mGb2GX39zT/Wb6/h/3JTx8oSCZB4pnGDjBrP4O
Fg7O7hg+YJ7ixEJeS1iksRMkZQRJA05wtGf8IDABEZbjA8HAVxJcl/Zm9+fg4HCx+/XuRYkSQSRE
MR+uCYJUfICDwwmn3RNwanKDjDJu5QFZA+yBCEjZgIfhTID6ihCJJDd5AAsLewgCLEc1W3JZkcSZ
jSiQNcAdoOZ1SgG9pPQ0qglSowNZA45AgC3wNcpOA0it/cyhCGiXc50GtMuhIxJgBkt5JoCaOCA9
wd43af1GEUBaA2QlSFKwfwI0fOiFvBkUxGotyBygcWKa6ha1vx4tjkmUQ45AgFXKT2MCdICotaG9
b7Wci1E5z2wtosYKs0sCZGF/oCDtzVobjmAC1PQ0NjLBXnH2L/270NBdJvCAti0CIo41PbWJx5Qb
6qv8k3gA6C18hdUMbtd9liPIXpIQ7zcB2Wc5AgGhoWCDAHlT7BqK+92CQIOeCjNQl9pbDYcgIDAa
WRe+Jwpk+B4h7Bx9aZFuaLPpAkUsnfWAAP/X9Z4J+PtfAb/6tM4EojKBWFrLHv71C7/uFb5ff/2F
O4JeTIrIASpYoBuJsKIoal+/+cx//MWHO2yR/XHz6sW3L99e4xYLFqxYuUkqh2bKKkmXwi9wgUtc
4gpXeIInuMIlLnGJE06lyGzLQvP9Jzqp55u6wAsWLDjjjDNu8A7vcIMbnHHGLW6xYsHKWhEARBcr
gig8QOCPW7FwOQHlulNl5jlSHf2Nb8ueJS89wcaITG0d50bSCouFZZ3/zQqnCJgn2akEZArOrA2J
ghoOAwYjMlUR8kcZeKxcTop8vcK3osw8wzInf+tMwS0WQYDnXeY1g+Zokn9msxZG0z/x8NwyNxN5
gNYLhKIDC+uB1oHY5rcOiJGIdSCWcTIPwlIayYGZtV2fZaZ8v5qBx1JISGd5PCaoVW6UJlDHzHyJ
DouwsERA7rPSJAYgjSDm3KUjwRczaIJgOyMk0yAI1xfgYYvyGzE7OpMJBP7myRB8ocCXOBD7tYDr
SgdBjczkaxYWK2cLGv4MeYCkwAuH6EsQ9GJuNG6FwewJAsNaiz7UAQPdZJqJAD0g6wUJEn5X+3KA
cIMpFhi+MQoTCKVbSJOPysYi6boKkFlA1LWh1gSouJT60abM15Da53piJKo9DPY4qgy57qOIpR1K
UOxnxeefFte6EESBb/y8gMqOqIyT5XOjHp/AZPJva79BkRCV4m9FAfYCUI+UVDmH0iyd9bmh2EQE
XQ0OylWqVFg8NdY8NdS2SPf8zFDfHShn/wHXWlanMi56fQAAAABJRU5ErkJgglBLAwQAAAAAAAAh
CCECM6D28QsBAAALAQAAPQABAHJlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfc2NydWJiZXJfY29u
dHJvbF9vZmZfbXRybF9hbHBoYS5wbmcAiVBORw0KGgoAAAANSUhEUgAAABgAAABACAQAAACqo3/p
AAAA0klEQVR42u3UoQ2GMBCG4TOQWtYghEVQSFZAo1kIxxasgWyQCIJ5f3EEAvlpcpb0kfS+5Fqu
lSiKvouUnJaRmZ2dmZGWnPStvGTA8+QZKOWJhJqFNws1yb28ZyVkpeeKUJ/lGxMdBQ5HQcfEdkbq
q/cFtdCQ3VrNaLhWSz2Z4fxQyR9UZ2QgFXL80UwjL2iOxjy50KImstdAxoRqhRHVSQAdahRmVBEM
FKhZ2FEuGHCo3Rwwt2TetPlYzT/OPBrG4TOOt/kCGa+o6RGwPjNRFH3WD0cLSFPGfwx2AAAAAElF
TkSuQmCCUEsDBAAAAAAAACEIIQL/5SBqCwEAAAsBAABCAAEAcmVzL2RyYXdhYmxlLXhoZHBpLXY0
L2FiY19zY3J1YmJlcl9jb250cm9sX3RvX3ByZXNzZWRfbXRybF8wMDAucG5nAIlQTkcNChoKAAAA
DUlIRFIAAAAYAAAAGAgEAAAASn71cwAAANJJREFUeAGd1LVhw0AUgOEvIFeGdeRWWsUwgndQJggt
owwhl2EcwOxLF4Y7v799TACwp6tQqd2bm7tXqxR69vwgmdyJK0vBO0vXzuQyX6RjqLEWfmCtMdb5
rD7xLPzBs8m7ScvIi+BvXoy1gFwjRDCVQ8+ZdZTB2pkehWshkmsFlWW0wVJFLSRwwUOSwQOrJINV
qsEiOaXkolPbekSZNLhyh9WIX75GDmSGniPWeyTb8YCgY/THiU6/nihk+k5/fALn+jKAn9/Mg4WF
B7VK+fnNvAJhTMOUGtt9hAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECWz3PT4cBAACHAQAAQgAB
AHJlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF90b19wcmVzc2VkX210
cmxfMDA1LnBuZwCJUE5HDQoaCgAAAA1JSERSAAAAJAAAACQIBAAAAEsJUBMAAAFOSURBVHherda9
bSJRFEfx37wCTDYRbIALWOwWTA1IzqENS7QAjdhmHIKbQHIFJjBazUps4BGjeZsjkIF5/5Mfvc97
r6MJcg+ePFsr7e2V1p49eZALzkrQNVb49C0e8O1TYaz7s6zj0budeBo77x51nEymb2arEX+gsTV3
K3MkwZ1CJZ5JpXAnOEhmYKkWL6C29PtwVX0LtXghtYU+ANyYqcQrqMzcAAQjX+KVfBkJQNdSc7Wo
sdSDYGwntuCfiUCuEFtSyBnatBZtDJmqWosqU17FBLzykUT0wd8kopI6iaimSiX6k2ZryQ471fUv
kj3IZF8k4acNJmnKCD2rVoVtpQcEI9urRVsjIUXxn+ukb0fIDKwubpArA5mDBPfeLmrZb+4FR5K5
NW8xRKQfa4CgZ6KwObLNykZh4tf5U1tuaOrFWqlWK629mBqeGv3+A9Eq90F+nE0eAAAAAElFTkSu
QmCCUEsDBAAAAAAAACEIIQKLsjGl0AAAANAAAAA7AAAAcmVzL2RyYXdhYmxlLXhoZHBpLXY0L2Fi
Y19zY3J1YmJlcl9wcmltYXJ5X210cmxfYWxwaGEuOS5wbmeJUE5HDQoaCgAAAA1JSERSAAAAFAAA
ABgIBAAAAFBCFf0AAAAYbnBPbAAAAAAJAAAAAAAAAAkAAAAAAAAA/wAAAL0IzwEAAABEbnBUYwAC
BAMgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAA4AAAAAAAAAAAAABQAAAAAAAAABAAAABQAAAAYAAAA
AAAAAAEAAAAArAY9UAAAACNJREFUKM9jYBgF1ACM/x2IVfifOIVMxFo9FBQSHTyjgDoAAN51BIo5
OjaWAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQIp7N0YxgAAAMYAAAA5AAEAcmVzL2RyYXdhYmxl
LXhoZHBpLXY0L2FiY19zY3J1YmJlcl90cmFja19tdHJsX2FscGhhLjkucG5nAIlQTkcNChoKAAAA
DUlIRFIAAAAUAAAAGAgEAAAAUEIV/QAAABhucE9sAAAAAAsAAAAAAAAACwAAAAAAAAC/AAAAAOl/
LwAAAERucFRjAAIEAyAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADgAAAAAAAAAAAAAFAAAAAAAAAAE
AAAAFAAAABgAAAAAAAAAAQAAAACsBj1QAAAAGUlEQVQoz2NgGAVDHDD+30+cQqbRsBoxAACoCwHC
TEeR0QAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECPo4N2sABAADAAQAANQADAHJlcy9kcmF3YWJs
ZS14aGRwaS12NC9hYmNfc3Bpbm5lcl9tdHJsX2FtX2FscGhhLjkucG5nAAAAiVBORw0KGgoAAAAN
SUhEUgAAACQAAAAwCAQAAADTThCeAAAAGG5wT2wNAAAAEwAAABEAAAAXAAAAAAAAAP8AAACdk5Ix
AAAAUG5wVGMAAgQGIAAAACgAAAAAAAAAAAAAIAAAAAAAAAAAOAAAAAAAAAAAAAAEAAAAAAAAAAQA
AAAsAAAAMAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAAAMrDSQEAAAEHSURBVEjH7ZS/bQIxFId/Pp9S
0SQFBSULMAIzMANldogUMQcSC8AMjMACDECTFHScfV+KO/7e2XcoUpr4c+V/33uy3rOUSCQSv8Lc
TjA9b/E3GWH0ppNMZzYv+mrmlF/2M5V616e+ZSMar1d9aKFMZSiQQYgV4AnhgRVqG48qyxo4UbaM
AthgOQcNiSQyxIAtUDSyKYAtA6pTcVGtGrID3J3GATuGIU1LPWARY/Z3KgfsGVPt9hPVqgmHy7N7
4MAkpglUKDliyhHweODIlGr1OVGtmlHg8ThmXZpIz5Aj5gDMuzVcK7vROw6rpUYyWsrKPdX9zWJQ
KUXaoa+o/lhIv20ikfiX/AD55Gv/YIV67gAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECL7os7WoC
AABqAgAANwADAHJlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfc3dpdGNoX3RyYWNrX210cmxfYWxw
aGEuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAALwAAACAIBAAAACh46fIAAAAYbnBPbAkAAAAC
AAAACQAAAAIAAABBglpB/wAAAEKDxPAAAABcbnBUYwACBAkgAAAAKAAAAAAAAAAAAAAAAAAAAAAA
AAA4AAAAAAAAFQAAABsAAAAAAAAAAgAAAB4AAAAgAAAAAAAAAAAAAAAAAAAAAQAAAAEAAAABAAAA
AAAAAAAAAAAAkLD94AAAAaVJREFUSMfVlj9rFEEYh5/ZszFICCiSBNuQf62NEBuxsYil4JfRDyBY
C36GJHZWyScQxKQJWGhzUUMKQT2CtzuPRTbI3uX2Zne5Ir9q2Zl55p2Xmd/7wnVWmDxkIIQIrrPN
FpssMlcODTjhkAPehf7lrIYyMwMfuOPAqxTVM1+7DPYaw8F53xhVLczLr//w3MKonvqs4Qb2wBU/
qfkYuLrJ0Ki+vAgoPfJVv6hDp6swV18knsAALvgxEX6ZKBNTZAa+Vf+arkLtuzg1RfbAh0ZjTcav
0lB9NTV+M3BPzW2mqP4Yjz+rwkN0g8ej/5OeZ+Qu26MPtYrJgEfcIq97zZMODjwZ/VnFR+B+vVXU
2suqc6EwTMILrHTA32OhurqCDwJ3OpjjPDfrktNVYg3eAJy1RsMvzuuiD8DncmobfJ+f1dXjF/ND
B/xxGNgL1l3MA35zo8UGAXifYmhtTeHUpSmmNmNL62DIJwmGXJaT2x42LifPU+vVRTH8OpNiOPNS
PvNGpNJG7U5oo0xpo1KawDWessUmS6Ufyh++c8Q+u+FbyybwWugfW6VlD0QWrLgAAAAASUVORK5C
YIJQSwMEAAAAAAAAIQghApApX5TCAAAAwgAAADgAAAByZXMvZHJhd2FibGUteGhkcGktdjQvYWJj
X3RhYl9pbmRpY2F0b3JfbXRybF9hbHBoYS45LnBuZ4lQTkcNChoKAAAADUlIRFIAAAAYAAAAGAgE
AAAASn71cwAAABhucE9sAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA2B0YZAAAADhucFRjAAICAiAA
AAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAGAAAAAAAAAAUAAAAAf8AAADYc65CAAAA
IUlEQVQ4y2NgGAWjYBQMYsD4n51EDQz/SdPARKqTaK8BAMObAg71NOuMAAAAAElFTkSuQmCCUEsD
BAAAAAAAACEIIQJD5UhtTwEAAE8BAAA6AAIAcmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY190ZXh0
X3NlbGVjdF9oYW5kbGVfbGVmdF9tdHJsLnBuZwAAiVBORw0KGgoAAAANSUhEUgAAAFgAAAAsCAYA
AADhJn/jAAABFklEQVR4AWIYbCChtlsB0L590AgIg3EURwISkIAEpCABCXWABCQgoRIqoRIqoffd
vsu6+e/Ka/IM/EKALuuwLstbuURNIQhQ5xfUYOUajQzrrGTlmo2Iu1lRgAXwy+sgCwL45eOVWwtc
cSPg7lYGWIO7aoEADt0C82oAOALc7dML8A2wdp0hdwvM6wHgE2AtsAdYOFqFBBhggAEGGGCAAQY4
AMxCz2uBrXltF/tw2g52M7QtvQK7DnBjz/txC6+H9k/zKEvW3DvwYqVGgd0kG7yLo/bpZYdjG/E0
e+TVoJ98JGZteuQIrv514fnfFY9CN4yCtbYtof9PvkS/YfvE+ATt/uH97IH93ofwsG4rfAP0tPYW
Jw4Ph37ReKzBfX8AAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAk/kYRNJAgAASQIAADwAAwByZXMv
ZHJhd2FibGUteGhkcGktdjQvYWJjX3RleHRfc2VsZWN0X2hhbmRsZV9taWRkbGVfbXRybC5wbmcA
AACJUE5HDQoaCgAAAA1JSERSAAAAKAAAADAIBgAAAGN7OJsAAAIQSURBVHgBYqAWSKjtZgc0Z89g
coVRAIaDwXrrWFVcbhs3sW3bTt8HVZy+iF3FThWXa3t3PCffv7bm4szzvPV8w3v+c3EeF+AfpO1B
1GnUI4AzmsL8OIk4BM1Owa8h8AjqIB3U45ibYT4cRBzSjTgOw+dG4D7UQnpRhwNOhnmxGzFIH8Ww
Fz4nAnegBtJPNdhp9zu3FVHIAMWwDV47AjeiGpKgamy2MsyD9YhALBLFRnisCFyNSojFqrA20Xdu
JUIQm4SwGp6BBC5DOcRmFVjRn7AhWIgAxCFBLMSQvgRmoQDisAJk9RY3HP8gLvlrGrqLS8V9iMvu
IbWrwMUIKAisx8Kuhs5/ECV+w9c28CBEmX3NcRn4pDDQNGWawOkoVxhYhukmcDPiCgPj2GAC70CU
umkCvysO/GoCyxUHlprAqOLAqAkMKg4MmMBCxYEFJvCN4sC3JvCS4sArzaN9TGFcDCtM4CQUKQws
xmQTmKr0e/gaqc0TzXaFgTs67l1+Kor7CW/HqXoB6hXEBbCkqzNJCh4qCHyK1O5OdmOQ42JcAcb3
djaeiTKIw8oxry+bhaHY4PCUE8MmePq7sHRqebRpoOu3Oci3MS4P8+BJZE84Ds8snhtDeIkJVq2B
07EUvyxaEK1Ehl2b/j14i5I+TkFxlOA9DsDvxL2SNEzBalzDVxQhhDCK8BXXsQ5TkD6Q5/oP8Qjd
fDOWuD4AAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAi3XkFM+AQAAPgEAADsAAgByZXMvZHJhd2Fi
bGUteGhkcGktdjQvYWJjX3RleHRfc2VsZWN0X2hhbmRsZV9yaWdodF9tdHJsLnBuZwAAiVBORw0K
GgoAAAANSUhEUgAAAFgAAAAsCAYAAADhJn/jAAABBUlEQVR4AWKgFUio7Qa0a2fFEYRQGIUjAQlI
aAktBQlIwEFLQEJLQAISkICE5D5nn+Wf4s4cqo6B74H9/UE1q1rZim+uhwBYULeyFQDWNq1iBYC1
DWsHWF8GWF8FWF8FWF8CWN8GsLYOMFOFe+ABsL4EsLYTYH0BYKYJ18AHwNoawOIABhhggAEGGGCA
AV6x7hG4c+GjBa6OgLNH4OwIePMIHHnV0CMPB8BFq8A0ET0DB2vyy0eLXBbFnVZ8BuBgDbZmWuT9
dV4wmCqG7hWZ093UHSpAHjpc9sdt+WlBgLxZXQw73Z3UBNBJtI2rX/e5QLc7zLMF2L8PJsk6/gHe
rdPKqy5gH3Xq0WgQZrjBAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQKLpQg0vQAAAL0AAAA+AAIA
cmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY190ZXh0ZmllbGRfYWN0aXZhdGVkX210cmxfYWxwaGEu
OS5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAAZAAAAFggEAAAAn7b/PQAAABhucE9sAAAAAAAAAAAA
AAAAAAAAAAAAAAD/AAAA2B0YZAAAADhucFRjAAICAiAAAAAoAAAAAAAAAAAAAAAAAAAAAAAACDAA
AAAAAAAAAAAAGQAAAAAAAAAOAAAAAAAAAAFchXebAAAAHElEQVQ4y2NgGAWjYBQMLsDI8J9ULUyk
20IfLQDQyAEHcKXqqAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECw6bFUrsAAAC7AAAAPAABAHJl
cy9kcmF3YWJsZS14aGRwaS12NC9hYmNfdGV4dGZpZWxkX2RlZmF1bHRfbXRybF9hbHBoYS45LnBu
ZwCJUE5HDQoaCgAAAA1JSERSAAAAGQAAABYIBAAAAJ+2/z0AAAAYbnBPbAAAAAAAAAAAAAAAAAIA
AAAAAAAA/wAAADQmhvsAAAA4bnBUYwACAgIgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAgwAAAAAAAA
AAAAABkAAAAAAAAADgAAAAAAAAABXIV3mwAAABpJREFUOMtjYBgFo2AUDC7AyPCfVC1Mg9UvAM+W
AQMlelcKAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQK4JyPUuAAAALgAAABFAAIAcmVzL2RyYXdh
YmxlLXhoZHBpLXY0L2FiY190ZXh0ZmllbGRfc2VhcmNoX2FjdGl2YXRlZF9tdHJsX2FscGhhLjku
cG5nAACJUE5HDQoaCgAAAA1JSERSAAAAGAAAAAYIBAAAAHOilpgAAAAYbnBPbAAAAAAAAAAAAAAA
AAAAAAAAAAAA/wAAANgdGGQAAAA4bnBUYwACAgIgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAIwAAAA
AAAAAAAAABgAAAAAAAAABAAAAAAAAAABJt5BrAAAABdJREFUGNNjYBj6gPH/P9I0sDAwkqYBAMJa
AgQjPTijAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJkHQsttgAAALYAAABDAAMAcmVzL2RyYXdh
YmxlLXhoZHBpLXY0L2FiY190ZXh0ZmllbGRfc2VhcmNoX2RlZmF1bHRfbXRybF9hbHBoYS45LnBu
ZwAAAIlQTkcNChoKAAAADUlIRFIAAAAYAAAABggEAAAAc6KWmAAAABhucE9sAAAAAAAAAAAAAAAA
AQAAAAAAAAD+AAAA+wQzbgAAADhucFRjAAICAiAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAAjAAAAAA
AAAAAAAAGAAAAAAAAAAEAAAAAAAAAAEm3kGsAAAAFUlEQVQY02NgGPqA8f8/UjVok6YBAPlNAyp2
9z07AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJIBJPMbwIAAG8CAAAoAAAAcmVzL2RyYXdhYmxl
LXhoZHBpLXY0L2ljX2NhbGxfYW5zd2VyLnBuZ4lQTkcNChoKAAAADUlIRFIAAAAwAAAAMAgEAAAA
/QsxDAAAAjZJREFUWMPtl01oE0EUx38xkYARFNEWFEFPQRTiQSjS2lYSFKEILbZ+nAQ9FcT0IIXe
BKmgSBEvgngVIQch4CX0IIqKh5ys6EUteJL6hSRRmpj10MfrbLIJTXYGPfTNYXbfzv5/O29m3szC
uv0/lmIBr6n8JEePHUAhQH6lPLMDeNUS4JHqXnaDXi22aXXUBuCj1FNEtFwW36DNHuwznj6V+giR
8GNwTOJd9OG/ivdAeMBW/uDhUWWT4X0kgMnwIfrBAgAxBoznT6QeCg9A5/uI4atLvd/GSjgt4fig
njPUxFewAdjCL5E7LMCq3FcZtrOacyJ4H5gw5MdtJbxRkSxxwYU8xHXeey7kAa65lYcdlFzKA8wp
4KKbnW2X9uGhq81zWvsw4QawkTcCWKLXDWKYuiDyYXeCaKB3kQT9ACTZbCcPNVqM5zoSl9yEaTdf
BFBjtE27s7yjwkuuc5xEZ4h+KoKoMNaiTda38pd5wSyZFoEPsBFNebXAQGVbnKPesnetiPOyU3t4
3GyYUdk2R7XHaw/UOZb1tbyxLlbly5xkjDu8NgDlTsbiBGV9cYlTTfJpbbmdcfV3ZH18Mr7uATN6
XSHT0LYrAPQwHxDpZvmuARDlqjEaKyVo8nYNADhI0QcocY8+mwCIcYXvDf14z23SeuAMCQDYxi1+
N41HlSJ3jdkVet+7wbc2C82zkQ4TTBo511/q9rLuHqaZ17S4mo3EIpYwcQ6RIkmSODv5zJTvR2bd
/qn9BXjOgikhYqrsAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJIBJPMbwIAAG8CAAAsAAMAcmVz
L2RyYXdhYmxlLXhoZHBpLXY0L2ljX2NhbGxfYW5zd2VyX2xvdy5wbmcAAACJUE5HDQoaCgAAAA1J
SERSAAAAMAAAADAIBAAAAP0LMQwAAAI2SURBVFjD7ZdNaBNBFMd/MZGAERTRFhRBT0EU4kEo0tpW
EhShCC22fpwEPRXE9CCF3gSpoEgRL4J4FSEHIeAl9CCKioecrOhFLXiS+oUkUZqY9dDH62yyCU12
Bj30zWF2387+fztvZt7Mwrr9P5ZiAa+p/CRHjx1AIUB+pTyzA3jVEuCR6l52g14ttml11Abgo9RT
RLRcFt+gzR7sM54+lfoIkfBjcEziXfThv4r3QHjAVv7g4VFlk+F9JIDJ8CH6wQIAMQaM50+kHgoP
QOf7iOGrS73fxko4LeH4oJ4z1MRXsAHYwi+ROyzAqtxXGbazmnMieB+YMOTHbSW8UZEsccGFPMR1
3nsu5AGuuZWHHZRcygPMKeCim51tl/bhoavNc1r7MOEGsJE3Alii1w1imLog8mF3gmigd5EE/QAk
2WwnDzVajOc6EpfchGk3XwRQY7RNu7O8o8JLrnOcRGeIfiqCqDDWok3Wt/KXecEsmRaBD7ARTXm1
wEBlW5yj3rJ3rYjzslN7eNxsmFHZNke1x2sP1DmW9bW8sS5W5cucZIw7vDYA5U7G4gRlfXGJU03y
aW25nXH1d2R9fDK+7gEzel0h09C2KwD0MB8Q6Wb5rgEQ5aoxGislaPJ2DQA4SNEHKHGPPpsAiHGF
7w39eM9t0nrgDAkA2MYtfjeNR5Uid43ZFXrfu8G3NgvNs5EOE0waOddf6vay7h6mmde0uJqNxCKW
MHEOkSJJkjg7+cyU70dm3f6p/QV4zoIpIWKq7AAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECFZMl
5CIBAAAiAQAALgABAHJlcy9kcmF3YWJsZS14aGRwaS12NC9pY19jYWxsX2Fuc3dlcl92aWRlby5w
bmcAiVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAQAAAD9CzEMAAAA6UlEQVRYw2NgGAWjYBSMglFA
OWDEEHFl8GXgJdO0zwybGXbjVxLF8J9CGIXfgt0UW4DmAyY0CwQpDnRB/BZQG9Sz4JRyJNGo/diM
Z2hAFzoDD0tSAUzfGSTjsZhDPQvqsZtDLQvqcZlDHQvqkZItDSyoR8kXVLfgF2rGo34+YKVvRhu1
YFha8IzhDW0teM7gjGwFLYLoErIVtIkDJCtoFclwK2iXiqBW4K4y51PFir24S1Ny4RkU8/SYMApd
SgGqCZfQLbhBsQUETFBkuE1RAN1mUCTU+GVi0GEQItP17xiuMPwb7VEMNgAApWT2BdaiR6sAAAAA
SUVORK5CYIJQSwMEAAAAAAAAIQghAhWTJeQiAQAAIgEAADIAAgByZXMvZHJhd2FibGUteGhkcGkt
djQvaWNfY2FsbF9hbnN3ZXJfdmlkZW9fbG93LnBuZwAAiVBORw0KGgoAAAANSUhEUgAAADAAAAAw
CAQAAAD9CzEMAAAA6UlEQVRYw2NgGAWjYBSMglFAOWDEEHFl8GXgJdO0zwybGXbjVxLF8J9CGIXf
gt0UW4DmAyY0CwQpDnRB/BZQG9Sz4JRyJNGo/diMZ2hAFzoDD0tSAUzfGSTjsZhDPQvqsZtDLQvq
cZlDHQvqkZItDSyoR8kXVLfgF2rGo34+YKVvRhu1YFha8IzhDW0teM7gjGwFLYLoErIVtIkDJCto
FclwK2iXiqBW4K4y51PFir24S1Ny4RkU8/SYMApdSgGqCZfQLbhBsQUETFBkuE1RAN1mUCTU+GVi
0GEQItP17xiuMPwb7VEMNgAApWT2BdaiR6sAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAkZwWuzE
AQAAxAEAACkAAwByZXMvZHJhd2FibGUteGhkcGktdjQvaWNfY2FsbF9kZWNsaW5lLnBuZwAAAIlQ
TkcNChoKAAAADUlIRFIAAAAwAAAAMAgEAAAA/QsxDAAAAYtJREFUWMPtlL9LQlEYhp+svJUNpkIS
LY6ha7o01J/Q1j8gCBUEQS6JW5BD0WZLLdVQNpZTRUM/IBfJlqgc+oVWEiIYLjUo1+Ptdr23+Txn
ufec93zv953vngsSiUQikUBHW8UwIYL48OHBiRN4p0KBB+7JcEHxv9adTLBGnu8245YEYyYSbcHL
Io9tQ4sjzwIec0c0SIwwdmGmQo4MN1R5pQYoeOnFzygBHILuiyRLvBllbidORZNb2rDWHY26TIzu
v8QhcjrF7xsarOvsuCbYFNjUpyhn+NW3Z3YtdS3Ni/oc4Jxo67KDPSGDAtMoTFqqIIzCLEUhSkrs
z4qwsIELwLIBgItNIdJq84ia30yWGUqNe2CFeoQSETKaOQDcZFXfI/qwEeFDLdWIZENVJY6CwoEa
J4tbFHoEi1OuhEKXDQ3mBOUdJ0L4X9dOtGiOSwYMDXo41NmV1b/VWosy83SZOP8pnsyE11psM2S6
xf0kqLUPX7dI8ckx45b/viPskGertbUSiUQikdT5ARbS/ngVcTcjAAAAAElFTkSuQmCCUEsDBAAA
AAAAACEIIQJGcFrsxAEAAMQBAAAtAAEAcmVzL2RyYXdhYmxlLXhoZHBpLXY0L2ljX2NhbGxfZGVj
bGluZV9sb3cucG5nAIlQTkcNChoKAAAADUlIRFIAAAAwAAAAMAgEAAAA/QsxDAAAAYtJREFUWMPt
lL9LQlEYhp+svJUNpkISLY6ha7o01J/Q1j8gCBUEQS6JW5BD0WZLLdVQNpZTRUM/IBfJlqgc+oVW
EiIYLjUo1+Ptdr23+Txnufec93zv953vngsSiUQikUBHW8UwIYL48OHBiRN4p0KBB+7JcEHxv9ad
TLBGnu8245YEYyYSbcHLIo9tQ4sjzwIec0c0SIwwdmGmQo4MN1R5pQYoeOnFzygBHILuiyRLvBll
bidORZNb2rDWHY26TIzuv8QhcjrF7xsarOvsuCbYFNjUpyhn+NW3Z3YtdS3Ni/oc4Jxo67KDPSGD
AtMoTFqqIIzCLEUhSkrsz4qwsIELwLIBgItNIdJq84ia30yWGUqNe2CFeoQSETKaOQDcZFXfI/qw
EeFDLdWIZENVJY6CwoEaJ4tbFHoEi1OuhEKXDQ3mBOUdJ0L4X9dOtGiOSwYMDXo41NmV1b/VWosy
83SZOP8pnsyE11psM2S6xf0kqLUPX7dI8ckx45b/viPskGertbUSiUQikdT5ARbS/ngVcTcjAAAA
AElFTkSuQmCCUEsDBAAAAAAAACEIIQJ1MtA63QAAAN0AAAA2AAAAcmVzL2RyYXdhYmxlLXhoZHBp
LXY0L25vdGlmaWNhdGlvbl9iZ19sb3dfbm9ybWFsLjkucG5niVBORw0KGgoAAAANSUhEUgAAABAA
AAAQCAAAAAA6mKC9AAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAAVG5wVGMA
AgIJIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAgAAAAMAAAACAAAAAwAAAABAAAAAQAA
AAH/Dw8P/w8PD/8PDw//Dw8P/w8PD/8PDw/mLEhfAAAAIElEQVQY02OUZmFABn9YvjOhCPxj+fsX
RYABVX6YCQAA6pYFMHjU8awAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAo4KkMj8AAAA/AAAADcA
AgByZXMvZHJhd2FibGUteGhkcGktdjQvbm90aWZpY2F0aW9uX2JnX2xvd19wcmVzc2VkLjkucG5n
AACJUE5HDQoaCgAAAA1JSERSAAAAEAAAABAIAgAAAJCRaDYAAAAYbnBPbAAAAAAAAAAAAAAAAAAA
AAAAAAAA/wAAANgdGGQAAABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAA
CAAAAAwAAAAIAAAADAAAAAEAAAABAAAAAf8dUWX/HVFl/x1RZf8dUWX/HVFl/x1RZYSIK/0AAAA/
SURBVCjP7cuxDcAwDANBSuAyHio7ZHu7EMWMEAdI6av/Y1w3yYjAG9tVxTlXZm70sNHdlCQJ2xIf
neEMfw0PFvUU7vg2USgAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAhrzRJndAAAA3QAAADIAAABy
ZXMvZHJhd2FibGUteGhkcGktdjQvbm90aWZpY2F0aW9uX2JnX25vcm1hbC45LnBuZ4lQTkcNChoK
AAAADUlIRFIAAAAQAAAAEAgAAAAAOpigvQAAABhucE9sAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA
2B0YZAAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAIAAAADAAAAAgA
AAAMAAAAAQAAAAEAAAAB/xgYGP8YGBj/GBgY/xgYGP8YGBj/GBgYsN0YTAAAACBJREFUGNNjVGFh
QAZ/WL4zoQj8Y/n7F0WAAVV+mAkAAPQdBTnDdC3vAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJY
xZrC9wAAAPcAAAA6AAMAcmVzL2RyYXdhYmxlLXhoZHBpLXY0L25vdGlmaWNhdGlvbl9iZ19ub3Jt
YWxfcHJlc3NlZC45LnBuZwAAAIlQTkcNChoKAAAADUlIRFIAAAAQAAAAEAgCAAAAkJFoNgAAABhu
cE9sAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA2B0YZAAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAA
AAAAAAAAAAAAADAAAAAAAAAIAAAADAAAAAgAAAAMAAAAAQAAAAEAAAAB/yZnf/8mZ3//Jmd//yZn
f/8mZ3//Jmd/ed1NMAAAADpJREFUKM/ty7ENACAIBEAgv5CrOYYTU/DgCGpiyfWnYy4AqionVRUR
cHczkzuZCZIk5ZrJow4dfoUNXQ0TJzkHknYAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAgFlVwSK
AAAAigAAADsAAAByZXMvZHJhd2FibGUteGhkcGktdjQvbm90aWZ5X3BhbmVsX25vdGlmaWNhdGlv
bl9pY29uX2JnLnBuZ4lQTkcNChoKAAAADUlIRFIAAAAeAAAAHggCAAAAtFI59QAAAFFJREFUSMdj
EMQNJIysKZFloJG5QJKBRuZiN5oq5mIxmlrmohtNRXNRjKauuQijqW4u1GhamAsymkbm4kzXo7lx
NDeO5sbR3DiaG0dz48jNjQD599AhCgiPRAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC9DyFPKEB
AAChAQAAPAAAAHJlcy9kcmF3YWJsZS1sZHJ0bC14aGRwaS12MTcvYWJjX3NwaW5uZXJfbXRybF9h
bV9hbHBoYS45LnBuZ4lQTkcNChoKAAAADUlIRFIAAAAkAAAAMAgEAAAA004QngAAABhucE9sEQAA
ABMAAAANAAAAFgAAAAAAAAD/AAAAg1Pu1AAAAFBucFRjAAIEBiAAAAAoAAAAAAAAIAAAAAAAAAAA
AAAAADgAAAAAAAAgAAAAJAAAAAAAAAAEAAAALAAAADAAAAAAAAAAAAAAAAEAAAAAAAAAAAAAAAC4
NSeYAAAA6ElEQVRIx+2UvQ3CMBBGv8OIioqCho4FMgIzMANzwCZILAAzMAILMABNJERHbB5FpEiI
4BiQKJDfdf55Pt/JljKZTOYrrG0QS9zMbzLCNNJVXVmhgcpITvQklkDJORIlsKpXx4/bAIFXBGDT
WU1MwrEDKm4tcQW2uISm0JMYsgeqp2wqYM8w4VqNaswB8A8aDxwYJ2okCScx5fig8sCRaT2bDE6i
4NSUPQAnijc1kkRfYsYFCATgwqwefRv6EnM8gUDF/ENNo1oAsIhpOv3mcbZmImyNM//Vg6xbndzw
qMpSv5ZMJpP5G+4nXQ6FDEVJsQAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECRTFgIh4BAAAeAQAA
OQAAAHJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX2FiX3NoYXJlX3BhY2tfbXRybF9hbHBoYS45
LnBuZ4lQTkcNChoKAAAADUlIRFIAAAAwAAAAMAgEAAAA/QsxDAAAABhucE9sAAAAAAAAAAAAAAAA
AAAAAAAAAABAAAAAnQxGqAAAAHRucFRjAAQCDyAAAAAwAAAAAAAAAAAAAAAAAAAAAAAAADgAAAAA
AAAMAAAADQAAACMAAAAkAAAAFwAAABgAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAAAAAAAAQAA
AAAAAAABAAAAAQAAAAEAAAABAAAAAQAAAAE+ZyIYAAAAQUlEQVRYw+3YUQkAIBADUM8w5rj+EUxj
B2Eg8lbgjX2uRo9wskDPdH8AAAAAfAksEwEAgAeAbSIAAAAA3KTSd84BGaECXWlMtjkAAAAASUVO
RK5CYIJQSwMEAAAAAAAAIQghAtBa1TMzAQAAMwEAADcAAQByZXMvZHJhd2FibGUteHhoZHBpLXY0
L2FiY19idG5fY2hlY2tfdG9fb25fbXRybF8wMDAucG5nAIlQTkcNChoKAAAADUlIRFIAAABgAAAA
YAgEAAAASJG/swAAAPpJREFUeNrt2jEOgkAQQNG/2OyGTo1n8HScE49DA9EENTEWFCY2OxDNf9Oz
+6FkkCRJkiRpHYn0y89vANiRKQGT2b1PCZKAPR09A2PADPR07IEU9fbPXHgEz4VzxFdoSBxf178x
h11+5vZKOJJoagdAx4Nr7Pt/n9DFfIOeO3N4wMydnobqMsPimImx8kyLpw9kqiuMi+sfKJXnsEgY
KdEBmdryugEttbUGGGCAAQYYYIABBhhggAEGGGCAAQYYYIABBhhggAEGGGCAAf/8m/VEoa04hdOH
gOBVg6nefFo1cNlj63UbF562XTlz6W/LtUsXXyVJkiRJ+u4JlhNeWfEd3bsAAAAASUVORK5CYIJQ
SwMEAAAAAAAAIQghAuEALcBRAgAAUQIAADcAAAByZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19i
dG5fY2hlY2tfdG9fb25fbXRybF8wMTUucG5niVBORw0KGgoAAAANSUhEUgAAAGAAAABgCAQAAABI
kb+zAAACGElEQVR4AezRMarDQAyGwdl1s2lDDpHT+Zzr47gxJODoXcIyPNB8vQr9SimllFJKKaWU
ezTtP9/vYDE8EhoW0CVpeFpNuyOh3bR6omV9/20TyW3eGSt0zcsmfJ0iqdNX2Lw0/fr/r8JHJPcR
1pwNpp9TJHf6mbrLDbu4qd1wuYdD3NTxx57dpCoPQ3EYf9o4eXfSSneovFXvIq2guAM34DW90MF/
EspBCh4PdOLHLE/yS00t/z4WsAZkcuSAHHsFXow8eCokWMCTkQsdO0GKEqDZv7IF4DB9z5ECfhkZ
aIANNfCjhG8PEJ6zDm0ViYpDHELCQ4J4AcKj25cohEo8uoU8BtnEJR7NfoDL6Bwezb5HQCYvxNOj
4XutQF6A5+R5mMvTrD4YeS3F8+kA4WFHx2UKsfAM83g8AvI06z0AW65ahTk8NzoDz+cCNPwjULMB
GoaJyRyeC62Bx4HQfyBR6Q+vcwlJB+bWwOMS0CsAEoK0AI8ToVoJjbbz+3i8NrFQQA20SngLj+dl
9ATUCBIdN0ZeFh7ngHlIWgUDj3OAAanhzt342fINsCEZeLwDDEiVXm08/gElJL3beDwDDEg2Hv8A
A5KNxzfAgGTj8Q0wICWSjcc5wIBU4okQoIQ9ew0/ToASyk8RAoqEvD7kWwPWgG8L+GvXDgkAAAAY
BvVvffsGM5CDthrIHnW3EZ76cib99e1SfAUAAIAzsMH7b7rI5iQAAAAASUVORK5CYIJQSwMEAAAA
AAAAIQghAoFZJPfYAwAA2AMAADcAAgByZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19idG5fcmFk
aW9fdG9fb25fbXRybF8wMDAucG5nAACJUE5HDQoaCgAAAA1JSERSAAAAYAAAAGAIBAAAAEiRv7MA
AAOfSURBVHgB7NUxaxZLFMbx387sq0lhAooiIsFGEWyCWFvYiBFD7mcQ2/TJZxC1ESR1GgW10nRa
xUKwEESrIELAJiRNSIhvdufCZVgWRbn3um9Msf8lJGx2zjnPmWfO6Onp6enp6enp6enp6YhCEBS/
/N+hJRrQEB0xZty4MUdEGgaiQ0cQwVEXzViwbNWaTTt2bFqzatmCGRcdBVE4TKYBrlj0wqb0i2fT
C4uuAIfBUBFEs1Zs5CKH9lXqf54k5b8q+4b5iw0rZuW1f7r8wg2rTelDtfSLpzZsZKy6ofhzEgoF
Lnmcy6lUucRK9aOM5n372+SxSznWARPAHV/b5ah8a5U8tGfXrj3D1ttvqrZkX90B4aDLP2Ypl9mY
Ixf40XOL5kybMmnSlGlzFj33MQvMRmtWLzl2kBIiznglqWXb5IK+uO+WCT9jwi33fWmvybZ65Qzi
QXV/yjvJviQ1v9fNOwcoRaFxdqEQRCXgnHnr0ncR3plCOIjyT3or+dZKvu2uEyAqFX5GoRTBCXdt
yxJytLdOjlpCIZjwWtv5yXvXQPiXyfN3rnkvaZ+G1yZGe7lFLH239U+cQvyPaQsRpzz5LtoS4ijt
c1tOmKfOQyVK/4O88qE8lXLk2wij6v4FG83kqSSPBMTfihk8kpqYtQ0XEEfh/ihveE741ADFb8Zl
4GmOmE0pdn8SAq5L9tU52QenETqJfNqHHLW2L7mOoGOCN02SyrarKHVBiau2VU1z3gjd939Wao3O
e536NOJea6QmswhdCghW1Ln/tXXHFQpdUSgct67Oe1BbEYQu+3PZlqTKx2wehS4pMJ+jV5Itl7vb
4wEWJcPcnc/OInRu0rM+q1U50yIGXfVmzEvJMP88QOx8ByIetLK8NEYXWSLO28rTp7brJkpdU+Km
3Zwl2XK+GxMFzLTc+ckECl1TYMKn1kmbQegm8ILafg77DKVRUOKZlDPVFrpr1LJ81efDFYyCkIdF
ytmWuwu82rpk5kYqYK51Wa52lWdgrREwNI3CKCgwbdgIWDPQCWM2GwF7pkYqYMpeI2DTmE4YtyPl
Z9ekUTJpt8m1Y7wX8Kct1B/iAx+jf/0wRvuL7O927dgGgCiEYeh8LHzznfR7OiQ3zwvQksT1K+GZ
q99pgaaPlEJ9Uat876Ziq68Wlbt9vW7gSCYmI187sxq6S9WA7FHqNoSnUjkj/XXaJfH1XD2eVT2e
a/WY/L3khk2/P/zzAQAAAOAHmDz7Xj2vK3UAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAghNQbO4
BAAAuAQAADcAAwByZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19idG5fcmFkaW9fdG9fb25fbXRy
bF8wMTUucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAAGAAAABgCAQAAABIkb+zAAAEf0lEQVR4AezB
MQEAAAjAoGn/0JbwBOIJAAAw7TFbF8FtLWkUgL++V3Yshxmd1bwhr4Z5FwZnvxp4uH783v4xM2zD
yTawGmbGTXCYZ8IsX/VQV9d0qVylSslOzi/pSmo65+/ToBL6KLsNURsqfg0b0dY2Ylgtw5DabYdK
DWZ5vy0es8u3nXLGFVecccq37fKYLd5vFqhVt5NpgI963GFnRFPHGYc97qOAW28odfqccNQ/EsmO
SY3ufyOK6VtjUifV+IejJnLbW0w/2OzbmXonkZ4qujpZxrdtFm6dhCBg3P5Ep9EkiulbGalGt6gb
7Tee+pphVOBufy7oNG4Uub7mqquuFfNyQ1NI/rO7QTXT9Od6N9kmEU7frvql/R6wxbhl5phjmXFb
PGC/X7qa2iRBqc275s6khBqrfCXZJYp5uZ70rI3apkLbRs86+f9tkq2+YhXqmcr+Wj8WTYpifv7a
fcYALbUqOzsIKrUWYMx9fi2WPfixtahmgv5SPxDdkAd33hPmJ+otwVQIWknGfE84L0lIvf3A0umW
EFTm+Wrh/OhHPgeq/gbP9T7nR2KxGr5q3vQebjXelfOmEe2ymJT3/hG0sNiu1EuaS++ink773CnR
T7vOiwJabgYtBC+mXSlJcCeq6cr+e/1DV5Oz/zKCml6T9PVfLeBlMffZ9Q/vRT0d7q8dyPmfFO1R
C4ISlVb+NqytbThTb/WICILanqLfA+rBr4QKG0WTuilfP7VUUClRgzUmvOKb/uCyy/7gm14xYU2q
UaISLPXT1GvXpGjjdNio8p08SOOCT6LVk03GPOG42BuOe8JYrleuhU+6oMnJ+Y5q8PmfEOWt01M9
uQzgS36dNsWmuE43aeP9tS9BKUGNp+QtVTTBIEVUKkd1NYnOr80v8yhg1FuZfOyNLOIto5StBfP9
OkludB1VDU5AjQ87K2rS+74eApVRB7OHp4y0hg4aVfUk4D55BGd9GLWBYAiPizqJwHEry+Wrwpt5
P5868vnhTcoeBCsdTwnoiB7HkAEgYMQRUSe9n0Vd0veFtAX2EanmF0oJajwrj+KIEYTBGOgOZ/Pl
+Yr1aBWH0Zjfp6nvI1LN3xsrDsEW1ruSL9hn3TEYE1XYIppM719pIxQCn0hZ6zNS7ScKggFtv5JH
sgXVYCz0WPJmI9qHViFvpROpvM9Ia+mElQXFFvaJmlT+GIJBoLgzPlgMWmNH//4v14EdqItkPFjc
cweEyrfFfCht7pnYV/IFr+9ITn+lx6yb8zjRt1UGgiGnsoCOcYRi2G+KNyUg+mZBMWBcJws4ZchA
MOJMFnDNslKAYX9IpX1HpvgHw6UAy1zLpWeMGAjaruRhr5rTU3pZvMm4rK3EHP9q14wRAIJiKFZ/
c7R/YUdjNQEAkCVZuwC0fWn6ah2lJ0A/Qr7E/GfUHxndStjM4e20Aw06UjrUY2uVKlIkF1v8atHl
Lr9eN+DgIyZDPj5mNejmVQNlD163UXjilTOlP167VHw9qR7nTfU4f6YeK39P54Zio/Ziny8iIiIi
ItICPjW4CjVVA60AAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAtLyrKufCQAAnwkAADwAAgByZXMv
ZHJhd2FibGUteHhoZHBpLXY0L2FiY19idG5fc3dpdGNoX3RvX29uX210cmxfMDAwMDEuOS5wbmcA
AIlQTkcNChoKAAAADUlIRFIAAABRAAAAUQgEAAAAAIaCvQAAABhucE9sCwAAAAsAAAALAAAACwAA
AGmRCEL/AAAAA07WZQAAABBucExiCwAAAAsAAAALAAAACwAAAOFoW4YAAABkbnBUYwAEBAkgAAAA
MAAAAAAAAAsAAAALAAAACwAAAAtAAAAAAAAAAAAAAAIAAABPAAAAUQAAAAAAAAACAAAATwAAAFEA
AAAAAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAAAAAACjFDtuAAAItklEQVRo3u2aXWxUxxXH
/2dm9u5619imjqHBiBoR0wBxaLHUBhq1VlUl0CCFCvmhihJZkZJKKVHTpkr61CLUNyK1JaqUNB9C
tCWqjCigUhSlAYtSSFOsBBHsKg4CHH+AA/hrd33v3Dtz+rDXxuBd7xrvLlLFXO3a2r2e+fl/zplz
Zu4Ad9vddrf9/zQqaT98pxEJDIBAADj8OR2Pw2946t6yItL09xZqERBA1VRvYwzAdtgODtH49lWl
eeFRs9ggamm7D5P1Trk9co1P2k4Lvn1MmrNpKWPcVtmFcxYBALx+z/eWV9THlogqikEhYNeOuQMT
/f+48KOrAAC1RqxGuwmNznMzO83x3yEA1CoTYrcLPBv/6aol31cPy2WopWpyJrtjAKx5FNdMb3Bi
4O+/6f5DGmiLpWy7mdKTSxH7BIKEaosBwMVVwy+4ndrXPHUZ7WutPa21r820z323c/iFi6sAoC0G
BRn2VQJAAdnqQAIX143vcodCAKuNNtpoq+00LDvtc9as2R0a33VxHRD2IYoLGerXHNkUBfYsSu/U
V3zWrIOboGa7rA40+6yvpHfuWQRsijZHiqslQUCscSCBgS1ut2bNWt9kykIuo7VmzW73wBYAco0D
AVEcRAEB8XwUtCcx8ko42FzxbmAazdqOvLInAXo+mum7KB7YFgOOLU0eCT2P53UZbTUnjxxbCrTF
5u+VBAHREgM+aHQ7NWu/YO+b3TN9zW7nB41AS2x+5iYQxKYocL5x4hPNOigC3uQVaJ745HwjsCl6
+zoSCHKNA3q/Pv2x5nkbeKbBOf3x+/WgNU4Y3TmDYZZM0ixW40z8obfVWgTzdessIwdq7UNvn4mv
RrOYylwFIxIAtNIG0W6X7XAegYEqQa2qYJxHlu1otxtEK+VOxyJHKUoQkK96FzYntrEpuoJTo7NJ
bPts86teGNlZ87bM5YctIs2/WrR+Ly0qRT6d5u9qQfOK9pOpBrrIhRuaAFCD6gi2vCQbYUsGmBnL
ysYtL3UEDSqXP+bwxe1yt9fdHH+KuaSAAEDM8ae6m3d722WhvkiZpNciFz8tamFKjwgjahc/3SLD
ZEgFTdetDnC4yR0qQrorMCW6Q4ebgFYn2zSe1dBdgFy3UdbBliyWb2awsm7dRsiugsKFQaBzfF+i
6glwWQAzFFz1xH2Jc5mlLudVsVnAvvVA5EGmkvvhjZChyINvPQDbLPKrSECThFm5cT6L89toDFq5
EaZJzgyYmYiUIlB8PaG8iIT4+szYecOlhdrNc0tVQ/m3l1TDc0vbTQvNbmgCN0n4W5eLmiJuSRW4
Rhc1W5fDb5K4JV3MMHQtgRfWi2ous4YMUb2wHlxbwLwogKolIgJbZkYrIlVLshHNUDFJgKwCSlw+
ZCknMuMm86tYSYCKljmew5hW0cz4eRCHAJBzBwjDcYfyVzouASa4M7vaJsiMnwfRI8D3AKLy4lE4
rpcfMcqQbpIBUeYEKBhuEjLKeRHHGerqkPFJlFlFYfyrQ1DjeRF5lCEvXbbj5fdEO37pMuQoz16M
MdBl4eztDUZQ5jICCEb29sLpsreOPMOcffZ++W6/11fmaAHB7Xu3/37ZZ/NX3Sy5mq6c5jKXEYyh
09UkGZy/6raDwag82lGG5ektS9WjHaNyMJhZG1CWnZYo4tGFg39dsKpsSjJhvPveH3jDSMNDkE9F
hq2El+w5QMRlChhmop4DXrISsMg/L4LBNQb+/uPedVEWSGZB3vX9x+HXmJmemB3R9Pn10V1dnx8R
lOPZXpFTs6DPj+zqqo/2+TCFIVoEMU3m4D5vRMiSz44spDdycB+ZmEZQmKEBC3Peq1Evd144QKVf
qjLRhQMvd9ao8x5Mtlo/eya2CMbcmNr2ZqqXSltOMIlU77Y3Y2rMRZB9MSKyJiMLk/QrzLH+QzvZ
J1sySCbL/qGdx/orTNKHQdaRcqoI7bt16sn3ut8RkksDyWyF7H7nyffqlO9C51JR5p7vNbGKi6Nn
Hm+qXmZt8YsztkoOntq63Z1wvXQaOls0z44IUEAUGQh6Tj+6PlFnbXHrcLZKDn/6zIv/vEqBm4KX
S8PZEBkAAqpyzqZSp7/1zYpaa4qnJBslx87/8md/ulRlUilM5NZwdhUBgDwsiJ64fuU/3/5aYhGb
ojw9YFglh7tf/Pkbny3AeBIuPAS5vV3m7Q4aldEPh//7r++sqPoKY957PQxIMXjy2V/85VIlksmw
cJhl70Pm6Y4BQHOlcza5/9h3o3VrBbG9bUwGC8F07o+P/Prf1yo5mcQEXPi5jVygimBAs6OumddO
NfY0fDW2kMgGNFeTMxspicYv7t/x6J9HtGMmUoUAFqKGgEQUUcSjcVWR8r+x+I22FY/Fv2RgDRX6
JJnZCimRvn7+8DO7P7ySiAQTXhppeMiR9Oai4mS2sWDDPirVBfe14/KjxcGC+licKTN9IPPLrWfG
wAwmAoiUcId7Dr3+2x/u6/cqOTVhUkjDnS2O56Ji5h6FCBzEUIFYTWzEB/1k5Zb1TY9VNZIUCBcc
lierPSKCyOwJW7AZ6zl7+MCp330KromMuHAxARcaPoJC1pmF+hNBIoIIYnAQq4xJZ1RDLkj8ePnj
Dy9bG7/XqZaVKpJ5+MSZDOqbpB5ND/aeOXji9xfGUzDVjtFJFy40XPj5fXCuiJlzEhIROIgiCqcy
6kmfAATgr395c31j3ZK6WMJxpDKB1m5q4IueL/7W/9FlEBQQ4ahJetDw4EEjZ8kwP8TMvRIKEUTg
wIED5ah4RImrFgFM6PgcPkWUkFD3iMCmfR0ggIaGhg8fAcxcNhLmOr8JEARUCKoQgYRyVEJEhJKA
IgAIGAiMb1NWBwhg4CMI4TJ19Zw2qW/v/KKAgIQKXxIq/GT60TsDi0l1g/BlYUt9fvFmzEnUG+/T
ES1sCDWJZst3CnT6X4rwcNrkGRGaljgzUDxlWJ7PQPPdMcJNgNMhy79pfrfdbSVr/wPKCjjTmYV3
aAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECcLmB2hILAAASCwAAPAADAHJlcy9kcmF3YWJsZS14
eGhkcGktdjQvYWJjX2J0bl9zd2l0Y2hfdG9fb25fbXRybF8wMDAxMi45LnBuZwAAAIlQTkcNChoK
AAAADUlIRFIAAABRAAAAUQgEAAAAAIaCvQAAABhucE9sCwAAAAsAAAALAAAACwAAAGmRCEL/AAAA
A07WZQAAABBucExiCwAAAAsAAAALAAAACwAAAOFoW4YAAABkbnBUYwAEBAkgAAAAMAAAAAAAAAsA
AAALAAAACwAAAAtAAAAAAAAAAAAAAAIAAABPAAAAUQAAAAAAAAACAAAATwAAAFEAAAAAAAAAAAAA
AAAAAAAAAAAAAQAAAAAAAAAAAAAAAQAAAACedBLeAAAKKUlEQVRo3u2ba2xcRxXH/2dm7r5sxw/F
RN5YoXFTAjF1KiVtqkoIRaTQREKiz6QVLaAKCVTxAT6AhJBKK/hARVuh8gFBixqB3BJE0qCIKlVF
C30obe0SkroKadomcRNwaNaPeF9z78zhw527u7Z3N2uvve0H7ki71u5q72/P/8yZM2eOgf9fzV/E
H3tE8fG3ompaBkIoBFU8csVj9P5HITRR9EfpmUuIZbD5z61BnAdHc0DLFy94XBKoWiIcIJzNRFXM
SjDr3rPzHGElrEgRCLlH99xPPaKHkqIHmgAgxhnkbYYz9gMGgwFUPi8SsmFEKtspghOgtOgW68Sz
BhrBvNsSFGI75Vk7ac9bMOwc0EVgNoRY4XvCSUtbZEGMWRgEMFd0/Wqgf21Hn9cuEhRjbQv+7KV/
f3DuW+9h6rSEghwUCTtqwE52uxjfbACxQl43Br114tk8sCH56PqtO9o+5w1QD3VRW6UrcpanOOO/
l31p5Pnvvn8qD+xMnrVjvrMkNy45obFPCGdDAm2Jj+ahX/j0Vdu77/KuQ4yi+zAsGAxyn4R7R/uv
Tw6/8wJObI9tSY4Wwe6T0UTiZhGFs6AAIAflmEXu8Ge33N22R61z320rvLRyRnN5/SIEZ7NPj/4O
b30pNSjGDIyTuwy61KgJgoCEgod4OrVtFeSdayYfKIz7rFn72mpuaFjta/a5MD75wJ1roLatSqcQ
hwcFGSrTDKKAgIKHRG/7mjaosZ25UR3imQbxomG0r1lzbnTsJqg1bb3tSMCDggidYul4AgpxJAbb
kextn3hQFzVrs2i8MqbVrAsTD/a2IznYjgTiDnIJmGWJ40hs7EDs/vTUfncbbmoYzZqn9t+fRmxj
h4NcgtxhcAl9MLGxA7HH1mdf8lkHDXtffc8MfM6+9Nh6Bxn6JC0OMgT04CE+2I744fW5oz6HvrRM
w/c5d/Tw+vD74cFzkFUuWSMQhUKLXu+0+VnPLX+Ib2XTfG45J5QZ2dd3Xdeh4VyvynFFdtkgYjhE
Wm7GrfJ7v03u4GBZAUPIwPvk5qvsM8R5usS1A7isakMRTpZN3t+Lf/ph5zc5gGwmdtV0JxP7zDXm
23/dFD9XXrPpcqtLhciD3ljhjRs370esueBa52Iw9NGbr3t+MDHmw5bWG65nRSpFRCno9u5v7JVr
G1oml2pHkLd66Nz+Y8UsFsLV2gG6JGCbd0X2ofu8IbYrBhhmWtYbeui+49ltXpSm1EeMZMaQulj8
6dCqe7kF22zmVfceG7pYHFIVGX0dKzpIT50yg/fIPtgV32kLWNk3eM8p46lqgNUQCRhSo/lfb+za
w1hRkSvS6q49v9w4mq+wYw1EcpNeGALt2K7WtsCGzo5q7a7tIBN6I8+1pFhoQ9AY0Na7G60s93Dv
brSNVcyGaojRyyItYJ8aiG9jalnFRzDFtz01AJsWpXtSLV8UQIeEvX4HvBZXl7zrd8B2yIVMoiLS
O5n7JILOG6jJPcUiL0vovAFBnyxJzTVDdz8ds7tWx69splC0pKUQ8St3rT5m++lyqwt1ykxw24Do
RmsCTsVMEN23DWSCTlk76LigmZAwG9LU2XpE6tyQhknI+RveBUEnKWC6+0SKW1xhZhap7j6YpKgd
dBxkG4FUBwG2xVa0BNUR3r+20AQGFQUgEx9NVVsmgKJw1d6acZGSBBZxQuuFJog4OEn10wgCZgGp
/Tn12NYoTYD2IWdROxkrW01o/VGcxjC0rsYzX2ieJkid5dafyAiGzkJOLzgEEfMq/KQNvHMXTJ6o
tasLkcmfuwBPG9DclW2BYWcI6q0JM936BdBMvzUBNUP1hWbwrE15B8bNTItnCwhm5sB4ypu1mLft
X+BxM5wWb2byp1s/XfKn38ykxQzXTiPI7WPtlIU6M9LiCSMYZ0agpqyrgnOt0M1gIG8g971sg9ba
0Ab7XobMG6C20NHLNmtBD49PHxXcsgnDgqePPjwOytpSIl1zulgwuAuJ3PFDRK1aBJmJjh9K5LpQ
ceBRIy4yAAMjbIGfOJKbkIJbsDlgK0Vu4okjBRYW4XEHV4+LTmYwbMZPx4ZPvXuIWhMbmfDuoeFT
6VjGR3RaWLfsxLCwWR2Xew/mLgix4pAsRO7C3oNxmdWw80Wu7osGBmZat6lHT7y9vwXLIBO9vf/R
E21qWof3rueLZbEDmEwxFr97ePrkCtuRhZg+efdwLJ4pwiCotjGuLrRBgCDGJy8++Ygt0soFHya2
xScfOXkxxggQLLQgUL0cL0CQEFp0Jf88vtPrv5btipSSGVbIN57YfaBLzeRRhIYPCzMfsno5PqxQ
CSs7vIPHb9nQPWAtieUPNkqefXHXzwXntMmjCB/BQsB6hxoC0pBVk/Tq61/evKrP2uXdKrBVcuKf
t/7oRM4GOg8NDb9xobkEKQyl1JnC6de+sLWtdzkh2SqR+dd933/+wxQXCiiiCO18EY0gRhtWAQL5
IhU7Njvyyk2bOtJsl6VGwWAlLvxjzw/+MpESuQIKKEKjRlSshciVLS4+pbx3si++cmN/9wCIm7Ql
WyEEnXnh5h+/+mGKHGDoh7Z6LY5qJsHuqBwJJJBMJXKkvL99bevXpWd5ybZkQJDxR578/N7AT3Gu
gDwKKKDgEKsGN1kTkVE+DYQPTxH/ZqRn7FMDqV4iaxa702YLKwXR5InHf7L7oITkYgEFaOeFQe1q
JtXZTEQHvgkkEEfciydil/S6rn23b/pK+ycMrKFGz+KZrZASsxfefuaOP56d6ogVtF9EEUVnQR8G
NRcIeXlpoh9ioTnpXfQfP3L+tbWFzjXJVeHrbME0/weHXTEMJiIIUiL7n2MHHvzFd56b5qTIFq1G
0Q0fPizqrGBUv+YHgnKWjCEODzF4HbFLPoKvrr9j67Vf7LlaeMIleMzMUZ8OEVE43yysnzn+xnP7
Rn7/PlSHd0nDh4aPIrSzYFDr9O/yiOUGBA8KcYcYh0p6CTWpgURiT/qu66+6pnOt16nalSsNholz
kA9m/enpc+8cHT7y9PlCAeiOFYK8j8AtdUUUEZQk5vqWutwGN+rUibmh4EEmPVAeYBgE7V13pq/u
7V/dlvLicVUM/GI298GHx//71PnZqbDvIQlw3oeBjwDaDb9W4jAP4HJJDIVyh5CqBKnCvhBPKpmg
ScB3mZ51iYiAhITXjQIHxjdR9lQCDCpW5GYRHaQoNRVFQ0K69hXhCUVKKKGidYkDBDawAfsW1uEZ
GPilEQZq20hZpvHmwKjzKRoxSEgI12MjXRJXmXUCxmWfYS6vnR0DB8hYrubAeYILyJINVQmT5pze
lTs+I7ygZEdTygmXs8VyjuBRo5aEch4nS41AlYjsEKP9SOB8tdwRimVHdD3cUXeiKKESZNSx6DYa
tlQ2MM6SZTie01K93IgVqNEUivoZRFWhrbNleWos4XZLbD2nMhCVrFc+c4o8zc7xyyUWDppPUCv7
Gar1dTM+/v9p0ez1P54REXQBZiSmAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQKxYT+B7QAAAO0A
AAA+AAIAcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfY2FiX2JhY2tncm91bmRfdG9wX210cmxf
YWxwaGEuOS5wbmcAAIlQTkcNChoKAAAADUlIRFIAAABIAAAASAgEAAAA/+R7zAAAABhucE9sAAAA
AAAAAAAAAAAAAAAAAAAAAAD/AAAA2B0YZAAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAAAAAAAAAA
AAAAADAAAAAAAAAkAAAAKgAAADwAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAAAAEA
AAABwjjxOwAAADBJREFUaN7t0LERADAIxLAn++8MC9CloZAm8DkBAAAAAAAAAABgV+lbQe/aIUGC
fg2d9QELSmbK7gAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECGl+dXeAAAADgAAAAPgADAHJlcy9k
cmF3YWJsZS14eGhkcGktdjQvYWJjX2ljX2NvbW1pdF9zZWFyY2hfYXBpX210cmxfYWxwaGEucG5n
AAAAiVBORw0KGgoAAAANSUhEUgAAAGAAAABgCAQAAABIkb+zAAAAp0lEQVR4Ae3PoQ0CQBjF4H8G
BAPhMbhTJOxNGAGHfQzw1Llr0m+CdsQkSZIkSZIkScot32w6a+CXsAdy1IADa2gS+ELaYg48a4E1
MFMLtIFaoA30Am6gF3ADvYAb6AXcQC/gBnoBONALuIFewA30Am6gF3ADtQAYKHn1AmqgF3ADvYAb
6AXcQC0QueBCcyF39sI7lxnuwifX4cpjL1+SJEmSJEmSJOkPDQ/c66iRtE0AAAAASUVORK5CYIJQ
SwMEAAAAAAAAIQghAkb4txmrAAAAqwAAADgAAgByZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19s
aXN0X2RpdmlkZXJfbXRybF9hbHBoYS45LnBuZwAAiVBORw0KGgoAAAANSUhEUgAAAAIAAAACCAAA
AABX3VL4AAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAADYHRhkAAAANG5wVGMAAgIBIAAA
ACgAAAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAACAAAAAAAAAAL/////RjxKpgAAAA5JREFU
CNdj/M/AxMAAAAUNAQMIYcEiAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQInnMAZ9QAAAPUAAAAy
AAEAcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfbGlzdF9mb2N1c2VkX2hvbG8uOS5wbmcAiVBO
Rw0KGgoAAAANSUhEUgAAABIAAAASCAYAAABWzo5XAAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAAAAAA
AJkAAADGULC7AAAAVG5wVGMAAgIJIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAAAAYAAAAM
AAAABgAAAAyZM7XlmTO15ZkzteWZM7XlAAAAAZkzteWZM7XlmTO15ZkzteVAtUvPAAAAOElEQVQ4
y2M03vp0JgMVABMDlcCoQYQBCx65rTjEvUk1iIGBgeE/Gp9xNLAxACM1DPIeTdmD1CAAhewE3uDK
OMUAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAphuayPdAAAA3QAAADYAAwByZXMvZHJhd2FibGUt
eHhoZHBpLXY0L2FiY19saXN0X2xvbmdwcmVzc2VkX2hvbG8uOS5wbmcAAACJUE5HDQoaCgAAAA1J
SERSAAAAEgAAABIIBgAAAFbOjlcAAAAYbnBPbAAAAAAAAAAAAAAAAAAAAAAAAAAAzAAAADqDTysA
AABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAAAAAABgAAAAwAAAAGAAAADMwA
mczMAJnMzACZzMwAmczMAJnMzACZzMwAmczMAJnMzACZzHeCsIkAAAAgSURBVDjLY2SYeeYMAxUA
EwOVwKhBowaNGjRq0GAxCACa5wJVluVQygAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECNRy+cdQA
AADUAAAANwACAHJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX2xpc3RfcHJlc3NlZF9ob2xvX2Rh
cmsuOS5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAASAAAAEggEAAAA/MdG3AAAABhucE9sAAAAAAAA
AAAAAAAAAAAAAAAAAABAAAAAnQxGqAAAAFRucFRjAAICCSAAAAAoAAAAAAAAAAAAAAAAAAAAAAAA
ADAAAAAAAAAGAAAADAAAAAYAAAAMQMzMzEDMzMxAzMzMQMzMzEDMzMxAzMzMQMzMzEDMzMxAzMzM
CEcy5wAAABdJREFUKM9jPOPAQBAwMTCMKhpVRF9FAOl4ATBepDQwAAAAAElFTkSuQmCCUEsDBAAA
AAAAACEIIQI/Dt471AAAANQAAAA4AAIAcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfbGlzdF9w
cmVzc2VkX2hvbG9fbGlnaHQuOS5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAASAAAAEggEAAAA/MdG
3AAAABhucE9sAAAAAAAAAAAAAAAAAAAAAAAAAAAzAAAA5IZJ2gAAAFRucFRjAAICCSAAAAAoAAAA
AAAAAAAAAAAAAAAAAAAAADAAAAAAAAAGAAAADAAAAAYAAAAMM5mZmTOZmZkzmZmZM5mZmTOZmZkz
mZmZM5mZmTOZmZkzmZmZb7mYIwAAABdJREFUKM9jnGnMQBAwMTCMKhpVRF9FAENFAPBYTuJqAAAA
AElFTkSuQmCCUEsDBAAAAAAAACEIIQKdmAwbBAEAAAQBAABBAAEAcmVzL2RyYXdhYmxlLXh4aGRw
aS12NC9hYmNfbGlzdF9zZWxlY3Rvcl9kaXNhYmxlZF9ob2xvX2RhcmsuOS5wbmcAiVBORw0KGgoA
AAANSUhEUgAAACoAAAB+CAQAAAD41UsxAAAAGG5wT2wAAAAAAAAAAAMAAAAAAAAAAAAAAIAAAADC
iRxcAAAAVG5wVGMAAgIJIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAMAAAAAAAABcAAAAYAAAAPAAA
AD2AAAAAgAAAAAAAAAGAAAAAgAAAAAAAAAGAAAAAgAAAAAAAAAEhb32GAAAAR0lEQVRo3u3MMREA
IAwEsAflVU4xAUsvEZCVykudk975QCqVSqVSqVQqlUqlUqlUKpVKpVKpVCqVSqVSqVQqlUqlUql0
cnoBmsUEeM4dl5oAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAvJh9M8CAQAAAgEAAEIAAAByZXMv
ZHJhd2FibGUteHhoZHBpLXY0L2FiY19saXN0X3NlbGVjdG9yX2Rpc2FibGVkX2hvbG9fbGlnaHQu
OS5wbmeJUE5HDQoaCgAAAA1JSERSAAAAKgAAAH4IBAAAAPjVSzEAAAAYbnBPbAAAAAAAAAAAAgAA
AAAAAAAAAAAAHwAAAInCfD8AAABUbnBUYwACAgkgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAA
AAAAFwAAABgAAAA8AAAAPR8AAAAfAAAAAAAAAR8AAAAfAAAAAAAAAR8AAAAfAAAAAAAAAelmGJ8A
AABFSURBVGje7cxBFQAQAECxTxH9U1KCi7cF2Gh1167ZA1KpVCqVSqVSqVQqlUqlUqlUKpVKpVKp
VCqVSqVSqVQqlUqlP6cHMD8CGlq00fkAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAtIlcenzBgAA
8wYAAD0AAwByZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19tZW51X2hhcmRrZXlfcGFuZWxfbXRy
bF9tdWx0LjkucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAAMAAAABICAYAAACgP/qyAAAAGG5wT2wY
AAAAGAAAABgAAAAAAAAAseEjQf8AAADGcvpaAAAAEG5wTGIYAAAAGAAAABgAAAAAAAAAcDRfLwAA
AFRucFRjAAICCSAAAAAoAAAAAAAAGAAAABgAAAAYAAAAADAAAAAAAAAeAAAAogAAAB4AAABCAAAA
AQAAAAEAAAABAAAAAf/9/v4AAAABAAAAAf/9/v4AAAABVOHBXQAABhpJREFUeNrtnb1uJEUUhU9V
t0FahEAgtLspIliLlViBJSzZwTwCmeU32Hcids4bOCKZeAmRkJAQBGQWkbuKZEZb1NatuvXTw9h7
Pqnlnp/1tHfOqXtu9R9ACCGEEEIIIYQQQgghhBBCCCGEtGD4X0COUTOG4idHjj9mcZoB7zc01nst
VD/gd/lDG8AMen+rISj+h2uCGsGvbgSzovhNhQHMbuMNTfBeiN8H37nWAH4NE5iB7zMF4Uvirn1M
HrYxtI99wQh+hBnmwSOtiUZzk3itxhw0wOOsDHElCJ8zmX9jKkd5U3rv3Cl+SeAmIWojPF9THWiK
hxmDakZ5nxG+9N37VhOYzsZVI3jpdZsxDyrWyXEaQBNhwudd5nWfMIhXxKWiSeaOP9ZkqkD4nBVe
s0oT9ZiV/H+Nb25094URP4xDLorWqbhUjDo9PYBG/EZYYqFbhTEMDfCoDRCvp36HUzTLiMTfZIK5
UvBSdMkZYMo8rzEGI9DjiEA+ijqx0JfgvTZhDp9ZEFWM7lkgbf6XFiush4+tYAzTGYfIcRkgHvGt
IPT9CO4S4vbBa6XPlipB8vm5Ufya5jUlZJsxS1gBTKanoAEeTiTygsAhPN5//w7pqXQksn/qc9Um
mDO5Ssr8VhB0uD7t33d5efnR9fX1081mc/ni9PQ1gC8TsYeQ+53wf/3lzZsfb29vf765uflzu93+
E8QlkzBUXGlcpidoqgC5ER6FZhhXV1fPzs7OTl+cnn4H4FMKnwjsB9DPvn758tu7u7u/l2Xx2+32
t4TmYoEb5exQsQJoxC/FHBvlewvAXFxcnH/z6tUZgA2AzxlfSMYAAPAFgM335+fu5OTkEwC/C7NI
LtKSz8Qk0QSm0OSi0OSGP6dgfd7/QYtzPwF4BuB5MPNDSI4FwB8A/pqs/SEQ/H0QcZZg3QkNdHFn
WcuhEJIRkhUAwFcAnlD8pIIJwFMAH+/WfRSTnFAVTEVD/J+yo5laKuZ9YabnA8Ye0kCondSMoaQ/
CH1BkrmwAaaQ98NlCn7OweMn/C5JAye75cPdiL/stBf/dFFfEO9biGeLmipAbvanZBJCepvj0k5T
SZ9dFUBqgI2iIsy7hdGHjOgHbDDCh/2Ag+5YMt9qAAjZPxV/wthDA5BRzImIs0SiDg1SbHxre4Bc
zDGZXoARiIyqAC7Q1n5ET2X93BmJzRVAe6BbbIKJBiCDDLAX9ZIQfaxBh3cvtlBtAM2Bbymxh3Fo
pgHIoAi0jzahAaYoAqVmfmL9eq0BoJztsYooRMiICuACbUkVIDc7lMRWVABkOu3UHmAe8UlGkBpk
pZ1iGu0WK0DOOdJOMBNEoQlvd2LQAGREBLKJCHQfVIMwArlM9FGdDyDN9uTO2MrNDhHSWwF6NJnt
ASSBeiH/S0bJnfZIyIgIZDP9JwqTNsCAy6JIGd8Ks0ITeAQoGdMEYxdtwn0COT2Kx/5oK0CpCkgl
R2pSCGklN8mSizvF0T9lgJorL2h2kDECkTUikHRwXE6rSV2XdoSlnCUdnZfaG0wDkFFN8KLQnhcq
ga9tgmtLVCkiEXKU+rIDN046O4yQERGopLcm5k6ha84UI6TXAB7v7njVLF0VwAgmyBmDEYgcOgJp
ddoUgbQizhmBkF4DaITfpF/buRHSB3IfABltAqvQXfXgays3otYINAFZIwJp4hFGG6CmQoAGIIMN
gDXitVU0vyOcSsja1aB2oM5WANPoztxNLQjpEW3p5ovV4l8rAoV4fn+kE985SK/eA6Tu1eRZAcjg
wdUXNHdwA5iMGQhZqxr4kdVAc0ZY7cYwApFDRKDaQVd9cVzf8EGaW1gS0huxNdoqvTYsAvVsCCG9
sWdIL2ArNqL2eRqAjK4AI7TZXAFy914Kr8myX2gAMtIAKW35gja7DVDTYLAHIMfQA1TpV3tVCN9Q
omgAslYPoDGBSr9zpxPDu3e7xMIdYaQXJyxeiERDI5DWWd1ZjJCG3rMmqXRXAKkspaqCZwUggyuA
dCPsrrg9F0b50oyPNAO0gCfEkzEswSLNBJVmhsTqoG2CgfIUKGeByKEikEaL0ESjmqtC9OYzQloN
0Ntnilr+F/zAN8ViyaFmAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJueyEDAQkAAAEJAAA7AAAA
cmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfcG9wdXBfYmFja2dyb3VuZF9tdHJsX211bHQuOS5w
bmeJUE5HDQoaCgAAAA1JSERSAAAAwAAAAGAIBAAAAOHJtWIAAAAYbnBPbBgAAAAYAAAAGAAAABgA
AABBgtpA/wAAAIauQgsAAAAQbnBMYhgAAAAYAAAAGAAAABgAAADlmSBfAAAAVG5wVGMAAgIJIAAA
ACgAAAAAAAAYAAAAGAAAABgAAAAYMAAAAAAAAB4AAACiAAAAHgAAAEIAAAABAAAAAQAAAAEAAAAB
/////wAAAAEAAAABAAAAAQAAAAEaNes1AAAIKElEQVR42u1dvY4cRRCu6pk7hxgkQAQWknkGEp4B
kSIii4QX4DV4ACICC4kAh86IceCQzIEREgkRhgSj25kugumerqqunuk9nQHPVa1ud/bvzv6+rq+q
/6oB3Nzc3Nzc3Nzc3Nzc3Nxuk+G/8I3bZXTzcDpJ1wS35xt47Xfx1vsFdUNN50O89zqeTdFx2z41
Hrt+B571Glbv10TgrWn3FuBU3e+QgND7Ciq4sQH8bSGADND5ey0SaBtu63kNPTbePbInUONKAm/R
QFsU4E5gleDj2u65D+Ct8ARqwE/GNe2QQD0EoJIaXFs/btBhxYljUUAm/PqKFDVWpGgGVC01GvzW
Yys6HA1+LjjU8ailSVAwNhPIGv5Q3WsidER4/cXI0m9i7Z8/xnQPgBCB0v+bEgIEaOVFrZSywF+g
zregniP7Rp0xHckDtN5TdYvqeabFCtDNrKVISmBtPwjw87PymZqGY0YBLTMxgVzAz88y+Mu1DM4r
BaPhEyiuCszWj03C8XzAlp4MckiSQwzykH4IcBUfrEVtKwZktc9tPiTYw/PP7305voU+LspsevHr
V/e/AYQImIgJKzWFoI6xHR5YdYsPECC8+PruJw64ZX88fvMLiOlG4qfOjJIvhOZAGrIAvMA/QIDw
7IHD37K7Hz97ACEhlbUDVg3ZHLEs2UuodH8o8EP4++md9xzqll39dufD5AEzRCCYVy/gaSrr0o0b
A29cfIbM7OW7DnPbLt6BgbX1EopxjQEqEowb8lNCb4Z/gAGDw9w2DDDCrF6MgBBSB60Kw+PG6GfJ
fjDDD4ODvGMDS11D6gHn9o91LjRWPQDZ52XZDwwwNNJWN41oyXoyCblRk+wNjOZoDY/dgbX+0Qno
JqAM2C0ozpUAIZCWIBQjQbr1uwT1SRBVI0UL/LB6AG3FAFuIsgA5AT0xIMNOEBmOtIpQMwbIgYjS
/osPuAT1SFBMo0ELCZkMYGNCKwnB6AHIWbCShgaXoC4PGETyzmcO9X1jKKLOgxCG9AvdA/Y9ICS0
OH7YGo4I5uAEGp2xkLh127bAfCCoCSxjiD4YAVgG48BkyCWoV4KGtQ+FDWQ3PKB8NLBBuewFbnsE
BDZ3AulKYwu9MQDE3FdwCeqQIC49ocLzrBgAajzUJegcCaop2IwBaCRKOhije0CHB2Az+BprRoLR
/kGtcEDRJXPrkSDeA0C10Gc3BtSRgPcK3PYJQHPlVOPj28an5sPWL3JjiAUmRLjHFzRFCJWGuQf0
ewBUQ5qNFbOhGQHsQOweAN2agdW6cYMEOwjLD8so4LafBaGR/zT2TQT75epLaPfj3Jq44Vb/tyAe
Gr/CJsEp6JUgC3w8LwiDuRPMCdgnoLWzbjcIWyqF1UIVtz4BshAzEA5nOZXD3+8DnYLtWc1/njS5
/e8JoN0qCG4SL43bDXgAOfhnkkDne4BdfELvjnLrgd5GzEA4NByoVfPACegRIILu4h1hU8Wk/pN7
QKcHkBkHaEuCaCf4ugCdL0LbwZhsD9Bf0vvBo+O7Y1HtlKftTDKY+q8rgvB94G49EhQrCmSj7gjC
NY8E0T2gwwOi2lNPqnjNWf2AwmdMrLrtIxbFBu1rdsTIrAUSXzoFG/ayNFQy2n8HAVTF8RX65fb8
hcPctp9/L0iJrUrQEqFQdSDAyH9KOZb45HuHuW0/PmLiE41cSHdy01pPOfUe1CZVsV318S8fvf/B
PYfash+efPoQTjDBBBPMMMMMMRUriCIu7BCAVYEaZIuuw7dP3/7r8v4blxc+PcPspz8ffffZwwT+
Av+k4LdSUzEDzFdCl53BFzDARbpdwgVcwmV6HOEivT+un6/XRR5ldIdHwjndJpjhBBOcYIIrOMEV
XKXHU7ot78/rjZewAb1PeHkJWQ5Uaj9FmGGAGUL6wwFOK7wsRxKr448zhUlQypLlSigL/LnFn9Lz
IjxRAE1VrcVk4wbfeatl4T3AkOCfIBfgyv+sIREkt+Ych4DSG5I+MDHZmRL4sxAdU3raBOixn4WE
pe0PMAEm+Pk/zBKgwCTu9YdfekBkojKnsHtaPSKuwbfuFUCbAFqrW8rhiOXP4fpY4F8+M8CYBGoQ
7R8PVrSPhA/MTIbmBP+J5T6RyRAZNdXNwq1F/zFtsl822i9Xsyhfmcc9xiQ/S+CWC7OPso6odKTK
kMy8ik2OBaf1ahYiJGNBNSI6mn9My1AmAAFS+6cV/kHsihpEIcsjSVApO7aklrPKhmQkmFXiWZfs
MwmQJYWKDyDMIHe4kgF/qDamHSsNBZZERoOC7Aez8gFKdeLMad1RiA8nIqZCE9FYULeAT6vy2/Af
Lwa0KIis5U8iHY1sIss8R0D3A1CN/0MqQ5q9QA7YhTU51dtyjrSYl4yRsRwJpCdoAYpmHkTbMYDX
NiNBghzxnlnmP4hixsdcyK5LdBcCogjJss8b1ZRWV+ni7GzBmAPmVaAWEkro1XWkj9YRk/WiZTjm
fYPIPEN3xmCvI0as1j2tNS+jkREsyh8hAKYU1drWdyQCbC+IAmzZCyBjBLQzC8pXpfQoz4gX2Yki
8GIVfo8WA2QolhSQAp7DLz0I9gu38u53YJ6Qp29yG9CF7K0NmUfqB+hIQKpEdzQ6X4WuxqSkdfoR
7pWvF8+gCf8Rzw+oKQAGP7F7fpwDmKOiGwRAdWqMH+CwdYADVeXqdcHuerFukwA/wqQvG7qhI0z8
EJ/riNArOcRHe4MfYwVwvWOsLM3X0zE7BPhBblu50I0e5OZHGV4vHX0lRxn6YZ49YvRKD/P042x7
osGNHmf7Dwrt/zqj8fCbAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQICvGFnQgEAAEIBAAA+AAMA
cmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF9vZmZfbXRybF9hbHBo
YS5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAAJAAAAGAIBAAAAN/AGGkAAAEJSURBVHja7daxDYQw
DIVhNzDDSfSMQk9NwQSMwQ4n0TNIJghtdmADpP/KcBwoieTiCn8DWMpLYluMMcYYY/4TLRMrGzsH
BzsbKxOtlGDE8cQxSg56PCmePlXmTa63POGFo4TjdV/GU8rflMJxFZjpaKioaOiYCVy5VDaBQW4w
EHjOip5vC7U8oGbhW7zBSzqzJDBz5uPzO1skAwtn42/MgVoyUBMukdNyNkgmBs5aYSIKUoBANAlr
Iua8yFdhI+qkAB3RJuxEjRSgIdqFg6iSAlREh1ohtaOpha12/WoPUu2LKH1atTai1NjUWq1S81ca
R2oDUmlkqy8R+muN/qKVXv2MMcYYY/7SB9l/u0FkyGYqAAAAAElFTkSuQmCCUEsDBAAAAAAAACEI
IQIbf5nwkwEAAJMBAABDAAEAcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfc2NydWJiZXJfY29u
dHJvbF90b19wcmVzc2VkX210cmxfMDAwLnBuZwCJUE5HDQoaCgAAAA1JSERSAAAAJAAAACQIBAAA
AEsJUBMAAAFaSURBVHgBrdZPbtpQFIXxn/EUr6B4SjpL9kC3gNoFtKXjoC4kTRYROkCCSQalXUPY
hREVTBuB7WZmIZkY2e9980/Xf949R+2JpUZuPXq29e+VrWePbo2kYhedyDufzWUK5SkKmbmvBqIm
Sd/YL7saSSXbWxlLzst6hu5kcmUDucy9Kz2159rCQXkhR0vXddPceLpIU3Hw5OZ0qsjQsllTo1q6
ElWixL2jsgVHD5JqnrFM2ZKNsQgYWMlbi3IrA4hN7JUd2JuISc0VnUSFuZSRTNmRzAemis6iwndm
ygDMWAcRrdkFEe3Ig4iOoUQvoR7tb8CXHebz/wz4Qwa7IsEubYg18k0cZrGl1ardhFi19N05tNIc
/NA/jaNFqzhaGIqCB2QV2cvukV2ViM1FJWLjwXu987Um8dHvxlrzxydJc0ca+PJm0ZpImySn1W9q
Zm3r5ZWttZnp+er3H1sC9iWr4LZqAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLdfoQBUwIAAFMC
AABDAAAAcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF90b19wcmVz
c2VkX210cmxfMDA1LnBuZ4lQTkcNChoKAAAADUlIRFIAAAA2AAAANggEAAAAJkyiVgAAAhpJREFU
eNq92L1KY1EUxfHfvRDLiZYxCLHWeQYtZfIA8QUk6R0lTyDaKZjWxqmEvMPEQomWmX4g1aQYhXwI
A8m909gMwUmMuWetB/hzNvucs/cyhyKfbNlz7Mqtrr6xsb6uW1eO7dmSF/mwIgUVl+49S6SmnXh2
r2Hf+keAOSWHvvtlIp3hiZ6WQyU571ZsQ9WjoUQ6pxNDj6o2xO9D7WgaSRfwSNPOvLjIqqqOsXRB
j3VUrYnMVNGpp/mL92bTnCqaoYJLL9Il+MWlwv/b/NxAuiQPnCu8VcxVJ0bSJXrkxCrTilU9SZfs
J1XxdAl3dCRLhyU60xeh6MZYmoHHbhQBIOfAQJqRBw7kACh5kGboByWAyKFhprChIxFQ0JJkCku0
FCBS8UuasXsqIvIaJpnDEg15trWlAdy2zRf9ILC+MnVpINe5Dga75i4Y7I5uMFiXfjBYn3Ew2IQ/
IWG/Q5bxZ7gGCdn69yEv9bfAz1U53EMc8ov5TF5DEurzjFT0AowF+6JwA886EPkaYpQLN6Ru/jt+
DzM814EcCL9YEIdcmYjVMlkGa9MoWMtkzV17e4G/WOoCf6EgChdNzFDRmeclhC5nimYqsvbhOOmH
2nxxEsR2Nb0sWL6mXfEiEeDoXRHgyKOaDbF3a8WmIy29ucPNI5tWLKzIun0Nbf03Y9u+9nRsuzgw
b1tZ/TWQHpiYGLwG0nVl2/MF0n8BuNHqAK/yYJ8AAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAiT4
GFTSAAAA0gAAADwAAwByZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19zY3J1YmJlcl9wcmltYXJ5
X210cmxfYWxwaGEuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAAHgAAACQIBAAAADTYQuIAAAAY
bnBPbAAAAAANAAAAAAAAAA0AAAAAAAAA/wAAAPDjHycAAABEbnBUYwACBAMgAAAAKAAAAAAAAAAA
AAAAAAAAAAAAAAA4AAAAAAAAAAAAAB4AAAAAAAAABgAAAB4AAAAkAAAAAAAAAAEAAAAAj/7ASgAA
ACVJREFUSMdjYBgFo2AUYADG///J18xEic2jmkeG5lEwCkYBFgAAQ/UCEn/SrWAAAAAASUVORK5C
YIJQSwMEAAAAAAAAIQghAk3oXDrPAAAAzwAAADoAAgByZXMvZHJhd2FibGUteHhoZHBpLXY0L2Fi
Y19zY3J1YmJlcl90cmFja19tdHJsX2FscGhhLjkucG5nAACJUE5HDQoaCgAAAA1JSERSAAAAHgAA
ACQIBAAAADTYQuIAAAAYbnBPbAAAAAARAAAAAAAAABEAAAAAAAAA/wAAAMoBKZQAAABEbnBUYwAC
BAMgAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAA4AAAAAAAAAAAAAB4AAAAAAAAABgAAAB4AAAAkAAAA
AAAAAAEAAAAAj/7ASgAAACJJREFUSMft0LEBACAMgDD0/5/bH3RNdhYKoDoz7/H1D/i2GCsCAqDE
1lEAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApLEsrQMAgAADAIAADYAAQByZXMvZHJhd2FibGUt
eHhoZHBpLXY0L2FiY19zcGlubmVyX210cmxfYW1fYWxwaGEuOS5wbmcAiVBORw0KGgoAAAANSUhE
UgAAADYAAABICAQAAAAXZM7nAAAAGG5wT2wVAAAAHAAAABoAAAAhAAAAAAAAAP8AAADtpRnKAAAA
UG5wVGMAAgQGIAAAACgAAAAAAAAAAAAAMAAAAAAAAAAAOAAAAAAAAAAAAAAGAAAAAAAAAAYAAABC
AAAASAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAAAP2b00sAAAFTSURBVFjD7ZQxUsJQEIb/F3BgBoc6
JR0XoOcSegdqC21sLKy4Ag09BTWFXoGh4gZUdM4wEvI+CxgUDJgXkEL3K1Ikb+d7u5tdyTAMwzAM
wzD+M+77K66VyGV9OQpCV+7t2JHyXoRz6E6PelcpUJaqomc94Rx5r+eIqNKnCH0qRIRUBIejyhBY
5tYsgSFVHMHFjyTqvABpLlUKvFJfRwZDSSJmDCQ/qhJgTLyOKgSRRIMpsDqqWgFTGgWz2smuxQzw
B1UemNE6IasdXZs5/kDvUjxz2mdQbXU3LPAZ2Xk8C27PpJIkyhIdVqR7Ok9KSmd94mwQSdxvivZV
BQ8n/haZQ16W6ALJRudJgK5EOXiI86wwid52DFZATwpcTYErbAAkJMCg0GoK6lyNEQAjamfvVoYu
ZsKE+JdVW12T5gVU6959Pi+hiy6SlWEYhmEYhmH8ST4AbXgLmdWVJtUAAAAASUVORK5CYIJQSwME
AAAAAAAAIQghArWCyKNTAwAAUwMAADgAAgByZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19zd2l0
Y2hfdHJhY2tfbXRybF9hbHBoYS45LnBuZwAAiVBORw0KGgoAAAANSUhEUgAAAEcAAAAwCAQAAADp
nq/tAAAAGG5wT2wNAAAAAwAAAA0AAAADAAAAseGjQf8AAAB23mviAAAAXG5wVGMAAgQJIAAAACgA
AAAAAAAAAAAAAAAAAAAAAAAAOAAAAAAAAB8AAAAoAAAAAAAAAAMAAAAtAAAAMAAAAAAAAAAAAAAA
AAAAAAEAAAABAAAAAQAAAAAAAAAAAAAAAHGKsM0AAAKOSURBVFjD7ZjLShxBFIb/6jaKC6MBcaHg
QMyoQeIlgQSTZ0jwXRIU9+J76BPICPENFIMuFFzMCLNLEEfihSyC09NfFtOJGqa1q6eKGPAsZ6qr
Pk6dOpdferD/xozNYoxCE0kM6Kne6K3GNKRePfqzoK5zfVVZm9pW1RxLdKhh8MCNwUgS0yyzw922
wzLT1790CRNIEiOscAxAg4gGcQuMOPkP4JgVRq6+dwhDJx/5DsAlUQbvRFwCcMonOh0CEUoUKCVe
aZDdfq8uUWju4wZmggMgank5d1lMBBww4QCIQGKMKlAnv9WBKuNtXhkhhmHKkCla7gIqM4zJ7SEM
IV2UHMCQ7FGiizDns8dIzLd5TX97aL65b76oGecCt3ZxewQFt5aPRfUodpjAYvVo0bY0SaJD4hU1
yzyTJQ/VeNnc38Y7saT36lcsl+k9UKx+fUj2z4qDMTF9mhNOYZrnoTn6TNw6oIPUuClqyhPOlIpp
8dP6OCTNeuyyZpMzsuEYJE16xJlMzrB46KM5HmTW/nPUPu8MevTOoD3OY484vfmysi+r2+Oce8T5
YY/zzSPOkT1OJS03tNtgJnvbFAlJ+x69s5/W9aQXiS2POFv2ReJQezJOu51mp2C0p0PLIkFgzrTm
CWfNnBHYFYlA0rpOFDjuBgOdaD393JSfTURodvXZQ4OxYXYJTZS3dY8dNqcxFzzPOfxhJBYcDzYL
OQcbCUNANxsOx74NunOPfcmFFSg78FAdqFBod0pvRtD9kAycCiovXCo890VuuiHGnd4DMe6aVPmM
VWoWUmWNVYrOpcobQu4MS2xn8M42S8zYCrn5ZO5+FfVa7zSqIT3RVUz81LmOVNGmvqhiTjzK3A/2
7+0XUfcwvZ/N8IQAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghArZs6uPMAAAAzAAAADkAAgByZXMv
ZHJhd2FibGUteHhoZHBpLXY0L2FiY190YWJfaW5kaWNhdG9yX210cmxfYWxwaGEuOS5wbmcAAIlQ
TkcNChoKAAAADUlIRFIAAAAkAAAAJAgEAAAASwlQEwAAABhucE9sAAAAAAAAAAAAAAAAAAAAAAAA
AAD/AAAA2B0YZAAAADhucFRjAAICAiAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAA
JAAAAAAAAAAeAAAAAf8AAADht+cKAAAAK0lEQVRIx2NgGAWjYBSMglEwCkbBKCADMP7npJJBDP+p
YxATtbw2ahBhAADW5wIUflkgpgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECUxgqq6QBAACkAQAA
OwADAHJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX3RleHRfc2VsZWN0X2hhbmRsZV9sZWZ0X210
cmwucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAAIQAAABCCAMAAAChK448AAAAM1BMVEUAAABgfYtg
fYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYurrs+rAAAAEXRSTlMA
IFCAv/8wj88QcN/vYK9An5dcN1gAAAEPSURBVHgB7dnFgcUwFENRGRQy/f6rnd0wG54WuRWcoAn/
zfkQI38V5rTtB1+yQJxXImmKOEMmjRElk8YIF0lrhM80RxTSHLHTHhFojyi0R2y0R5xJAFFpj2gU
QCQBRKEAIgkgCgUQUQDhKIC4FBBRAUEBRFNABAVEVUBEBQR/2Y24ETfiRtx/zMrODoVRNCrMJwL6
O9mZV5hjOoHZdoLAumPHkA725AUW5QkC2xPBfveQ+RTYNtsxrNJ9Iyx/WBcG5rLZANr7QLLD2Hb+
vYLRPTp+EXaKB2CueGBOu8H70HEgmRv66zyTrCemVhJ/KnnM7gzfM1LBksrBr4oFy3JX/ExwOazt
bKG+SGINDf/tCV0MS6TFI1KuAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLC5ROT8QIAAPECAAA9
AAEAcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfdGV4dF9zZWxlY3RfaGFuZGxlX21pZGRsZV9t
dHJsLnBuZwCJUE5HDQoaCgAAAA1JSERSAAAAPAAAAEgIBgAAAKpPlqUAAAK4SURBVHgB5dszuFxN
HIDxa7e3/vyliW3btm3bSRnbZt/FTdDFtm1c793JO+EU692z55yZ8zy/ft/1mflPgh3XwHlLZ2FO
ggkXoVMhIM3QPXYSBFRTdI2dAC+EDxN1ix2jxPrixXhdYoersUGiR7k9dkiwWB/Rw9waOwilEGHy
YrDbYvvBAxGhUgx0S2wvJTYaHvRzemx3NTZG0T2dGtsVJRAx5kE3p8V2QhGERUrQxSmx7ZRYKxWh
k92xrdXYOEW3syu2JQoh4qwIreMd2wz5EDYpRIt4xTZGHoTN8tHM6tgGSqwT5KGxVbH18AXCYfLQ
INaxtfEJwqG+oF6sYmvgA4TDfUKNaGP/xSsIl3iFfyONzcVtCJe5jdxwY5NxAsKljiE5nODFEC63
INTYuvBoEOxBzWCxKbgEoYnzSA4UPBlCM+P9xebgjYbBL5EVZJNLOxN9fXafaRz8RDaqwa0hNNde
DT5oQPAB9e38yYDg90iWwTUhDFFFBk83KHiyDN5jUPBOGXzGoOBTMvipQcGPZPBHg4I/yGBhEK8M
LjIouFAGvzYo+JUMvmtQ8B0ZfNig4KMyeKVBwatl8BCDgofJ4H8NCi7z8xbxngGxD9UFgHUGBG9S
g+sYEFxbDU7EVY1jr/laph2lcfAYX8GZmi7VPkWmbDTlVR4XbF/4nEaxV5EWbAexOko1iPWqgy7B
oldoELwxnAmAdJe/ta8iK9w5jz/xyoWxH/B/NDNaeS6KzUP9aGe12rpk3cuj7hDGIrrAwbEFMtaK
4dK3Dv3MNrBqovYfh035XMR/Vs9MZ2ADvDbHbkdWPI8BNMEtG0LvobVdBz3SMB7P4zQpOw2ZTji7
lIlJuGHF4jmmI8eJx/ESUR/b8TiKyOfYgaZIctOx2nIYhx04hbt4ixJ48A53cRo7MBGVkGjVY/oK
fMVhRiGCtUsAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAjz5TjmmAQAApgEAADwAAQByZXMvZHJh
d2FibGUteHhoZHBpLXY0L2FiY190ZXh0X3NlbGVjdF9oYW5kbGVfcmlnaHRfbXRybC5wbmcAiVBO
Rw0KGgoAAAANSUhEUgAAAIQAAABCCAMAAAChK448AAAAM1BMVEUAAABgfYtgfYtgfYtgfYtgfYtg
fYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYurrs+rAAAAEXRSTlMA/7+AUCDPjzDfcBDv
YK9An2Ku5c0AAAERSURBVHgB7dnVYcUwEETRHTGt9fqvNn9hFk3gVnDM1ko+DJ/KGOu8LAufL8R0
HgEgl3oeATRbzyOApgQIwHgCBJojQADKgEBkQMAyIKAMCCQGRK4ECFwMCHQGRGZAQBkQmQEBZUAY
BgQ8A6IwIAwDAhSIzoCwDIiLAWEYEPhH/CP+Ef+IOQj+N2Zg+HYYhq+oZfifcBisynie4p8/E/xt
SyRYdwzeFEHmlAmW5WIJBhRSGwjmiJFgdCa1gWC4XMZfVMc+pc3LzHwbvxjj6dic/9jL4ibzuw0Y
TinGDeP3RZRV9Ta+KTlevQZ2JOflMj4qqyxP32dkW2VHavBWQWVbvrzmMMXL5rq9HiTmsr3Kd7sD
3uISdP3oFBAAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAqH3jTDHAAAAxwAAAD8AAQByZXMvZHJh
d2FibGUteHhoZHBpLXY0L2FiY190ZXh0ZmllbGRfYWN0aXZhdGVkX210cmxfYWxwaGEuOS5wbmcA
iVBORw0KGgoAAAANSUhEUgAAACYAAAAhCAQAAAAfMRGdAAAAGG5wT2wAAAAAAAAAAAAAAAAAAAAA
AAAAAP8AAADYHRhkAAAAOG5wVGMAAgICIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAMMAAAAAAAAAAA
AAAmAAAAAAAAABUAAAAAAAAAAdoOUbQAAAAmSURBVEjHY2AYBaNgFIyCUTAKRsEoQAGMDP+pZxgT
NV02ahjpAADfBAELe7XTvAAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC2uMjMMgAAADIAAAAPQAC
AHJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX3RleHRmaWVsZF9kZWZhdWx0X210cmxfYWxwaGEu
OS5wbmcAAIlQTkcNChoKAAAADUlIRFIAAAAmAAAAIQgEAAAAHzERnQAAABhucE9sAAAAAAAAAAAA
AAAAAwAAAAAAAAD/AAAAr4PKlAAAADhucFRjAAICAiAAAAAoAAAAAAAAAAAAAAAAAAAAAAAADDAA
AAAAAAAAAAAAJgAAAAAAAAAVAAAAAAAAAAHaDlG0AAAAJ0lEQVRIx2NgGAWjYBSMglEwCkbBKEAB
jAz/qWcYEzVdxjQaOSQDANtoAQUTLOg4AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLTtmRBuwAA
ALsAAABGAAAAcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfdGV4dGZpZWxkX3NlYXJjaF9hY3Rp
dmF0ZWRfbXRybF9hbHBoYS45LnBuZ4lQTkcNChoKAAAADUlIRFIAAAAkAAAACggEAAAAdq80VQAA
ABhucE9sAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA2B0YZAAAADhucFRjAAICAiAAAAAoAAAAAAAA
AAAAAAAAAAAAAAAAAzAAAAAAAAAAAAAAJAAAAAAAAAAHAAAAAP////95AnfuAAAAGklEQVQoz2Ng
GAUjGDD+/08dg5io5SKqGQQAtscCBHOggcIAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAhWeLvW6
AAAAugAAAEQAAwByZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY190ZXh0ZmllbGRfc2VhcmNoX2Rl
ZmF1bHRfbXRybF9hbHBoYS45LnBuZwAAAIlQTkcNChoKAAAADUlIRFIAAAAkAAAACggEAAAAdq80
VQAAABhucE9sAAAAAAAAAAAAAAAAAgAAAAAAAAD/AAAANCaG+wAAADhucFRjAAICAiAAAAAoAAAA
AAAAAAAAAAAAAAAAAAAAAzAAAAAAAAAAAAAAJAAAAAAAAAAHAAAAAAAAAAHQvmebAAAAGUlEQVQo
z2NgGAUjGDD+/08dg1gYGgeZ1wD/6QKFnybKqgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECLLnx
DnQDAAB0AwAAKQADAHJlcy9kcmF3YWJsZS14eGhkcGktdjQvaWNfY2FsbF9hbnN3ZXIucG5nAAAA
iVBORw0KGgoAAAANSUhEUgAAAEgAAABICAQAAAD/5HvMAAADO0lEQVRo3u2ZzUtVQRTAf/apkaUL
S5Ii7MMoKbMPwsI0tSBJKspFgRVE7dr0BwQtFVuEfWgUrQzbVGhGJWREb5HpIrEwM8EwLdAiS7TU
2+Lpa2buhy+vd+5bvHM2Z97cmfm9mXPnnJkLUYlKVPTKSd5iOOgnbrFSH06RI8yk9pOuC6gmLCCD
Zu8QZkmlxWG2ymS7HqDesNvlRRpQth6gHsG+SYyiO4TanczRAdQh2OtMzzYzGLLj2awDqF2wN5ie
HeWlUNqtA6iboZCdwCrT043ee5EMZPBGKG0zPf1csHcpbT0BglfSkKq8FrwokY06gJoEO8fCiwJe
L5oKJLrtelIcvShLB1AXnSE7hv1KbSy5Qmm5DiBoEOxDCs599k5rX3clB4WoPkxi6Pf5PFJi/hE9
QHEMCoOeDeHUKzh39aVpYlYUmMB5qODUMk8f0GFp6E1+48BcvgqD36bOXxyAcof01QccSGMsknAA
aiMLB3IjCycY1SIKB/IknE6/cQCeSUj7/AfKlN61jyzQMehsh7peVpApZIixPPF7jpbQL8zRGPn+
L9sJyY8+k+Q/0mMJqd6bs8b/SDK9ElKp/3O0h1EJqcR/pAsS0LD/zj2LpxLST+kmZKqU+CLvGKaN
Gxy3OFhNU5bSJSENkBFWuyRalJj4niqOscw90lopjzQYCGOWkmi1TfTaqeSouwi5VTqPGAxOcbHn
hDOpfRS4QSpgRHHvElc4BgYjYS6+jRTzR+mw1HKrDBfHwOCeO18qYkjpsN4UUMw4FRRSRpNlrt7n
1r2z+a502SN5kxnnSqhuEQe4ZHrzXEsGfUqXY5QRZ4sTY+ohYWaBYDVtpqnvJN8C56oFTvD6cEaB
YCF3LPzhi1K+ZoPjARDAOX47vj/XbXE8AoIsum1xKh1wbIHcplsB0qm0/I8Ghr7vaqrk8MFmll5w
2uajl0dL9i/JKFPCihhg6jhliu8eAwGkUs24g4u3cpliUvUBAWyhYcrY9Y0AVbqAgh71wPZ+yVo1
yBoq+BVJQMHD9xkaHb0qqON6t4QUzhNQDlKydvixU8VTSDktpvROvJwHcNzcvTlQpU1oDMnE8oNq
aohKVKKiUf4CIzwOqrd0HjUAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAiy58Q50AwAAdAMAAC0A
AQByZXMvZHJhd2FibGUteHhoZHBpLXY0L2ljX2NhbGxfYW5zd2VyX2xvdy5wbmcAiVBORw0KGgoA
AAANSUhEUgAAAEgAAABICAQAAAD/5HvMAAADO0lEQVRo3u2ZzUtVQRTAf/apkaULS5Ii7MMoKbMP
wsI0tSBJKspFgRVE7dr0BwQtFVuEfWgUrQzbVGhGJWREb5HpIrEwM8EwLdAiS7TU2+Lpa2buhy+v
d+5bvHM2Z97cmfm9mXPnnJkLUYlKVPTKSd5iOOgnbrFSH06RI8yk9pOuC6gmLCCDZu8QZkmlxWG2
ymS7HqDesNvlRRpQth6gHsG+SYyiO4TanczRAdQh2OtMzzYzGLLj2awDqF2wN5ieHeWlUNqtA6ib
oZCdwCrT043ee5EMZPBGKG0zPf1csHcpbT0BglfSkKq8FrwokY06gJoEO8fCiwJeL5oKJLrtelIc
vShLB1AXnSE7hv1KbSy5Qmm5DiBoEOxDCs599k5rX3clB4WoPkxi6Pf5PFJi/hE9QHEMCoOeDeHU
Kzh39aVpYlYUmMB5qODUMk8f0GFp6E1+48BcvgqD36bOXxyAcof01QccSGMsknAAaiMLB3IjCycY
1SIKB/IknE6/cQCeSUj7/AfKlN61jyzQMehsh7peVpApZIixPPF7jpbQL8zRGPn+L9sJyY8+k+Q/
0mMJqd6bs8b/SDK9ElKp/3O0h1EJqcR/pAsS0LD/zj2LpxLST+kmZKqU+CLvGKaNGxy3OFhNU5bS
JSENkBFWuyRalJj4niqOscw90lopjzQYCGOWkmi1TfTaqeSouwi5VTqPGAxOcbHnhDOpfRS4QSpg
RHHvElc4BgYjYS6+jRTzR+mw1HKrDBfHwOCeO18qYkjpsN4UUMw4FRRSRpNlrt7n1r2z+a502SN5
kxnnSqhuEQe4ZHrzXEsGfUqXY5QRZ4sTY+ohYWaBYDVtpqnvJN8C56oFTvD6cEaBYCF3LPzhi1K+
ZoPjARDAOX47vj/XbXE8AoIsum1xKh1wbIHcplsB0qm0/I8Ghr7vaqrk8MFmll5w2uajl0dL9i/J
KFPCihhg6jhliu8eAwGkUs24g4u3cpliUvUBAWyhYcrY9Y0AVbqAgh71wPZ+yVo1yBoq+BVJQMHD
9xkaHb0qqON6t4QUzhNQDlKydvixU8VTSDktpvROvJwHcNzcvTlQpU1oDMnE8oNqaohKVKKiUf4C
IzwOqrd0HjUAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAvVuAnOAAQAAgAEAAC8AAwByZXMvZHJh
d2FibGUteHhoZHBpLXY0L2ljX2NhbGxfYW5zd2VyX3ZpZGVvLnBuZwAAAIlQTkcNChoKAAAADUlI
RFIAAABIAAAASAgEAAAA/+R7zAAAAUdJREFUaN7tmL1KA0EURk+CDyAipE9pYeG+gJA2ryA+gA8x
voSPYZVasEiroIWlVToXtU7h2knM3P0Z2PlBvzPl7PId2Hv3DgNCCCGEEEKIP8WkdWdKxUmk1Bce
+Ap7ZcaaJuJaMwsTWkXVaWhYhXyyQ947PuY4NBzxaVWKxTy6DkyY26UbVurRG2paWNe7g0GP3Y8U
d96nw7W9Ue11xHiFvLsqT6c1K4eQ68pKL+S6s1ILub6stEKuPyulkBuSlU7IeTMuq5Azhm5GoVvz
FJBRyFylzTIkJCEJSeg/C72VJnTBc1lCNQtfKW8NGUq5i9pTyt9le0oltP0vpTL+QztKpfwYf5SG
XTZcJlK643TYmTrOqrzcY57KmmU1i9KGa20LfSQJD0rZRK+gTZj9km1UnS1LO7j9vvWMK/vidgRe
ueERIYQA+AYIIuzfz/JGZQAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCEC9W4Cc4ABAACAAQAAMwAD
AHJlcy9kcmF3YWJsZS14eGhkcGktdjQvaWNfY2FsbF9hbnN3ZXJfdmlkZW9fbG93LnBuZwAAAIlQ
TkcNChoKAAAADUlIRFIAAABIAAAASAgEAAAA/+R7zAAAAUdJREFUaN7tmL1KA0EURk+CDyAipE9p
YeG+gJA2ryA+gA8xvoSPYZVasEiroIWlVToXtU7h2knM3P0Z2PlBvzPl7PId2Hv3DgNCCCGEEEKI
P8WkdWdKxUmk1Bce+Ap7ZcaaJuJaMwsTWkXVaWhYhXyyQ947PuY4NBzxaVWKxTy6DkyY26UbVurR
G2paWNe7g0GP3Y8Ud96nw7W9Ue11xHiFvLsqT6c1K4eQ68pKL+S6s1ILub6stEKuPyulkBuSlU7I
eTMuq5Azhm5GoVvzFJBRyFylzTIkJCEJSeg/C72VJnTBc1lCNQtfKW8NGUq5i9pTyt9le0oltP0v
pTL+QztKpfwYf5SGXTZcJlK643TYmTrOqrzcY57KmmU1i9KGa20LfSQJD0rZRK+gTZj9km1UnS1L
O7j9vvWMK/vidgReueERIYQA+AYIIuzfz/JGZQAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECfCpJ
f3QCAAB0AgAAKgAAAHJlcy9kcmF3YWJsZS14eGhkcGktdjQvaWNfY2FsbF9kZWNsaW5lLnBuZ4lQ
TkcNChoKAAAADUlIRFIAAABIAAAASAgEAAAA/+R7zAAAAjtJREFUaN7tl01LVFEYgJ9i3JSmIhom
QVNZixw3GYFuQtu0aRG1CaJFEQnRKiZatVDEpQtj5ge06B8kotKkhbroYwgag2b6IA0UEc0ZRwen
hRbec87M/fBELt7nbGbmnPec595z3nfuBUEQBEEQBEEQBOF/si9Q1CHaaCZMmDD1QC3VwDyrwBxp
MqT5SJLsvxZq5BLtnKfF0+gCSV4xyRCL9u/kSR4ywSbFAG2DUe5x1JZKBdd4EUjE2TZ5zmX2706m
hsfMui61RoYZUmTIu479QpSqYGfoAPeJUmvsSzFFkk/MsMJPpa+JSs7QRoRzHDZGL9DPIHl/R/0O
cyWvst7zPA3Ml5jjO7e8J9RpJsre9gofl/ajzDwJmt0nCPGInMs5sCVUJEuUUPk6M24MHKdgQehd
ibkbSwV3GDMqQRewbkHoCBeNFzxLhyn0rmPRrfaGC9u9doQAunirrbNOtxrYqVXhXzzYsb/2hCBE
lFWtbHY6A3uUAWMcc/TbFAI4zpiyYu9Wx59SPqVVkKzj78MGlTs+Lzq+AUyrw2OK8Qca/m5nykra
L3B7uxjWMK2sFjNV57hBqYlnyq85X48sKSV6krMGnbh5Tl3pM8taRoz42qYnWnyBb950zEpqWyLi
S6hOu0dF7zruSsOc8H2UqxhgI6hOOaWvXA2cX628DKpjVsrTx8FdJv0N7YEm7j09nErDnLJSh6od
mxfz+8Zzk/fkeM0Vqy8LEZ6SJsF1eQMVBEEQBEEQBEHYm/wGxKNido1iA74AAAAASUVORK5CYIJQ
SwMEAAAAAAAAIQghAnwqSX90AgAAdAIAAC4AAAByZXMvZHJhd2FibGUteHhoZHBpLXY0L2ljX2Nh
bGxfZGVjbGluZV9sb3cucG5niVBORw0KGgoAAAANSUhEUgAAAEgAAABICAQAAAD/5HvMAAACO0lE
QVRo3u2XTUtUURiAn2LclKYiGiZBU1mLHDcZgW5C27RpEbUJokURCdEqJlq1UMSlC2PmB7ToHySi
0qSFuuhjCBqDZvogDRQRzRlHB6eFFt5zzsz98EQu3udsZuac95zn3nPed+4FQRAEQRAEQRAE4X+y
L1DUIdpoJkyYMPVALdXAPKvAHGkypPlIkuy/FmrkEu2cp8XT6AJJXjHJEIv27+RJHjLBJsUAbYNR
7nHUlkoF13gRSMTZNnnOZfbvTqaGx8y6LrVGhhlSZMi7jv1ClKpgZ+gA94lSa+xLMUWST8ywwk+l
r4lKztBGhHMcNkYv0M8geX9H/Q5zJa+y3vM8DcyXmOM7t7wn1Gkmyt72Ch+X9qPMPAma3ScI8Yic
yzmwJVQkS5RQ+Tozbgwcp2BB6F2JuRtLBXcYMypBF7BuQegIF40XPEuHKfSuY9Gt9oYL2712hAC6
eKuts063GtipVeFfPNixv/aEIESUVa1sdjoDe5QBYxxz9NsUAjjOmLJi71bHn1I+pVWQrOPvwwaV
Oz4vOr4BTKvDY4rxBxr+bmfKStovcHu7GNYwrawWM1XnuEGpiWfKrzlfjywpJXqSswaduHlOXekz
y1pGjPjapidafIFv3nTMSmpbIuJLqE67R0XvOu5Kw5zwfZSrGGAjqE45pa9cDZxfrbwMqmNWytPH
wV0m/Q3tgSbuPT2cSsOcslKHqh2bF/P7xnOT9+R4zRWrLwsRnpImwXV5AxUEQRAEQRAEQdib/AbE
o2J2jWIDvgAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECYSLgyA0CAAANAgAAPQABAHJlcy9kcmF3
YWJsZS1sZHJ0bC14eGhkcGktdjE3L2FiY19zcGlubmVyX210cmxfYW1fYWxwaGEuOS5wbmcAiVBO
Rw0KGgoAAAANSUhEUgAAADYAAABICAQAAAAXZM7nAAAAGG5wT2waAAAAHAAAABUAAAAgAAAAAAAA
AP8AAAAb/zlWAAAAUG5wVGMAAgQGIAAAACgAAAAAAAAwAAAAAAAAAAAAAAAAOAAAAAAAADAAAAA2
AAAAAAAAAAUAAABCAAAASAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAAGXPXkgAAAFUSURBVFjD7ZQ9
bsJAEEa/NY5AIqJ2SccF0nOJ5A70kZIiXZSOK9DQU1BTJFdAVNyAii4SCrb3pTAigfBjg0ORzCtc
2Dt6OzOekQzDMAzDMAzjP+MOf+ZasdyxUz/DhK7c+/br8ECEc+heT/pQpaAsVVUvesY58l7PEVCl
zyn0qRFQpCI4HDWGwDK3ZgkMqeEoXPxAosEbkOZSpcArjSyyMFQkIsZAfFQVA2OiLOokCCSaTIHk
oCoBpjRPzGojuxtmgN+r8sCMmzOy2tC1meP39C7FM6ddgmqtu2OB35Gdx7PgtiSVJBFKdEhJt3Se
lIROdqI0CCQeV0X7roKHM3+LnUMeSnSBeKXzxEBXIiw8xHlWmERvPQYJ0JMKrqaCK2wAxMTA4KTV
VKhzdUYAjKiX3q0duogJE6JfVq11LVoXUGW9+3peQhdcJCvDMAzDMAzD+DN8AuLDC5nYbwUmAAAA
AElFTkSuQmCCUEsDBAAAAAAAACEIIQJ8MdGWEwEAABMBAAA4AAEAcmVzL2RyYXdhYmxlLXh4eGhk
cGktdjQvYWJjX2J0bl9jaGVja190b19vbl9tdHJsXzAwMC5wbmcAiVBORw0KGgoAAAANSUhEUgAA
AIAAAACABAMAAAAxEHz4AAAAJFBMVEUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AACmWAJHAAAADHRSTlMAM5rb+/8Knf7EAwaEqdlqAAAAkklEQVR4Ae3YoQEBUBSF4VeAKInABiwA
A8CBpqmSDIygy2xgOhO8e8Mt8H8D/P2cBAAAbLWeDMNmcmyvMq32yVS8ybHemIGSXDszUJfraAa6
ck3NQF+umRkYyzU3A5J0T1lVSfrqAAECBAgQIECAAAECBAgQeD2ynnYgPjzj0zc+vsPzP3xAhC+Q
8AkTvYEAAMAbMAOFZzjp4QEAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAjt03sTcAQAA3AEAADgA
AwByZXMvZHJhd2FibGUteHh4aGRwaS12NC9hYmNfYnRuX2NoZWNrX3RvX29uX210cmxfMDE1LnBu
ZwAAAIlQTkcNChoKAAAADUlIRFIAAACAAAAAgAgEAAAAaTepQAAAAaNJREFUeAHs0EENhSEMBOE5
Ywe3JLj5XSCFhD4L79T2MN8o2EWSJEmSJEmSJEmS/jJZHC6R3OWwmJQabB5R2GMz6uZ/RIO+qgs2
0aRNgclrc8Bjkm4RjVqkO60OOKS7rQ64pIte/di3g9OGgiAIop2YjFL7RnkoyP13+djHAUNBYc9m
UA/2Nv3HARZgARZgARbg5P2fAU4eSS4zAJ+fEtgA+Py+lxmAzy+BFIDPL4EUgM/3A/D5fgA+3w/A
5/sBuHw/AJD/nY8fgMu/8vED8Pl+AD7fD4Dm+wHeOVy+H+BK8sgB8uUAzc8vCO48h3w7QPNLAOSb
AZpfAiDfAjDklwDIdwK8kpkAyzd+gRIA+S6AgeArN5DvAhgInrmBfB3AQADk6wAGAiBfBzAQAPku
gJkAyDcBzARAvglgJgDytQAlgPL9ACWA8v0AJYDy/QAlgPL9ACWA8v0AJYDy/QAlYPL9ACVA8v0A
JSDy/QAluPZSlAdYgAVYgAVYgAVYgB1O7nR2x9M7n/9p5w4EAAAAAID8XxshxEBhoTFR2ehUVVVV
VVVVATgkwCQjgxRXAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQIMDuocEQMAABEDAAA4AAIAcmVz
L2RyYXdhYmxlLXh4eGhkcGktdjQvYWJjX2J0bl9yYWRpb190b19vbl9tdHJsXzAwMC5wbmcAAIlQ
TkcNChoKAAAADUlIRFIAAACAAAAAgAgEAAAAaTepQAAAAthJREFUeAHswYEAAAAAgKD9qRepAgAA
AAAAmD37ZVEniOM4/haDiCIiBjUaNByC1WzVttENPgfTatynYDNsFy5ZBfOVy5Y7DXLh5IpwIAc3
vz5fBrnfOTPr4evzAOa7s/OPGUsaDIlI2LDlyBmF4syRLRsSIoY0+JOKBCx4QV0OLywIKPJHZBmw
5BP1w3yyZECWm1Ziwh71i+yYUOImFZjygbpCPphS4KZkGHFAXTEHRmS4EU3WKAtZ0+QGjDmhLOXE
mFTLk6Au5J0VMSE92lTJkaNKmx4hMSveUReSkCel6jyhzOGZiC6XdIl4RpnDE3VSqMWreegyp8NP
dJibpxKvtEiZB96MHx9T4X9UiI2d8MYDKdIyfn5Cjd+okRi7oEVK1A2Df0efa+izM0yEOv6RNyx9
j5S5ljKPhuUwj3cJSuSbGdc24xslkuDZGCXyRYgNIV8okTEeNTnJzyfAlkB2ASeaeJJhLQc/ITaF
ciKwJoMXI5TIDNtmKJERHhQ4yJUfF+SOcKCAc1O571PGhbI8FzDFsZK87aGPK315a0QJpyZyR/Z8
+pjgUJa92IxquFQTG/CeLM4MUFpiXItFDQOcWYr/X8G1ihgDSxwpimeOOT7MxVNKEScClJYOPnRE
HQFOLMRdnyfi7nCBC+KJM8KXSDyrOtBAaeniS1fU0sC6objn90i8IwzdD7sVPq3cT8dEHIF8it0f
yDdakyE+hVo1G6zbak328KmnVbPFuqPWZBuf2lo1R6w7a01W8amqVXPGOqUlh085Uc+9A+5T4L4I
3rfBf+3cbQ2AQAwD0EtQMf/GJmAicEB/kUD2nor7aOsg5CjsMrTlOjzhOuxBxJOYR1HP4j5GfI35
HN3wPd7nEpAQkRGSEpMTlBSVFZYWl1eYUJlRmlKbU5xUnVWe/mh9fh7r8/On+rwBBRMaRlTM6OQh
pd4zpGRKy5haVnFOr84rAAAAAAAAbmlnFZcI8+nrAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJ1
WQ5gsgMAALIDAAA4AAEAcmVzL2RyYXdhYmxlLXh4eGhkcGktdjQvYWJjX2J0bl9yYWRpb190b19v
bl9tdHJsXzAxNS5wbmcAiVBORw0KGgoAAAANSUhEUgAAAIAAAACACAQAAABpN6lAAAADeUlEQVR4
AezBgQAAAACAoP2pF6kCAAAAAACYPbtXaaSLAzD+yIgQZpgmTT6qBJIUW6YLuYJFq7EUwUtQrGbA
G9DeQoUU26WzFcHGZq9ALdZX2LApQkIILBtk83/785FEMzNJlvyeduCY45xz4ExCCuwR0uKBZ3qM
EYQxPZ55oEXIHgX+SR77XPMDmaMfXLOPxz/CYZc2v5EP9ps2uzisNZ9T3pAF+o9TfNaSS0QfiaE+
ES5rZYsDOkiMdThgizVR5h5JoHvKrIEjRkhCjThipWVoITP6SZuIgDpFXLbZxqVInYCINj+RGbXI
sKLyfEesTXjkhBqz1DjhkQli7Tt5VlCVV8TSgHMqfESFcwaIpVeqrJgv/LL++BCfz/AJrZPwiy+s
kKrl5//lkiyLyHLJX8sUVFkRecvL/0KDODR4sSyEPCsgY9n6vuERF49vlu0ww9K1jK/+MXE7Ni6F
Fkt2hGj9ISAJAX8QrSOWqMzI8PO/kpSvhikYUWZJtrg3vPwBSQoMC+GeLZbiANE6JmnHiNYBS+DS
Mez883BocsYtTwyZMGHIE7ec0cRhHvqJ0MEldZHh3PeYpcQFXcRSlwtKzOLxgihFpMynr63+BtPl
uOIdmdE7V+SYrqHtBH18UnWKKF0y3SEDZM4GHDLdJaJ0Sooc3rQ/OYvdDjfIB7thB7usNp1vOKRm
F1EKsXO5Qz7RHS52IaK0S2ra2v/fx2aHO+ST3bGDja+9A21S4mmfOc6xu0EW6Aa7c+1Tikcq9rXL
rgo2h8iCHWJT0S7O9knFtTLsIzY5BsiCDchh86g8e00atE+cJ9hcITF0hc2J9lk1BQVEqYZZiXck
ht4pYVZDlAokbk+757e5QGLqAgvtO8IeiQvnPHwcukhMdXHmPJDD9K/AIsyaSIw1MYvSvyJ7UIYM
MDtDYuwMs0B57oHEPStD1jG7RWLsFrO68twziespQxYxe0Ji7AmzovJcj8SNlSFdzIZIjA0xc5Xn
xiROlLYxmyAxNsFsG1HaTMBmCWw2wc0x+H8791IEAAiFANAZU9i/GFGM8E6OB3ZT+AEchByFXYZc
hz2IeBLzKOpZ3MeIrzGfoz3f41lbQEJERkhKTE5QUlRWWFpcXmFCZUZpSm1OcVJ1Vnlafd6AggkN
IypmdP4PKaVnSMmUljG12Znm9F4dcgAAAAAAAC5iAPQES++moAAAAABJRU5ErkJgglBLAwQAAAAA
AAAhCCECbdR1fMkJAADJCQAAPQADAHJlcy9kcmF3YWJsZS14eHhoZHBpLXY0L2FiY19idG5fc3dp
dGNoX3RvX29uX210cmxfMDAwMDEuOS5wbmcAAACJUE5HDQoaCgAAAA1JSERSAAAAbAAAAGwIBAAA
ACVvn0YAAAAYbnBPbA4AAAAOAAAADgAAAA4AAACx4SNC/wAAAHbmH3MAAAAQbnBMYg4AAAANAAAA
DgAAAA4AAAALMt0mAAAAZG5wVGMABAQJIAAAADAAAAAAAAAOAAAADgAAAA0AAAAOQAAAAAAAAAAA
AAACAAAAagAAAGwAAAAAAAAAAgAAAGoAAABsAAAAAAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAAAAAA
AAAAAAAAszcRtQAACOBJREFUeNrtnGtsFNcVx//3zuzDa+wYHOqQUjdBWKWFNCIUAjEhtCRpQEkK
VdOivL5YTcExfCh8qpBKI7WojaxU7sMVVaSqUpyUkBKUKpTwTDHCCELV4BYqIyMIlW1s4zWL9zGv
2w9zd3bWXu/OXe/jRtoz2rXkDzP3t/9zzpx7554BKlaxilWsYhX7/Bop4/nZ5w+M5LwGKzYiKdrZ
SI4rsAxQTEawdBAi4IpsWtCyg5FJ3yQDYmas1DfLAFlWsHScyR/XFeYT4AbLAJbpM2M4UlAo9zdO
NTY9VNWkLFQW0PmoISFUAYixKCLWDbPfvBLr67vw6HUHxv1dADhSQCj+t+uuxzeEnvB9k9yT+yRs
UD8RPXL0w+fHXWgFVU4ci4CAQoECFT74EUBwW+3g5tghLaExwSMROzS4eVstggjADx9UKFBAnZ+r
ZIql60RAQPbVPbE19IoXlaZXL7r3SOf3w1y1qdqVXquuhvDr2h1hnTIdd8KvdzUUTrd8sDjUstCt
tvhwQaD4ER++1bYs5ILLC43MyAXpPxct+oPycOF/P/Ps5S1LL8PK3yVJ3lgUZLS15ucIFsk3YpFd
9b8Hc+AE0WheWBS0ozbSVdNeNCygqqY90tVRC8pd0X3TL6BiqRNTEJCjX169nz5Q/ExlXez+3uPX
wLhyAqqRfLB6v950kMwrzQ2TDfR9Z8mn4mgiYDyyLj204ANSX7pagI32P/PVC1OirQBgbiza+0DT
oVJi2Wh965dchCWCRgWwCOjRxqaDpcYCSH3TwaONzv3MUxKhAlhKR83q/aWKrUnDmLd6f0cNFO9o
xCMYBYESeSuwqXzrTokDNS/AdGIthztS73oNt5YTCwhsGm71rhnxUBkSEChnvrbsdBFvx96SSPxC
86r/wEyr/vNQLLUgQxerD3aWGwsgwQc7F6ugXpaKqAfFKOixFnUFJDB1xbEWp8gi+cVY6lchv5ld
twuSWN2uN+pcUCQ/V+R6Pb+D3i0LGL375Z1eNKO546tjzqwtkMhmbemYkzvOaG69Nm8lIZnASGjz
1tya0VzxtSlY2wLJrLZlUzBXnOWKMdq+gTbIBkYb2jc400/hGCMAKJS5L0FCm/sSFFBnnIKKUdDd
s/1rZQTzr909GzTb6Om0EUZAQF9cT3wyghHfi+tdzkjEXJGC1q+DpFa/zrXMI5gVCWjVGlnBqh51
7mWCWZGC7r1PvozoDO+evfdli7Ksrti8FBJb81IxV0ylDlK9UGaw6oWu2oN4jzEKpXqB1GALnHuZ
QLonIKD++2UG89+ftvgtEGNEvVdmMPXebGUwzbKIQ5VZMoMps3jCF0r3BAQgVTKDkar8akUSoiQo
NVgwRMWXBoSeRZWPTXQGTQCQKFhcZioWjyKfGAPAYlKDxfJe8zAmZAYzJsTXPLjpAzKDZR9dJjBn
RXziusxgrtExr4rx7Vrj12QGG7+W7XESnUYvBgZ2s19msJv9ricuzGuMMQD4sFdmMD46liWtT/kf
hQ9+hFAdPaPOlTR1DFevwgSi0KDzjRKeYsz2XWukR1a9RnucfR8eYyyFZsHq75YVrL/b2R4hlO7t
R9jWnpNMl7Lq0PectEc4XV7Mlu5NWIfDYSmdMdxzOAwLpki6t82W2YR5/oCMYOcPwORbIyyxkorZ
isFoO66PSJcRR9qOw+CKMRGwZJSZsK4mruyTDezKvqsJe3Tirmg7owkTxs4uS6rpixXb2QUDJszp
HTFbjNn+a8A4Mtb3jkxgfe8cGYMBg+cBwRizXdGwj9Y3jTFpZmFjrW8mx5Wp4vACZkeZAeNU+Hyn
NPmw81QYBgweYXmDGdBhQH/qvdsXZcC6ffGp9+wRcb2mBVNyrAJR+9Cp0vvYRqKWOW0k9mw7MYQE
NGhcM+QLBt4XQbsjT8bnP1JesLO/bvkYCWhIQOPJA+KumEz5BnT7WPP20LFyYg0dW/N2ciy5sHKB
JROIDh0a9Gdfi/SVCyvS9+xr9iig50ocuV0x5Y4EFGTQHOz59pNqGTYgJUa2tx6+6bihnj2+vIEl
lSWgoP+K+s49so6WeE3fCP+qreMqNI6lOcXUDMGYe+f9x+GqT1Z8Sykhmj7+xvafXoKOOBJIIAGD
T1cKoFhqbzAFOX5LObvysVI5ZGLkl9t2X4YODQmeDT3o5Q2MTEb8x9hnJ9Yt988pPtadK22v/vYq
x4p7iy6xGEu6IwMBA/104qO/P91YU+Rn1APHN+z4aBQ64tAQhw6NTy8L1rSTvE3z7lkE4Icfyskf
rHyVBopVZfT8bu1fYPKUEXdlQ1ZIxdzKOcnkT5eiJ7+xKPiFIqxp9P7sxz/qhgEdCWiIu4oo5lUJ
70ZAoULlqvnt5tAq9YONq17x1RUwC4bP7H3m/ZgBAzo0aFytHNOUmYGBo/k4ms/ue11e+8eXv/Jc
IW4BZvy/7/7wz+duw+SlnI2lcywUB8zZsQMffPDDjwB88MEHBbS5tv25Jd/1z6AFSxvt/euOd0/f
doo4nd+OdScXFqmrNoVG4YPqoKm8X5nM83esXvX03OWimzeZPnzuzN+2dw9oYFwrw8EyoPOCl4kO
FMJw1HFJP/8oUKHaWyMfrvlJ8+KVDcsCHpoQEiNDn/y75xenz0ZSaywwebGrOS5oiTfl5/uugVT3
uurEmt1lnuw0xwvzNi6a31j/pbu+GGxQQ0qQBgArYcaNaHxo/H+jn924/v7ltwZccwi+EMFjy9bN
Qx1fSDB3a77tiimHtNHsojntZSUqAYzJ71lJroYlsXQOZrgmJyy/ASJvNLhepqA6YCoHo2k9lakr
uZ6YciiLQyXBDGfVcAZvhpjpG1j4pmgOpEKBDwp/qwN1Fc/Ja6VjMWdZ1oTuwJlp/bMoB1g6HOUv
qrCxVMchJ2++Y067tp0ukmgmTxQzhioMmBuOL/y4nJGCQEnbGJR8RJVyw2SEWWlN3JABbMqczVGL
TmkVZS7NLNe3h77L8oC510fSD2QAQ9oLZARa7csD5j4nyfCOqslomH6fhoxgU89Opkx+UBycilWs
YhWbof0fntKXgpL0xsoAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAuQdigEACwAAAAsAAD0AAABy
ZXMvZHJhd2FibGUteHh4aGRwaS12NC9hYmNfYnRuX3N3aXRjaF90b19vbl9tdHJsXzAwMDEyLjku
cG5niVBORw0KGgoAAAANSUhEUgAAAGwAAABsCAQAAAAlb59GAAAAGG5wT2wPAAAADwAAAA8AAAAP
AAAAjTkWQv8AAAC5kAHiAAAAEG5wTGIOAAAADQAAAA4AAAAOAAAACzLdJgAAAGRucFRjAAQECSAA
AAAwAAAAAAAADgAAAA4AAAANAAAADkAAAAAAAAAAAAAAAgAAAGoAAABsAAAAAAAAAAIAAABqAAAA
bAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAAAAAAAAAAAABAAAAAI5XOAUAAAoXSURBVHja7ZxbbBTX
Gcf/58ys7bUxEIwgmE2d1g5VpVakitqmaUgjKLRcSgJWFWp4MtCkaqO0RKXKQ9QUXkBWmiqN2kRC
PASCMOISXAhpuFahCBe1hKRFIjEONphgywRH9nrt3ZkzfdgzM2d2ZnZn9noqcUZ78Wq9e377Xc/t
A+62u+1uu9vyaKRi32D8P4KRLK8Z5YEkJfs0kuVbjADPJQEjrmckoCoaLihDFjAngvveX2KGz30R
4EgRoYjjmRcgfIAM118Fw6lFhErfiA+cH5p9y7Q2UggcKRqU+94Pzg/KeV+g5EgBWCKU/eh8Jbvz
MEHsR+crmZZXUjBbVl4w9oWX6p96cFpzzQPqV9S5tBZ1pA4w4oizcW1A65345IurnR+8NCogGT6Q
ecmNFCArEYfaSKuqty+Y9YOqx9Wv5vx0Q7uSPDN04rfvH5oUwJgLLA+5kbywnBKyoKbTc9+bu65m
OakP92sZoxNHB3Y/8o8R5gEnys0oDZjTpjLANkS3rrvnGdqSv5NlPXdef3H3joQLzPBwKEUEc2NR
835VzRvt03+F2UUI9oMjf3x656EJC43li0byxKL2rW/l7K20qXhZHusbfLGpi0Mxl80FRKN5YFH7
2t841jnnzWJiAbRpzptjnfsbxe8JFEBCS0zEohYaAe1fPfsVMq004yljZHDTlw5yiYlqGVBqNDQW
/w2X1ox03LuzVFgAmX7vzpGOpTWCzGgYqZHQWAQU9E8N7XsiD5d+gJ86v7Pt2dtcZiyM1EjAuCUo
IOjeuU92FeLYwwWBt1euGbDQREeSFY0EkBdxquFfWxYfoXPKNy3DPju+4sc9YILcDEdGEtrGMoMx
BQXdFysvFkDnLD6yL+bwjqKP9GlKADUUXMYrM9cdLa5zD+RI6uf9sOHg3xIeY3ASXhXFuMXBlkQP
HS6Hy/B2I6ueeC/hUkhfdSSBrCt9KXc66jZUbgo0vuOe30DnaDktLUgc43hXV1cSC6jbcHW1YGV5
BWh3Dq/sbYz9ARVusZf3NkLJHNB6Q5KsYKZ1qaCjndVLUPE2+V79U2DQHJbmqYw0p7woFJCelTJg
AdVLelaCQHE4fk/x0ADWRZZFY1sgSYttWRZ1QAW2MecUDQUF3dFe/tjlP6jZ0c69NLLJjOaIYxRk
Te2M5yBRm/Hcmlpu/1niMPVVQSs8d6yls2QCo7M61jqGniSIjREHHgWtV2Y+DcnazJ/VK1bm6OPf
aa6wfOpRpVk2MKXl1KO5QjX1ReKOo7kNErbmn3o4kBDOgy6urlsqI1jdssXVHCuQ8yBO+wLd/ljY
Wd1yDWS2PyaM0DysjGZJsyhobBEkbbFFXBURLPMgVvyioKBTFsgKNmWBMH8Ft5VlTanWT1XnyQqm
zls/NVxKZecctH1+GTa45G1m7fMFeQVMgnmMaGiGxK2h2Rp/5JCYc52fgta3yAxW32JJzGOlO2vm
UXu/zGC194fJPMyMg4CAqo0yg6mNwhJJiFyRgpBamcGIPXgJlXkQECo1GK3NyBNJEIkBAJUejIaN
YwHn7iqvjf49zeoV2bjMVGw8uFc04FjqYwmpwRIZK5xGMIkZgPQSA4ygcczeB0NAErdkBkvc4hLz
nA32S4INABjrlxmM987InQQbwhsJAAxfkxmM944I9mXksjH+hr4+mcGs3gVeH7N2DL7x31Jv+y+g
pXsXarXFaifHEr3Suo7ek2NZ8xKXtAzAXn0a6pYVbKjb2tLCkLlV2kdizFbJS2dlBbt0VlBBFiTz
MOXGwMA2X9DjMmLp8c0XhEV2DyfiZ2NcJXsnB8/ICDZ4unfSWwX9wZiwu5OBnT4sI9jpLkFe6R57
ZBmZfytQoKIK1ahBNBIdPhhtkgsr0TdzdSqBBCYwiSQ06NBzqaK9651LLqVf6pTOcXSm9IxttYFy
RXPPi56+NnalbsuElbq9scvsm2OTX4AAbUtMB7syfnGXTGAXd10ZT/dM2OkRACwtVtM0NTCwtgMT
N2XBmrjZdgAMDJrQS4+kKoAqQu9PHH9NFrDjr/Un7J6FU0VRZgwadLDWU0PnpEikzrWeAoPONx35
yit7gGbQoUODjhT0Tdu00UpjaaObtqV7w108CxOg7SDN+D9rYND2DR3rqDTYsY59Q+neWH3zDM7Z
hy1m7qFBS/8+rSd6DlYSq+dg6wmuQ5q1/80IOmwR7cyUmY5UGm7hq3c+rBTWnQ8XvsqhUrxX5oAl
JJjpFzVbZreSa14Yv14JrPHra164lczsj59HBLLt4nYe0eGLNdeSV88uX6SWeU5/YnjDL44OIwUN
SSQtsKyqqGT9RHGLOl+LupwYPrfo8XKiTQw//+yum9CRclxmtoh8JQbHFiSA/nv0kzNLH4lMK5cS
rv/l7gHu5FOY5FhaNjXMLTEvOIBcTnSfXP6N6OzSY33+0U9+/c5tjpUUpMWyyyuYKsKNdi2568SK
qQ1fKy3Wx4e+u+U/cR6O01hJ7hOZd/QKLjEnlrC6EWd/7v56/wMP0epSZRmHty3cE9d4sLGlpVmB
2SgELLPKg+Nc+v5PLx9f0DQlVnysW+c3bt76EQxo0KFxSTmxAnU8t5UpUBBBBFWo4o8qVCigoG99
f8XPo0U8n5T47Mhf1v6dpweaJa0kf8wRv4KDwdp9ryAC1UKLcDQFZG7V7ie/1VY1o3Co5OcX9qx7
eyApJAcpC0uz7MsohsTsvVUKVKhcXiZa+lUC8uXo60u/3Vp3X/5Q8ev/PPDMsU/TB7w1nn6nLJeR
EsIyigNmo6UlZGNFbIUEAVGVl+cv+1FsgVIXdvrzxvvvvPv8JU23Um9TWjaazkdhAU9ChzngTUE4
WoRfioBmHqahjZHff/Ph7zQ+VN+Uu4jCaN/Nf53v/t3FmylrvkkXsHQhcul8MiDgAe9wR/JtNNWy
sgh/xc4p0+/Dg3Xt81pisfumza2bpdbQqBoFtARLaBPxoS8GblzvubHz4w/ifLRujwHN4W3KsjAt
PFb4IgrUUknVUsa07VF+lIYKpxhyFyoxpyGEWTFuS6YiapYKhsAKFqBFNMPRKSZ0DY7JS+/CI2LN
DibMq5jjPs0a+yWR4nm8LkSuEMuQ4YoBGSDWL2eC6WBQoELnlqYIKinu1nVWErNnb53TEMIsC4ey
s/hQq6thqxyZaERQIQYFOhSo/JFAEaoSeGxEtpYX7R/Hdho2kOZYKCpxaRln7kj5eUCFxzPFITHR
1ohrdO60LVEZWQZUHliFlW+yDzuaQEr62GPWYhXO6kZMmL9kljLquQ4qlg7M50CxAKW4zplnzjQb
lh+0XUjAw8ClBHPD2fMjilCmQhzHpecskVHRiHEHEaqWQGnB3KM1IiCJ7sOtimLxEeYq/1NwWbvi
bLb0q3+U28YKrGVUajDnjJZzpgQ+cQyugmh5l0MrLVjmiDtTUpmlPg2g8Apv5QNzTwK5v8dd+1Le
HVvytf8Bw7pvWoRCwssAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghApuPBeyfAQAAnwEAAEQAAgBy
ZXMvZHJhd2FibGUteHh4aGRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF90b19wcmVzc2VkX210
cmxfMDAwLnBuZwAAiVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAQAAAD9CzEMAAABZklEQVR4AcXY
xWEWYRRA0YNMCojbEg21YBt8i61wrwHi6SRSQzwrrAScuD6yw+GXeXBPBfPpzKigVmf1GvfCO2u7
3nlhXK+zWtVZk1um7Ijf2DHlliY11eGpJVGBZYM6VdV+9yyKKiy6p1BhB82KGszpUUEnfRI1WnTa
X7piS9RhyxV/6LoowXW/6YQtUYItJ/yioxZFSZYc9UOFeVGiBYVvc0+U7L5v6rQoSraoE4AhkWAY
oNmKSLCiGbgpktwEpkWSKWi1I5Ls6OScSHSRXpGol3GRaIzXItFrPotEn4lkItV69hC9zZ/k/GWa
vtHOiUSXaMs+7DKP62ngtkhy+x9dmQyLBCPZry1dvul+7osXhVlRojmFHzrkU4m3wKH81/fMD5D/
+AkFp0v6CEz4jJ13TIU1eGylymPhiQZV1eVZxb8ShnSrqWa3TP/xZ8i0W5rVWZtzek146b2NXe+9
NKHXOW3+2hc5dAl3Vyro4gAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECuASpg3cCAAB3AgAARAAD
AHJlcy9kcmF3YWJsZS14eHhoZHBpLXY0L2FiY19zY3J1YmJlcl9jb250cm9sX3RvX3ByZXNzZWRf
bXRybF8wMDUucG5nAAAAiVBORw0KGgoAAAANSUhEUgAAAEgAAABICAQAAAD/5HvMAAACPklEQVR4
AdXaJZweBxDA0Rdm1AF3ny+ZMntRUsfnLpyYsows1/tfGV3IlxnNXZiZdurCdIvT//NqeWeUbIa7
DdnqQz+YdEwIx0z6wYe2GnKPGVpqpTU+dljcxmEfW2OVBpur33aFmILCTgPmqr0lXrZXlLTXy5ao
rdk2OiQqOmSj2WroMb+LmvzuMZWa712FqFHhXfOVrM8PogE/6inRU46Ihhz1lCk24Lxo0HkDptCo
QjSsMOoOe84F0YILnnUHPeasaMlZj7lNfY6IFh3R5xbN94No2Q/mu2nviA684yY9oBAdKDzI9c30
vejI92a6rg2iQxtc0xIHRYcOWeKqXhIdew2Xmme/6Nh+81yqXyTQ71I7RAI7AVYpRAKFVcAakcRa
4GuRxNcw00mRxEmzuE8kch9jIpEx3hSJvMXnIpHP+EEk8j27RSK7OS4SOUYk46xIxQGRyHH+zXZS
f5vtsv9cJPJ5tkfH2+kerglfP2alekGbnfAVlrUiiXXZPoNWA+wUCezK9ik9kPhnA6+Ijr3uqpY4
JDp0yFLXtFF0aKPrmukH0ZEfzOT6HkzxWzjBj/N33bT5fhIt+8l8t6jX+vCll348dX0vtDbAe94d
NtbKiHPsfzwEhqcdbXBM/rQS9fwoGvCznpLN917tqxbvm69Sj/tD1OQPj6uh2TY5LCo6bIvZamuZ
1+yv8Db4muVqb54Bu6a88rXLgHkabLV1vnZK3MYpX1tntZaa5b5La4O7nRTCSbsvrQ3eZ5ZS/Qco
/dcdnBhAhwAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECllPGx64BAACuAQAANwAAAHJlcy9kcmF3
YWJsZS14eHhoZHBpLXY0L2FiY19zcGlubmVyX210cmxfYW1fYWxwaGEuOS5wbmeJUE5HDQoaCgAA
AA1JSERSAAAASAAAAGAIBAAAABQb/JcAAAAYbnBPbBgAAAAkAAAAIAAAACwAAAAAAAAA/wAAACtu
DbEAAABQbnBUYwACBAYgAAAAKAAAAAAAAAAAAABAAAAAAAAAAAA4AAAAAAAAAAAAAAgAAAAAAAAA
CAAAAFgAAABgAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAxGWaewAAAPVJREFUaN7t170NglAYhWFI
jAU9nY5AzRYuwCKOoHvgAOoS1OoGdGJroSYeaxNjuNzvI5q8T09yws99Q5IAAAAAAAAAgAOtZGkd
PyhVbTanVmpxj6bamczZa2r12DI10XMaZZZvUq5j1JyTcuuXe6Z28JxWM4/vrVA3aM5FhdcRUOoa
POeq0vNUWugeNOehhfdBWenZe85T1Rhn97L3oOVv5WQ9Xt/65MQmEwE52X6dszPLhElObDMRkJPD
xzlH80xE5cQnEwE5Ob/N6dwyMSgnvpkIyMlNknR3z0RQTowzMYm5ON1oniTphl8iAAAAAAAAAPgX
LzaGlCrbSd+9AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQIhHiDfLQMAAC0DAAA5AAMAcmVzL2Ry
YXdhYmxlLXh4eGhkcGktdjQvYWJjX3N3aXRjaF90cmFja19tdHJsX2FscGhhLjkucG5nAAAAiVBO
Rw0KGgoAAAANSUhEUgAAAF4AAABACAQAAAA5BwgOAAAAGG5wT2wQAAAABAAAABEAAAAEAAAAidL1
Qf8AAADyNm2+AAAAXG5wVGMAAgQJIAAAACgAAAAAAAAAAAAAAAAAAAAAAAAAOAAAAAAAACkAAAA1
AAAAAAAAAAQAAAA8AAAAQAAAAAAAAAAAAAAAAAAAAAEAAAABAAAAAQAAAAAAAAAAAAAAANWRNaEA
AAJoSURBVGje7Zo7T1RBFMf/IwlL1hUfuw14EzRZeTRYqNHGD0Cx2ZKKT6DRUlsCfAGFaEVDvR+A
mkYTWA2NSzSBBSVZczewjwaM+VPgI5IQRubMnL1h/+29ufc3J2dmzgvoqquLJSP1IfbgHh5jHHcQ
4Sr6TzxuooGv+Ix1rGDN/OyY9TPFSZa4T1vts8RJpvTBs5xmzPMo5jSzeuBpzrJFF7U4y7QGeoFb
lFCVhbDgfXxNSc2zLxT6AMuUVpkDIdCHuUkf2uSwb/Q8a/SlGvM+0SOhTXr65o38XUZl+lbZ0+XF
BYbQgg/0IkOpKByY8QoqGAx0Fu9izDRtXrxk+cGXwdCBQbwQtDyz2EIm4BXexi1Tl7L886DoQAbP
hCzPXnxDLnDcF+OmOZSw/ERwdCCHCRm3mVJJF6YE3IYpxIE9/vemzZkDV8s/UEEHMrjv7jYP1fLM
R+7wI2rwI+7wo2rwo+7wQ2rwQ+7w19Tgr7sflVSsRRqZqFJDAuFBSw2+7Q6/pwbfcoevqsFvu8NX
1OAr7vAbavAb7vDv1eDfXeyQ2BxgWcXuy2eh211SSyrwFn+1S8B3Ebp7JJWAm0O8CW73t2ejd27R
6baJZaoHMHW8Cmr3eRt0+0JrPz4lttBqmngSzO5P7dD/S1wMUp1f9GIQpvnBO/pHbx1xRtz2ir7j
raEGeG5lfvfaygS8NpFDVIgS3L4HEj048WsBBVYTObLy5+iccx4WmuNltUyNWc6wfi7wOmcUx7T+
xvssssSGNXaDJRbZK1AOFFvC8WjiXeQR4Qb+dYYfaGMPNXzBOlaw2kGjiV11lSgdATaR1BjqlqI2
AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQI+OQSkygAAAMoAAAA6AAMAcmVzL2RyYXdhYmxlLXh4
eGhkcGktdjQvYWJjX3RhYl9pbmRpY2F0b3JfbXRybF9hbHBoYS45LnBuZwAAAIlQTkcNChoKAAAA
DUlIRFIAAAAwAAAAMAgEAAAA/QsxDAAAABhucE9sAAAAAAAAAAAAAAAAAAAAAAAAAAD/AAAA2B0Y
ZAAAADhucFRjAAICAiAAAAAoAAAAAAAAAAAAAAAAAAAAAAAAADAAAAAAAAAAAAAAMAAAAAAAAAAo
AAAAAP8AAADlpclQAAAAKUlEQVRYw+3PsQ0AMAgEsSf77wwVE0R09gKnSwAAAIBV6dvAuz4QEPg3
LZcBD0G2iDMAAAAASUVORK5CYIJQSwMEAAAAAAAAIQghAo8d8sQBAgAAAQIAADwAAAByZXMvZHJh
d2FibGUteHh4aGRwaS12NC9hYmNfdGV4dF9zZWxlY3RfaGFuZGxlX2xlZnRfbXRybC5wbmeJUE5H
DQoaCgAAAA1JSERSAAAAsAAAAFgIAwAAAGJ+jYMAAAAzUExURQAAAGB9i2B9i2B9i2B9i2B9i2B9
i2B9i2B9i2B9i2B9i2B9i2B9i2B9i2B9i2B9i2B9i6uuz6sAAAARdFJOUwBAYIC//49Qn+8Q3zDP
IHCv0if1wwAAAWxJREFUeAHt2gWyqDAQRNGONMkk2P43+12eGwzQVdwVHJwIdi3ElDM/HU4pDH+o
EuBSjaQKuKXOTR3NNW7seK4OOHRSCNwGUgk8TpQCF6MUOHK31LxU81LNS7g3UgvcTAycqQVO1ALP
FANnMXChGLiLgSPFwF0MXCgGzmLgmWLgRQ08iYFnioEXNfCqBjYx8EwxcFEDJzXwqgbOamBTA/Mz
3eAbfINv8A2+wV0NnNXAlS5leJXUwIEuDfCq0aUFYq+JALGnTmz6nRP8al7PnNS4udxLMr73xArX
qtMdofOxM7WtBwnQOsUztE5xhXtB7AQD1eEOVtmiZA1HVFzewQp/FCsOqnXuUW84qtG4PRvhkONt
HHFkUcy7XTwAUuIFx1fM4X5wbez8WhZwTm3lV5pmnFY0hx8e11rl58ojTi5kfrwecYFCduD6Firf
L0dcqBZXvlVPM65Wi7XzpWxdZly0FlLN/9mW11T2xX4HiRKEt8wxhxQAAAAASUVORK5CYIJQSwME
AAAAAAAAIQghAt753W4BAgAAAQIAAD0AAAByZXMvZHJhd2FibGUteHh4aGRwaS12NC9hYmNfdGV4
dF9zZWxlY3RfaGFuZGxlX3JpZ2h0X210cmwucG5niVBORw0KGgoAAAANSUhEUgAAALAAAABYCAMA
AABifo2DAAAAM1BMVEUAAABgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtgfYtg
fYtgfYtgfYurrs+rAAAAEXRSTlMA/7+AYECP759Q3xDPMCBwr1P1ev0AAAFsSURBVHgB7doHDp0w
FAVRXxfcwHj/q41a9NITvigZiVnBoePijqTDeR9ico+lD/NLgoCtXCoEbLXQWWAp302WYGSdUEsw
sLR0GFjrBgMrVxhYigTwA2LRxKKJdWobDZw7DCxPAyvQwBo0sKeBVWngRgMr0sCNBlalgT0NrEED
7zTwSgNr0MA7DTxp4EwDa9DAlQYONPCkgT0NnGlgveAX/IJf8At+wUdq77/E17wuqdDAwV3VoktK
7qp2XVJ3V5UgLwkL8sxZq2CT8AvjFrYqasyMXJaZjDvCqpB3hJUZnzkr0LYgDMgJtgrjBFsDcoKt
wHhFWD0ztilZFbK9w5qAv4jv6k1n1Lq7qy2f4M2bu68IuoHPEkd3bwvEa+0QrxUBe+C/L2V9Vtvc
M41VnzS7e6ygw+XonmzzOlbp7uFiO8D1yVkPkwFcK3r9vXIe94RGaPpTM3b3vzX2mWVZrZyvPatR
w/TZqL6EdDL2C4iyHuq1a5H1AAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQJqIR8NkwQAAJMEAAAq
AAMAcmVzL2RyYXdhYmxlLXh4eGhkcGktdjQvaWNfY2FsbF9hbnN3ZXIucG5nAAAAiVBORw0KGgoA
AAANSUhEUgAAAGAAAABgCAQAAABIkb+zAAAEWklEQVR42u2bTWxUVRiGn2mpjBYtXZCK/Imi1ASB
mLb8pKmWYAkQIMGYwIYokUURSti5MDFGCAFSlAUaiDEsSYCuNMQYCEQM1C60kcR2gDQIFGgsFMJP
WwqXxVDaOT8zdy4zc7+T3Peszp0z577PnPPde75z70CkSJEiRYqUqhK+op3HeBnLAO38wGRZ9mP8
6sP66HKfNZIA1mZp38NjkMVh2S3SjiwMNOl2ywEoD9TPXGqlAFwP2FODFIBrAXuqkwLQHbCnecRl
jkAbMWOJ8yClXZwaGQAXlfrblm8OcFY58r4MgCvcTamXWe+0JyVEgQ7gkVCOzLJ895RSX0CJBADo
VOrvWb7bSn9KvZQqGQDnlLrNVr8WBXUyANq0qYHPKAgljHWN15bSb1lafqC0u02xDIROxdhnlnZx
HigtqyRMIbS53WCNgtawo8AMcEKpL7ZODRXgXRlTaJIWBeZfdiF3lHa/yBiBq3QoR1YbWi3gGC9r
93Eh2qv8speIKS3mc9uQXH4kBaBes1brw/45xkgBKKZHMbc/Ze3fZ7B/k0pJuxMHFHu3niUsNRb7
VYjSEs3iOgCqueWCfSjmimKy1SX7ANs1o40u2Yc3fe2PirWfXFI4bR9Wum0fYiRctg/Q6LZ9eInr
LtsH2Oq2fXiRqxpAE07pcw3gEuNcAijRknyP79wag+UawJBLUQBwTEP4m7EuAcykX0P41q0x+FID
eMxSt0K5XUO4wasuIVTzUEM4EXYan81mbDcx6pVj05lQ+M2s58H93bCwaHRpGk0zJJWD2riI1goe
aQh91sdQIvW1YRr1PMem1hvsIcE9LtJCE3PyD1DEzwaEy7weqLePtR3um7TQxOx8IrxiuCd4XAiA
sN4wIYdLL0fZnK8nDpO1ba/kKFTmzP5I+Z8jbKA01whzjPvTPVmEsz/7IxeKLblGqOOe8USL8mA/
Wb7JNcISwxrV46GPW1sQ+x6PmJtrhFUMGE+1L+0aKZh9D49DuQ/nZdw3nuq4daVqtt/BSrZxmsG0
AIl8XJEWcdd4shvGfMFmf+LTz0tpYAdnDCvfZCqbF83XHkgNpzzNyis4Zvudz+yPaBxL2cmfWts8
aQbnLYP+16j032b/tTQ9FwgAJvCHBWGIZkqt9hNp7RcQAF7gR2vwdbHLYn9Shl4LCACwMcNVJLWc
z2i/4ABQQ5dv+35e3C84AJRx1If9Cz7/dxACAMA6etPaH2KVz55CAoAKDmcYgzOs9bE9GRoAwGq6
M0D08n2alwpDB4ByfvIRD100U6u90CMCAGAeJ31dlXo5xHpmyANIrln/8X13uEYLX7Ds6fpICAAU
8Sn/Zbn676NNDgBAnI10BExlRAAAxFjBcZcBhvc0DhrzaWcAkkuOT/iNoSzTenGqYJM1k9DLv1I3
jCtYwwFrVjdStushJUtTqKead5hFheHT03yo/GtEHMDoCJlJJdMpp4wipnKZUxyUGAORIkWKFClM
PQFRnIrNVWSHLQAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECaiEfDZMEAACTBAAALgABAHJlcy9k
cmF3YWJsZS14eHhoZHBpLXY0L2ljX2NhbGxfYW5zd2VyX2xvdy5wbmcAiVBORw0KGgoAAAANSUhE
UgAAAGAAAABgCAQAAABIkb+zAAAEWklEQVR42u2bTWxUVRiGn2mpjBYtXZCK/Imi1ASBmLb8pKmW
YAkQIMGYwIYokUURSti5MDFGCAFSlAUaiDEsSYCuNMQYCEQM1C60kcR2gDQIFGgsFMJPWwqXxVDa
OT8zdy4zc7+T3Peszp0z577PnPPde75z70CkSJEiRYqUqhK+op3HeBnLAO38wGRZ9mP86sP66HKf
NZIA1mZp38NjkMVh2S3SjiwMNOl2ywEoD9TPXGqlAFwP2FODFIBrAXuqkwLQHbCnecRljkAbMWOJ
8yClXZwaGQAXlfrblm8OcFY58r4MgCvcTamXWe+0JyVEgQ7gkVCOzLJ895RSX0CJBADoVOrvWb7b
Sn9KvZQqGQDnlLrNVr8WBXUyANq0qYHPKAgljHWN15bSb1lafqC0u02xDIROxdhnlnZxHigtqyRM
IbS53WCNgtawo8AMcEKpL7ZODRXgXRlTaJIWBeZfdiF3lHa/yBiBq3QoR1YbWi3gGC9r93Eh2qv8
speIKS3mc9uQXH4kBaBes1brw/45xkgBKKZHMbc/Ze3fZ7B/k0pJuxMHFHu3niUsNRb7VYjSEs3i
OgCqueWCfSjmimKy1SX7ANs1o40u2Yc3fe2PirWfXFI4bR9Wum0fYiRctg/Q6LZ9eInrLtsH2Oq2
fXiRqxpAE07pcw3gEuNcAijRknyP79wag+UawJBLUQBwTEP4m7EuAcykX0P41q0x+FIDeMxSt0K5
XUO4wasuIVTzUEM4EXYan81mbDcx6pVj05lQ+M2s58H93bCwaHRpGk0zJJWD2riI1goeaQh91sdQ
IvW1YRr1PMem1hvsIcE9LtJCE3PyD1DEzwaEy7weqLePtR3um7TQxOx8IrxiuCd4XAiAsN4wIYdL
L0fZnK8nDpO1ba/kKFTmzP5I+Z8jbKA01whzjPvTPVmEsz/7IxeKLblGqOOe8USL8mA/Wb7JNcIS
wxrV46GPW1sQ+x6PmJtrhFUMGE+1L+0aKZh9D49DuQ/nZdw3nuq4daVqtt/BSrZxmsG0AIl8XJEW
cdd4shvGfMFmf+LTz0tpYAdnDCvfZCqbF83XHkgNpzzNyis4Zvudz+yPaBxL2cmfWts8aQbnLYP+
16j032b/tTQ9FwgAJvCHBWGIZkqt9hNp7RcQAF7gR2vwdbHLYn9Shl4LCACwMcNVJLWcz2i/4ABQ
Q5dv+35e3C84AJRx1If9Cz7/dxACAMA6etPaH2KVz55CAoAKDmcYgzOs9bE9GRoAwGq6M0D08n2a
lwpDB4ByfvIRD100U6u90CMCAGAeJ31dlXo5xHpmyANIrln/8X13uEYLX7Ds6fpICAAU8Sn/Zbn6
76NNDgBAnI10BExlRAAAxFjBcZcBhvc0DhrzaWcAkkuOT/iNoSzTenGqYJM1k9DLv1I3jCtYwwFr
VjdStushJUtTqKead5hFheHT03yo/GtEHMDoCJlJJdMpp4wipnKZUxyUGAORIkWKFClMPQFRnIrN
VWSHLQAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECbOhC+NEBAADRAQAAMAADAHJlcy9kcmF3YWJs
ZS14eHhoZHBpLXY0L2ljX2NhbGxfYW5zd2VyX3ZpZGVvLnBuZwAAAIlQTkcNChoKAAAADUlIRFIA
AABgAAAAYAgEAAAASJG/swAAAZhJREFUeNrtmjFSwkAYhZ8rzkhjGipmvIEFha0zDgUHSJMSD0GP
pVegs7BJwxW4gB1yAlsLtKEgw9oiZBOSCLtP35c2Ie/LZv/9lwkghBBCCCGEEEIIIYQQ/4+zg86K
cIOLEydb4w2fv/FDfcxhPR1z9JvGH2LjLb6FxQbDJvG7WHqNb2GxRLcooikUGCDyPksjDOoL9IIo
NL36Au0gBNr1BQhgFxhzC4zx2Kp80cORQz1XiV92yiSnLh+b/TtOHPEtLKzhfXmYJ/HWy2O44zMK
7Exdwx2fTSCncBru+EwCjmXLcMdnEShoGloE8WN0uNvpjjY0EpCABCQgAQlIQAK8Amt2gRdM2Ucg
cStwzIHMrcAyiZ0KPFXIocBURnMVuNaBHAW2hWxPgW8l3lFgbCV+KHD2QlsK1f+Zuw9GIUVcR2AW
0CikiJnb6QwJptz7gQwJ+4YmMyWGYTzn2huaRRACi/oCswDGICuue+eFF3/gEneeBZ6QNtv0j7Dy
9sXiCqOyXuGQL3evcItrD8/+Ha/4ghBCCPGX+QYY41S/hfbz8wAAAABJRU5ErkJgglBLAwQAAAAA
AAAhCCECbOhC+NEBAADRAQAANAABAHJlcy9kcmF3YWJsZS14eHhoZHBpLXY0L2ljX2NhbGxfYW5z
d2VyX3ZpZGVvX2xvdy5wbmcAiVBORw0KGgoAAAANSUhEUgAAAGAAAABgCAQAAABIkb+zAAABmElE
QVR42u2aMVLCQBiFnyvOSGMaKma8gQWFrTMOBQdIkxIPQY+lV6CzsEnDFbiAHXICWwu0oSDD2iJk
E5IIu0/flzYh78tm//2XCSCEEEIIIYQQQgghhBD/j7ODzopwg4sTJ1vjDZ+/8UN9zGE9HXP0m8Yf
YuMtvoXFBsMm8btYeo1vYbFEtyiiKRQYIPI+SyMM6gv0gig0vfoC7SAE2vUFCGAXGHMLjPHYqnzR
w5FDPVeJX3bKJKcuH5v9O04c8S0srOF9eZgn8dbLY7jjMwrsTF3DHZ9NIKdwGu74TAKOZctwx2cR
KGgaWgTxY3S42+mONjQSkIAEJCABCUhAArwCa3aBF0zZRyBxK3DMgcytwDKJnQo8VcihwFRGcxW4
1oEcBbaFbE+BbyXeUWBsJX4ocPZCWwrV/5m7D0YhRVxHYBbQKKSImdvpDAmm3PuBDAn7hiYzJYZh
POfaG5pFEAKL+gKzAMYgK65754UXf+ASd54FnpA22/SPsPL2xeIKo7Je4ZAvd69wi2sPz/4dr/iC
EEII8Zf5BhjjVL+F9vPzAAAAAElFTkSuQmCCUEsDBAAAAAAAACEIIQLN2um0NwMAADcDAAArAAIA
cmVzL2RyYXdhYmxlLXh4eGhkcGktdjQvaWNfY2FsbF9kZWNsaW5lLnBuZwAAiVBORw0KGgoAAAAN
SUhEUgAAAGAAAABgCAQAAABIkb+zAAAC/klEQVR42u2YS0hUURzGf2WKPRQzsTIrHxlRZKVQgQTh
poWpmZAMkkRU25ZthCA3WlHUIsQkqDaJQS0KFAsiKS0KIgRb+ESZQBslNbVr07QwzHHumXvnPrTo
/zu7mXO/8333vC8IgiAIgiAIgiAIgiAIgiAIgvC/scwxpSjS58p6EkgAEokHhpgEvGgM0EM3vfTg
/XsCpHKAPA6yj9gInhrnDe2085rRpeq7WAqoZ5CAzdLJDQ4TtZjW4yingXHb1ueXYe5QGFEfWmQP
tUw4an1+GeEaWW5Zj8HDK9es/yk/aaLI/JAyN4mjOUslG03VHaCPYb7gBTS8QAoxQArJJLOFVFMq
fVRxF78Tb345J+k2eGuTvOQyZexllaHeanLwcJVWJg1UP3HCvv0iOgw7/QLRlrSj8Rhqv+eIdfMp
PDI1asstt5BrSv8hG6yIn2HU5LRzO0CAEU5FJpzBswjWDfcDBAjQTJpZ2VLGwghNM+RagG9oYVoe
o1RvjVl4JKumkThFg1+5QjrNrm2TnWynnhnlCaCR6vA7RBItyvxT1JAIwH3XeuAdAGnU8V3po4Uk
ldxu+pWP3WPTXD23A8yGaFB66Sdbv4NU29VHDgXVXIwAAEeVL7SP+NA5kE+GThMzXCKX1iU5sD9h
Fzd1jxNbyQ8NoL+bVnBROancZ4LzlOn+syI0wHPdu9F1doT8tsbFm8bCG8FmanTq+Xih93ih7ir8
OShCFk2ubmTdFATZ79JxpFGoEiwJG2ElVUzr/O+xHCBbd4o+/r3nquyXhJNURyimV7Em5FkOkIBf
cTyvZJsV++oIU8pVedDiYXqWp0pdvzX76giqC2CJrWmbic90W5r5tsxG8HHc9sqTSZvT9s1F8FPH
Ooc+rp1m2Fn7xhHest/RHWAtt/jhpP1wEXycCzmGO0GOYjBp1udZaATnBo7ZwaTZWyaOBX38cHrg
GA+mCYrtCu7kAT7GaaPClYGjfzO5zQc6qHXvQ6MgCIIgCIIgCIIgCIIgCIIgCP8uvwAQvOMYCRsW
vwAAAABJRU5ErkJgglBLAwQAAAAAAAAhCCECzdrptDcDAAA3AwAALwAAAHJlcy9kcmF3YWJsZS14
eHhoZHBpLXY0L2ljX2NhbGxfZGVjbGluZV9sb3cucG5niVBORw0KGgoAAAANSUhEUgAAAGAAAABg
CAQAAABIkb+zAAAC/klEQVR42u2YS0hUURzGf2WKPRQzsTIrHxlRZKVQgQThpoWpmZAMkkRU25Zt
hCA3WlHUIsQkqDaJQS0KFAsiKS0KIgRb+ESZQBslNbVr07QwzHHumXvnPrTo/zu7mXO/8333vC8I
giAIgiAIgiAIgiAIgiAIgvC/scwxpSjS58p6EkgAEokHhpgEvGgM0EM3vfTg/XsCpHKAPA6yj9gI
nhrnDe2085rRpeq7WAqoZ5CAzdLJDQ4TtZjW4yingXHb1ueXYe5QGFEfWmQPtUw4an1+GeEaWW5Z
j8HDK9es/yk/aaLI/JAyN4mjOUslG03VHaCPYb7gBTS8QAoxQArJJLOFVFMqfVRxF78Tb345J+k2
eGuTvOQyZexllaHeanLwcJVWJg1UP3HCvv0iOgw7/QLRlrSj8Rhqv+eIdfMpPDI1asstt5BrSv8h
G6yIn2HU5LRzO0CAEU5FJpzBswjWDfcDBAjQTJpZ2VLGwghNM+RagG9oYVoeo1RvjVl4JKumkThF
g1+5QjrNrm2TnWynnhnlCaCR6vA7RBItyvxT1JAIwH3XeuAdAGnU8V3po4Ukldxu+pWP3WPTXD23
A8yGaFB66Sdbv4NU29VHDgXVXIwAAEeVL7SP+NA5kE+GThMzXCKX1iU5sD9hFzd1jxNbyQ8NoL+b
VnBROancZ4LzlOn+syI0wHPdu9F1doT8tsbFm8bCG8FmanTq+Xih93ih7ir8OShCFk2ubmTdFATZ
79JxpFGoEiwJG2ElVUzr/O+xHCBbd4o+/r3nquyXhJNURyimV7Em5FkOkIBfcTyvZJsV++oIU8pV
edDiYXqWp0pdvzX76giqC2CJrWmbic90W5r5tsxG8HHc9sqTSZvT9s1F8FPHOoc+rp1m2Fn7xhHe
st/RHWAtt/jhpP1wEXycCzmGO0GOYjBp1udZaATnBo7ZwaTZWyaOBX38cHrgGA+mCYrtCu7kAT7G
aaPClYGjfzO5zQc6qHXvQ6MgCIIgCIIgCIIgCIIgCIIgCP8uvwAQvOMYCRsWvwAAAABJRU5ErkJg
glBLAwQAAAAAAAAhCCEC8MVwO7UBAAC1AQAAPgABAHJlcy9kcmF3YWJsZS1sZHJ0bC14eHhoZHBp
LXYxNy9hYmNfc3Bpbm5lcl9tdHJsX2FtX2FscGhhLjkucG5nAIlQTkcNChoKAAAADUlIRFIAAABI
AAAAYAgEAAAAFBv8lwAAABhucE9sIAAAACQAAAAYAAAAKwAAAAAAAAD/AAAAjk2DawAAAFhucFRj
AAIECCAAAAAoAAAAAAAAQAAAAAAAAAAAAAAAADgAAAAAAABAAAAASAAAAAAAAAAIAAAAWAAAAF8A
AAAAAAAAAAAAAAEAAAAAAAAAAAAAAAAAAAAAAAAAAAfYiQIAAAD0SURBVGje7dexDYJAGIbhIzEU
9HY4AjVbuACLOILugQOIS1CrG9CpLYWa+FmbGMNx/xGK95ngCxz3BucAAAAAAAAAYALaydI2fFCi
2mxOrcTiGaU6msxplFq9tkxt8JxWmeVJWuoSNOespfXhztWNntMpj/G9FbqPmnNTEesKKNV7z+lV
xryV1np5zXlqHfuirPQePOetaoq7ezN40GZeOdlO17chObHJhEdOmr9zDmaZMMmJbSY8cnL+Oedk
nomgnMTJhEdObl9zrtEyMSoncTPhkZOnJOkRPRNeOQnMxMJyULLXyrlkzy8RAAAAAAAAAMzVB/VE
lCp27oC/AAAAAElFTkSuQmCCUEsDBAAAAAAIACEIIQIsFhjnlwIAAEwFAAAqAAAAcmVzL2RyYXdh
YmxlLWFueWRwaS12MjEvaWNfY2FsbF9hbnN3ZXIueG1sdVTLbtNAFJ2pnUdDW1WIRRddBLEAqmji
8YzHdnfIXWSRSix4iG6Q1QRi0dbBMS1L1O9gwUehfgQ/AeeObRJXMNHR+J7re+bc69gO67NphzHO
DtlPh7FdVi/O2Eu2Xj1gHzgAngIhMAFeAe+BY9SeAJ+Br4DrltlVybrdxTz7uChZp3OTzcoF29lJ
v5T5aVYUeTGfsd3d62x+s8yL8q1N7+018aSq297+kF1cJPlFXrB+f5mWi5O0TNnt3e3dqRGeNNFI
CYU1NSIIAzkKaJtqYQxSodCxNIkSUZUKpTFDJYznyZEWErnh5lJCR0rXgpNK/uxUaqF9lEvwkJam
0kYYa2neIA4gm8hARF6kR4j1EDW+vckI6QetQ6RfnYL7lQ+5lvoZmlJaopAOMRNfBJBJfOHFf8mh
FCE1AJKilrYIFaRRBWdJc5BP7Q8lktZSJHwKQ7LdhAnCeDMb0QxQC7p9wjqhbfeYpu2+4ZXwwJN8
bPuovLQ1QqFqY9qLFI0gsO1RY5FKaHh2JNJqD6EZBjRZxJFSbS1FGlbLo3+B9ERsa3X1VCJhwmq6
kkqNCOuT2jKB0NR9bM1P4Z1GY8gWSVg3RvikgD4Dj/5LCNoauI86DqqmMF7y7FfjwbRIESaDiFxY
/fpxtp74Gev10qtZkWczdnS0KMvl8Xi8Ol/ML9OVqBPiPL8cp8tP42K+Gjc3uy69HHjhrufnJV4W
rG+8z55hf8w5fw28A345nG+5nDuAC3QAxvfte034jbWNfQBsgf++wdPawfUj/Lr1d2FQ75Tro+Q5
9AbV56PhOvyg1vsH56y5h7QT5645XP54QVznHkfepuCebHh7UHvb2vDWXdcd0uWg/pb1Kzi0O3X/
97Wce3Np+uf/mdcfUEsDBAAAAAAIACEIIQIAQxuEhAIAACgFAAAuAAAAcmVzL2RyYXdhYmxlLWFu
eWRwaS12MjEvaWNfY2FsbF9hbnN3ZXJfbG93LnhtbHVUy27TQBS9E8dtCm0FCKQuuvCCBaqiiccz
HttILCqz6CJZ8uouagIJtDi4pt2irvgMPocv6EfwE3Du2CZxBRMdTe6ZuWfOvfbYowE984kEHdJP
j2iXmiGIxrQeO8BDIABC4BiYAG8BjbwXwEfgC7C1tZgvPywq8v3r5axa0O7u9GtVTJZlWZTzGe3t
XS3n16uirN645f39Nj6p83Z23i/Pz/PivChpMFhNq8XLaTWlm9ub24mVobLpUEuNMbYyTmI1jHka
G2ktlhJpMmVzLdN6KVHWBlraMFRDIxXWgs2hpUm1aQRPavnTiTLSREhX4CGtbK2NMDPKvkYcQzZX
sUzD1AwRmwA5kdtkpYriziEqqk/Bfh1BrqN+iqK0UUjkQ+xJJGPI5JEMs79koGTCBYDkqKMtEw1p
ZMFZ3h4UcfmBwqKzlMqIw4Rtt2GOMNtcTbkHyAXdPWG9YFz16KarvuW1DMGzfObqqL10NRKpG2Mm
TDW3IHblcWGpzrl5riXKaQfQTGLuLOJU666WZg2nFfJboEKZuVxTP5VU2qTuruJUK5PmpK5MLA1X
nznzY3jn1li2xRLOjZURK6DOOOR3CUFXA/u44rguCu1lz1HdHnSLFWEyTtmF028eZ+eJn9L29vTz
rCyWMzo6WlTV6vlodHm2mF9ML2WzIM+Ki9F09WlUzi9H7eZ+ny8HLtzV/KzCZSH6Jgb0FPMrIcQ7
4JcnRK8vhAf0AR8g8YAOsOcJ8Btj0NzvHvjvGzyP+/j/GD9/4ztA6zxfHNSc+AfXW3OPeGbOW3N9
oh/HzPXvcOxj3HxrWh/3Gh+9DR/+Ou+Q/zK3BWwD4DyevabWu1renR60tYr/9OYPUEsDBAAAAAAI
ACEIIQJmW4JtpQEAAAQDAAAwAAAAcmVzL2RyYXdhYmxlLWFueWRwaS12MjEvaWNfY2FsbF9hbnN3
ZXJfdmlkZW8ueG1sdZJNS8NAEIZnm6RNaysiHjx4qCc/yNdqg8Wb6KEHBQ9+4ElCGk0wNSVdI3jq
DxB/gQd/n0fPgr6bbmkpOuFhNu/OTGZ2o5FJukbEaINeGVGLlGF9TjOrgRWwDrbAAeiBC3ALvsA3
2EGeB3RdJI+CqtU4Su5jQYbxnPRFTM1m8CSysyTPszzqU6tVJNHzMMvFdbm9vDx9703y6vW7JE2P
szTLyTSHgYhPAhHQ+G38dsZ9q1t0e/5VN+begFv2Xq8T2p7j+5bXtrnlOR1fel5wL/QsudGWmsXb
EGO+F6rYeUOZMg+eF/a+46cdq1PYnKc2FlcHKFR+ol2GIUh+weYvVKsFj/08S/q0uxsLMTx03VEY
R4Ng5KgNJ8wGbjB8cPNo5E6DdV0OhYMqolBgSNiYmbQNv8kYuwQ34FNjrKIzpgEdGIDYSnkfkh9Y
Hb4BKtDf53RpTazX8FTVfTaUl3smUnZQrzG59qlmsHVV7w9Nm2mr0ktNn2lYfhxJzVjQZG+n0Dbm
eltSvVXmeqvO8srQhvoHzQma9Jqaf7GWtnAu0/nZP+f1C1BLAwQAAAAACAAhCCECPiKERJEBAADg
AgAANAAAAHJlcy9kcmF3YWJsZS1hbnlkcGktdjIxL2ljX2NhbGxfYW5zd2VyX3ZpZGVvX2xvdy54
bWx1kk1Lw0AQhmfz0aZaRUVBwUMQL0q+Vhss3kQPPdijX8eQRhNMTUnXCJ569ORv8Kd51rNnfbem
JBSd8DCTd2c2M7tRyaB3hYjRNk0YUZtKQ3xOlbXAKjCBB05AH1yDT/AFdlCzBxqNOEruYkG6/pQM
REztdvAosn6S51keDWhpqUiip1GWi6vp8vLy7L33W9dq3SZpepqlWU6GMQpEfBaIgCavk9c+961u
0e35l92Ye0Nu2Qe9Tmh7ju9bnmlzy3M6vvS84F7oWXLBlJrFTYgxPwjL3Lphm2kdPC/sQ8dPO1an
sDlPbQSXR9ho+glzmoYk+QWbP1OzGTwM8iwZ0P5+LMTo2HXHYRwNg7FTLjhhNnSD0b2bR2N3lqxp
cigcVBGFAkMSzt6gXfgLxtgN+FAZUzTGVKABHRBboU3kbIBvmFHeiwL9paZLW0S8jkev3R9VdTrb
/NXYH5pSaWvSS02tNI3o7URq2pwm+5D/zFatj4WyD6XWh17VbctQag3QBNBU6dVy1vm91LkzmM3K
/jmbH1BLAwQAAAAACAAhCCECVKKejt4CAAD4BQAAKwAAAHJlcy9kcmF3YWJsZS1hbnlkcGktdjIx
L2ljX2NhbGxfZGVjbGluZS54bWx1VE1v00AQXddOmoa2qhCHHioRDnxV1cbr9e7a3JA59JBIHKCI
XlDUBGLR1lFq2mul9mdw4Ochjpy4wZv1unGistaTPTM7b77W67MO+9NizGN77DpgbIu55TH2li3W
OrAD7ALPAQMcAu+AT8BPn7HfwGNwPAOCoMzPS9ZuTyf5l2nJWq2rfFxO2ebm6FtZDPP5vJhPxmxr
6zKfXM2KefnBmre3a/mw8tvY+JyfnmbFaTFnnc5sVE7fjMoRu7m9uR0qHiUyPki5DBN5JEJuEikH
MRdhEh8IweNU6IHkQmITrEponUmeWGvIw1joXnPFXEVKgE5LKXtL5MdDEXOjSIpUJhRRG9qpekLz
qGZUS3ywJPChyJEawCmNlE3LQLJ0lLLW+sjSHg9TnkKpOVQ6g7MCbSX1JDdwNtxQaktBuDA26RTl
ZOFddZFKZC/kqdbGhkHttFeFgsQUbYmoBCFtH9CW2InRagSEjiuTJFPMw5BIKjGLKX7DKK2A1snV
3trEMA0aiuaxTSziobC1mqo1CWWteWoF1RQE9SnhEsSZIV3CRbTc78S2L+nRJChYksEvpNyhQyRj
nShNqpqGCz5kc0T01IRa7Y7Ocp9RlE0ZSdpeSq6cnFJFGK+KbO2UKR0RbalkNQnIdpzUKMRYPSeh
lHe2jE6UG4bdC1m5CUT3+BrnS50ciARx7IQzkXIhqunbA92QaQY92hqp+uSASBKRsT/RaumCSnVH
sXlKj9n6+uh8PC/yMdvfn5bl7FW/f3EynZyNLrgz8JPirD+afe3PJxf9enMQ0K+M6+FyclLi12bX
Xoe9wD3yxPO898BH4JfveWuB5/lAALQA5u3YO4jwF2sD7y6wBv33hp7WJr4f4Wm7O6zr3mTrwOUl
+LrVVVfrWt6u47tH5y90D+lNumChw+eP16RrregotwF0Txu5PXC5rTVyay/89uiz6+7dTgWf3r6r
f5XLX+lLXb/3n379A1BLAwQAAAAACAAhCCECskaZ3MgCAADUBQAALwAAAHJlcy9kcmF3YWJsZS1h
bnlkcGktdjIxL2ljX2NhbGxfZGVjbGluZV9sb3cueG1sdVTNbtNAEF7HcZtCWwECqYdKWIhTVW28
Xu+PuVXmwCE5UqA3qwkkosWRY9orUnvgMXgoXoArPAR8s3Yaxyprjez5Zmfmm5n1+mzAfgaMeeyQ
VX3GdlmzPMZGbL12II8hISSCnEDGkPeQXz5jfyAH8H8O2dqaTeefZhULguv5pJqx3d38a1WM52VZ
lNMJ29u7mk+vF0VZvXPm/f2V/qb229n5OL+4yIqLomSDwSKvZq/zKmc3tze3Y8VjK5PjlMvIylMR
cWOlHCVcRDY5FoInqdAjyYXEJliV0DqT3DprxKNE6LC9Eq5iJRBOSynDjeBnY5Fwo0iLVSYUhTa0
U4VC83gVUW3Eg8XChzLHagSnNFaOloHmwhFlrfWpC3s2TnkKUHNAOoOzQthaCyU3cDbcELWNJFwY
RzpFOVl0V12srAwjnmptXBrUTntVJEhN0ZaYShDS9QFtSRo17mZA6qQ2STIlPIooSK1mCeVvGaVT
0DrZ7a0jhmnQUDRPHLGYR8LVaurWWGKteeoU1VYE9clyicCZIcxyEW/227r22ZAmQclsBr+IuAND
JuOciCZVTcNFPLA5pfDUhBXcHJ3NPqMoRxkkXS8lV42eUkUYr4pd7cSUjoh2oWQ9CehunNQo5Oie
k0jKO1tGJ6oZhtsLXTUTiO/xNY0vdXIkLPK4CWci5ULU03cHuqXTDELaGqvVyUEgSYGM+4m6pQsq
tTmK7VN6xra38y+TsphP2NHRrKoWr4bD5flsepkveWPg58XlMF98HpbT5XC1ud+nXxnXw9X0vMKv
/c0bsJe4P956nvcB8tv3vF7f83xIHxJAmPeIHWDPM8hfrEFzF/WAf2/htB7i+ymeoHVnsbVf4B3U
mHcP1ltjT+hNmL/GcKv9OCGs38GIB92TL1o8HjQ8ei0ewdrvkD4J24JsQ4D59PabWrux/E4PVrV6
/+nNP1BLAwQAAAAACAAhCCECMUPLRbsAAAA8AQAARwAAAHJlcy9pbnRlcnBvbGF0b3IvYnRuX2No
ZWNrYm94X2NoZWNrZWRfbXRybF9hbmltYXRpb25faW50ZXJwb2xhdG9yXzAueG1sdZDNCoJAFIXP
OIYDtXDhokWCawvHFkFEyzYteohJBSP/0HmAHqe3rDuiGUEHPu69Z37u3OEQODKAYYUngBkGkRdj
0pxYEzviSgjRKJ2flFbw/UsQR/GGCIpg+8mMRxUcR1VpW99ShGGudXOQskvyrFRdNCxESV1K1dxl
m3Vy3Oy6psO50lnb1IXSdWve8WACC/NOmzEwF0vKPeJFsihywiJ//+Ub2X3tmbF68WlM+gFwE/nP
feM59qfPG1BLAwQAAAAACAAhCCECLtOs7L4AAABIAQAARwAAAHJlcy9pbnRlcnBvbGF0b3IvYnRu
X2NoZWNrYm94X2NoZWNrZWRfbXRybF9hbmltYXRpb25faW50ZXJwb2xhdG9yXzEueG1sdVDLCsIw
EJw0lRb00IMHDx56FmkqXopH8aAHPyK0hYqPlDYf4Ef5fzqplYrgwDCb2Wx2NxIh9gIQmOMBYIQe
9FIMGJMZuSUNGYa1ttVOW43F4hinSbok45zRukdnuMSKunorgkDfisacCpZV1tYbpdq8Kq+6TfpE
kpur0vVZNWWrPpejyLU73GzZ1OairWk4w12EmLiZfSEgIswYT8kn4VEl6dHPvnwHvztP3Yod5LAy
fwPSqfx571Mn/vR5AVBLAwQAAAAACAAhCCECMUPLRbsAAAA8AQAASQAAAHJlcy9pbnRlcnBvbGF0
b3IvYnRuX2NoZWNrYm94X3VuY2hlY2tlZF9tdHJsX2FuaW1hdGlvbl9pbnRlcnBvbGF0b3JfMC54
bWx1kM0KgkAUhc84hgO1cOGiRYJrC8cWQUTLNi16iEkFI//QeYAep7esO6IZQQc+7r1nfu7c4RA4
MoBhhSeAGQaRF2PSnFgTO+JKCNEonZ+UVvD9SxBH8YYIimD7yYxHFRxHVWlb31KEYa51c5CyS/Ks
VF00LERJXUrV3GWbdXLc7Lqmw7nSWdvUhdJ1a97xYAIL806bMTAXS8o94kWyKHLCIn//5RvZfe2Z
sXrxaUz6AXAT+c994zn2p88bUEsDBAAAAAAIACEIIQIu06zsvgAAAEgBAABJAAAAcmVzL2ludGVy
cG9sYXRvci9idG5fY2hlY2tib3hfdW5jaGVja2VkX210cmxfYW5pbWF0aW9uX2ludGVycG9sYXRv
cl8xLnhtbHVQywrCMBCcNJUW9NCDBw8eehZpKl6KR/GgBz8itIWKj5Q2H+BH+X86qZWK4MAwm9ls
djcSIfYCEJjjAWCEHvRSDBiTGbklDRmGtbbVTluNxeIYp0m6JOOc0bpHZ7jEirp6K4JA34rGnAqW
VdbWG6XavCqvuk36RJKbq9L1WTVlqz6Xo8i1O9xs2dTmoq1pOMNdhJi4mX0hICLMGE/JJ+FRJenR
z758B787T92KHeSwMn8D0qn8ee9TJ/70eQFQSwMEAAAAAAgAIQghAhaPebC+AAAAQAEAAEMAAABy
ZXMvaW50ZXJwb2xhdG9yL2J0bl9yYWRpb190b19vZmZfbXRybF9hbmltYXRpb25faW50ZXJwb2xh
dG9yXzAueG1sdZCxDoIwEIb/UgwkOjAwODiQsBFDIXEwuji4OPgQDZBgFGhKH8AH8h31SiAYE//k
y3+9Xnu9cvg4MYBhgxeABUZRLsOsJZETR6ImfF9JU5+lkYjja5Sl2ZaICop2Q2Q9Jyesw/NkW+ru
ViJJamPUQYi+qKtG9um4kRZdI6S6C131YioOAtvn0ppKq+4hTaeBJ/Oxsm91GQMLsKY4JN4kh5wT
DuX3X3krd1iHdrRBfB6VfgHcOv+5bzrH/vT5AFBLAwQAAAAACAAhCCECFo95sL4AAABAAQAAQgAA
AHJlcy9pbnRlcnBvbGF0b3IvYnRuX3JhZGlvX3RvX29uX210cmxfYW5pbWF0aW9uX2ludGVycG9s
YXRvcl8wLnhtbHWQsQ6CMBCG/1IMJDowMDg4kLARQyFxMLo4uDj4EA2QYBRoSh/AB/Id9UogGBP/
5Mt/vV57vXL4ODGAYYMXgAVGUS7DrCWRE0eiJnxfSVOfpZGI42uUpdmWiAqKdkNkPScnrMPzZFvq
7lYiSWpj1EGIvqirRvbpuJEWXSOkugtd9WIqDgLb59KaSqvuIU2ngSfzsbJvdRkDC7CmOCTeJIec
Ew7l9195K3dYh3a0QXwelX4B3Dr/uW86x/70+QBQSwMEAAAAAAgAIQghAlhWLQDWAAAAkAEAACUA
AAByZXMvaW50ZXJwb2xhdG9yL2Zhc3Rfb3V0X3Nsb3dfaW4ueG1sdZBNDoIwEIWnAoKJCxYmunDp
igVVV8aFrk08gC4bJGJUSkoP4BE8jMfQG/n3RFAw8TVfZvL6kpnWIIeOjIhRl05EZFMueCP6qgk6
oAf6YAzWoNEIZKyV3C0G335Z6hfDkj8k2xbxSsnNijwv0joZc54GUbgXqZ9f+IHcc5FsuQpTXoRd
NxE6msU6VIncCS0VZh+Yk+10NRi7gTt4AGJu5rfBAzJRLVCDr0v+S3X0LRwzf6eV19edQ2RezueJ
9f6Oj1fkapXcPMsZldxhavzsUsxkf3Z8AlBLAwQAAAAACAAhCCECO8hpAYQBAABoAwAAKAAAAHJl
cy9sYXlvdXQvYWJjX2FjdGlvbl9iYXJfdGl0bGVfaXRlbS54bWyVksFKw0AQhmeTxqZtKkUqiAji
TUpt7voI9uCheFOJ7dIsTZOSrNb2Ui+CNx/Egz6ARx/AB/AxFDyp/5YNDUHFTviY3X9nd2Z3YpJN
vknEaIvqjKhK2jA+ooU5YBNsgyY4AIfgFAzAFNyAO/AESiUeBGKUiCmnSiWKBQ+lJ0UUkmGIHpXL
lyIR5yIQckKOE3iT6EKejUVP+lSt6qnPRd+XVKvp+dCL+yLsRCNsT0TYD3hbhBzblfPi9jyKbLvD
r+Sx4GMqFr2wF0fI12j4Uo72XTfp+nzoJS290OpGQ9cbDdyYJ24abFmJnAScrplNu7jLPTH2DF7A
K3gD7+ADnDDGiNVoA3Hr4AtWhq8AA7rM6MpsjOv4CvNXLczjmF7HWo3pvYWM9gmvNCunKXMWGnug
1ZnKeat7leYs6ZwWGfOsFd3T9CwzrTdz1h7Zs//WobTiQltT3tRvkq9D1fcIv/NDfcUl6mvq+sxM
nLHE2yltJXOeQyuzv+6Rr9fM9TztLfvlX/gGUEsDBAAAAAAIACEIIQKak659+gAAALgBAAAqAAAA
cmVzL2xheW91dC9hYmNfYWN0aW9uX2Jhcl91cF9jb250YWluZXIueG1sdZCxTsMwEIZ/N5RUUYsC
qhADC2uHhhkx8ACVmJmQG1ux1TapHBfUCUbehpUH4BF4FFiB31WiVEic9Ons76zTnSMM8CYAgXO8
A7w1QXeNLhIyJhfkktyQW3JH4liXcr7UiqfCyQfrt0iSucwXhas2pcJwuJTbauPvH63yBqNRczXa
FsazPLOllm62s2wiS+UqqzCZGO/XV1lW50avZD1tCtO8WmVyvcicrrP2MfAsBtwCOIIQr+SDfJIv
ApHijLVT8sM4DHOTHv3Lng/R3+06Rr/ZPW5yqPF/TlonOnectv061xOInoKLOpd+Mwd3sOdCjv7M
184h/pn7F1BLAwQAAAAACAAhCCECu6P5GYoBAAAAAwAAKgAAAHJlcy9sYXlvdXQvYWJjX2FjdGlv
bl9tZW51X2l0ZW1fbGF5b3V0LnhtbHWRu07DMBSGTxpKeklvqAMDsCIxJAsDYgMkJCRYACE25Cam
iWhiK3GBLsALsLMwMzLwLkB5DliBP61LECon+uTjL8cnsW1SicgkMmiBAoOoQTqQH1MeLbAIlsEa
2AYHoAMScAVuwT14AEMwix71uuKXakNKzhIWe5zK5UxsiZ5IyLK6CTsP1QBlPTYQfXUyEdWqZL4f
xt1dfqqoUtGzQyHJtvVkP+wGimo1Pd0USokIHzgVXj9lnR5HqW57EfoqQKmeBny01LJY7Cci9Ml1
dXbpMCk9EUmmnPOQXzgRj/vOhqdCEe8h3VE8OoKnlZVAKbnuuqkX8Iiljm7gYLHL5Jmb8HTSlIrF
VA3wP0Q3RolWMa6SYdyBR/AEnsELeAVD8AbewQcgo0nzWLMEvhBVjDVQgG8buc/CRt7GY49uzR7V
kX6Pmy7Uybyuja/3xzW0K+Su1dLfMKe4mdwVsZ2RK/52M2M3O6XOmlJXyt1cNmaunLvmp3aVPy6L
+q99VLEP889ZTc7E+OcMvwFQSwMEAAAAAAgAIQghAvwg0T0lAQAAQAIAACUAAAByZXMvbGF5b3V0
L2FiY19hY3Rpb25fbWVudV9sYXlvdXQueG1shZAxT8MwEIWfG0Jb1FZFYgCpe0slkoGNCSRWEBMr
smorsaBJlLotmcrIX2Hiz8EKPIOrQKWKs57u8t2dfbkALZw3AIEBBgLYgzfGl6jN8SPqmDrFT+6a
qqgV9UI1m0kpF8ZW6HQeZJXP7d3SKJui2/WfqTZJalmozMIoXaLX89GNVMpkCVMyU2VuFEYjHz1G
sigm+bSQNuJ9ibbRxcSaPLvS2fzW6CWCgBUYDlNri7M4nk1SPZWzyPdH7I1lcR+XenYi5zbHePx/
ZbyeA3gSLW4HeIUQb9Q7lSBYGQqij0PmnD5pIX37e39/eZO+RTXIn39xZ7uMD3hCv+u29y7Hnv2+
Z6Jm/Q96xxobzL0R1IzpYOXYTs1C0SHdmG89h9gyt9jyn19QSwMEAAAAAAgAIQghAlKM1YcMAQAA
0AEAACIAAAByZXMvbGF5b3V0L2FiY19hY3Rpb25fbW9kZV9iYXIueG1sdZCxTsMwEIbPCW6qqpU6
gARS2Zg6OAsTQkjAO7BWJrEaizSOkoM2E4w8BA/FAzDwELACf9JEjSpx1qezf/t+n+3TkN4FkaAZ
fRJh1Qa0S9pFrR+BM3AOroADb0BKTszK0Gj0ZEt7b1PLFY3Hqa7cIy/WNuaEJpN2mRi7TJiCQGdx
4WxMSrWzjdJ5HrlVrlmhaGlYXUdsXXaji1uXsdnwnTVrms8T5vwiDMsI1+qyq1eoDXX+EBamDDt3
KUuuUkMvYkjH24eJD/AFvgGJaaOfgF/EAfIAeNBfe3odEvNDDNn4yOYctfv4H++U/OfB9us6bep1
fj2tzrXm97Sf9o6g5zeDn7/XX9eH+KfvP1BLAwQAAAAACAAhCCECp4gPmK4BAABIAwAAMgAAAHJl
cy9sYXlvdXQvYWJjX2FjdGlvbl9tb2RlX2Nsb3NlX2l0ZW1fbWF0ZXJpYWwueG1shZLPTttAEMZn
7bpxiNOYkEocKjhGAoEvVQ9cSyVAnEDqlW7tTbxK/Ef2RiinIPEOPEAfgAsS6oln4MSBnivxAHDg
Av02ceSAiDrWzzP+dmdnd9Ym2bRjEjH6RCeMaJEKQ/yDSrPAElgF62AL7IEjoMApOAO/wDn4Da7A
HfiItQxDBlSrpTwIZNzdFx1F1Won8Qc5/9kXiP2+9Hvj2HH6fJgM1NGxDFRI9XrxGQrZDRU1m8V3
xLOujA8K0U9iJWK1LXI/k6mSSYyFinKHimeKXPdF4rc4QNk8878mUcr1dnYj3hXfpTimSoXHQZZg
y6bJ05Ta7VCpdMvzcj8UEc83i+FNP4k8nva8TOQbfKASWlv7/0xvurhl5WqIE8NOmE2f4a+JsRtw
C/6Ce/AAHkFuMHZhMnYJ/pA5IubSMnJWwDPMgW+M7+6lXof/AAzoLVbq2mqIW3gcfeF4N4r71mM2
VvpC9qgx+R2mmsWcSR2j1Jraa818Q3tXau5ToVkz2nTe+9ka7qRGpdSMJs6sNfuNvVRf5erzLszk
LiFXx+6MtgjNfNWraU/YnB6yOT3/B1BLAwQAAAAACAAhCCEC3mgZdlMCAACUBgAAKAAAAHJlcy9s
YXlvdXQvYWJjX2FjdGl2aXR5X2Nob29zZXJfdmlldy54bWzVlE1rE0EYx5/ZzeY9MY2NKPgGLQoF
EzxGimADhUIF0aAXRSa70+za7Au7k9acqt/Ag0cPfgBvfgA/geChqPXqF/CgV+t/mglZYooFLzrh
l935z8wz/2efYUzK08ssEaPztM+IGqQb3iOatgVwBiyB6+AmuA0eAQ88By/Aa/AGvAPvwQH4Ci4h
3lXQBQ9BtTrgo3AoH/djvuPJERmG51Cx2OP2dj8Oh4FDpVLEHccL+ptiS2JI97phROWy7tz1+q6k
SkV310IpQ58Kha3QHia8NxDUaGDonuRSJOtx6Hdcb+DEIkAIbWDXc6SLELrriqOQhUJi84HojiJB
tRp3ngwTed8Tu2vKWgJv6zH3xebRGkze8HlfqHHK5XjgxCGSabf129MmjyI79CMum9itL2Tzli09
lXbHDcNExGrl8kYQiFhHtCx7wJOEVlZcKaMbrVZiu8LnSVOHbCJci0fbrVgkrcmGlpXIEVLOZHaU
E3rG8rSKb/+WGPsA9sFH8Al8BgfgC/gGvoMf4AJj7CIgVqOzWHsOHKKdwrMODOivUrpqi3hfxC9L
Bln4r+szo8byODoLei2baqxN+T2lFaZa7SeeSiumtMkeKkYNQDNrevz0dJ6xROae8qY2uZLyVtHe
SvBG2sefvD3Q3oxUfIb4SjOnmsXK47WZtGaMNWvOvOycebmpVj/U+efnaCf5TpPaXEvlX03V5qT5
936vjcUuj+cV52illA9TxyvP5GDq8zTrbaLP1mxSy9W/rOWd/7yWnX+4lp1jajlbM3PmLpncGeyY
O+YXUEsDBAAAAAAIACEIIQIILGf5NgIAABgFAAAyAAAAcmVzL2xheW91dC9hYmNfYWN0aXZpdHlf
Y2hvb3Nlcl92aWV3X2xpc3RfaXRlbS54bWydkz+LE0EYxt/ZvVw2/84kpjhBxcriigTBSgQ50EII
IiraKOeYnduM2ewum8n9sdFv4BcQKzvRxo9garUQObCwlOtVsFGf2cyyQ4woDvwymWfmfWbeN29c
8mi9RMToOD1jRB0yA99DKkYLnABdcB5sgivgNhiBPfAYPAUvwWvwBnwEn8E3bQnPGlhbU2JPbSaJ
4CmPBoIqFRGGMpnIBwKbId+Pp2orSPmOVPtUq8WpFJHiSsYROY70qVq9xwejII2nkY/9hPu+jIK+
2FZUr5vVNRkMFU5uc7265AeCOh1/moRywJW4ylNYXoepQIi5cVf6akiNhlkORWbRbpv1mKeBjOa+
njeW0a3sfLU6wQWh6MtIZ3J5zANxU4pd+GqJp/0sHCE3kHW2Uy7zyE9jZLKxMVQqOdfrTQZDMeaT
rtnoDuJxjyejXiomvfzwI+bRRdTxLCr5HLwCM/AOvAcfwAH4BA7BF/AVfAcXGGN3ALEmrcPjGPiJ
0cZ8FDjQZ5auR5N0P3TQIU7WA/qca/Y9oiYz2kqhsfvkPdRaqdCct+Rm2mqhlXBdFlteolWtO/Ss
tZrlt2P8GnbsbJ7DXWgnl+Tgmj7WcZUirp3723f++P3O7B3a/wm005b/EeO/atXIKeJazSU12jI1
+ss7SuzUPLa2RKvbGj5c87suvk2/+QDzGUtvmTdXslfN/ciq76GpL7PyX/nH3F6Y3DzrHDX/v+65
trYQm+e7mFeuL/aAu9D3uc7+8H/4BVBLAwQAAAAACAAhCCECOZrUoGMCAAAwBgAAMwAAAHJlcy9s
YXlvdXQvYWJjX2FsZXJ0X2RpYWxvZ19idXR0b25fYmFyX21hdGVyaWFsLnhtbKWTy27TQBSGz8Rx
rg5J2yBxXbFqKiVdVQjKRRESQuoCUUSXaLDdZIQTW/a0IWxaxIYtrFnxAkiIR0BimxUUCbbwArAN
/HbGsuWkElUn+jIz/xzP+efYo1GJ1gtEjC7RhBGdJdUw9ihpFXAOXAZr4Cq4C3aABQLwErwB78BH
8BlMwA/wC0xBC/vugGKx5/N9IcdUrbq+sIeSS+EOKZcTFiSPW5YY9rbsXUmVipo9dD0yDDV5IHp9
SbWamnZdKd0BYvdFIJ4IJ9zZMBw+dvfk45GwZB+xatq3o2cNY1c4ziNhjzzXl8nyaLZcr8/md4Rv
m5G3RiMwfddx7g0tYXLp+gEVCt09JB4i8Xa0Fm6Hw/Gh5bs4SbOpRm146Nmyve1x06bVVSU/a3PP
M92Bx2UcMduwy/2tKD21Wn0pvWudTmD27QEP2vGOeKzDvacd3w46cT5dD+TYsYkOWYluo97vibFP
YAK+gK/gCHwD38Fv8Ac8Z4y9AB80xn7mGSPWiN53yF+0BvoVkIP+NqWHrY5xE79C+NHgP4pT6yV8
SV0qHYRaKdEaYR9q5ZQ2VVol0ZbjuFqiLWlq3Ey03E3SDkJvR9CupLwtK29l9R2vqD7e677SWMpH
HKclms6MmZZPa/mZpi+IKyyI+9/zGylNUzWX6FdT5zqjzpWPnOfnan4RT2VzTo/Jma3lJmqpqfef
zRl6eYV+PaUvKS965IXmvLxW77+YystoriZ6rJUXaNVEQzUPb8X+sj7iWm2coFYXTlGr66labSyo
Vehl8wRezp/Cy42Ul2zOWM/eDS1zz+P7zI65//8AUEsDBAAAAAAIACEIIQKUiAzUBQMAAKwJAAAo
AAAAcmVzL2xheW91dC9hYmNfYWxlcnRfZGlhbG9nX21hdGVyaWFsLnhtbLVVTWsTQRh+J5uPzUdj
W+MHKuKliC0mRS9FLxWkKMRa2mI9CLrdHZOhm91lM+kHKK0g4g/w6MGrInrw7M2DNz2IH+A/8OJB
r+o7m5lkWBOaSB14mN1nZ97nmXfe2THAhOdZAALHoJAAOAyyEYA70G05xFHEKUQZcR5xGXEdQREt
xH3EI8QTxAvEa8RbxDvEF8R3xHGMO4doIu4iHiAymVporTO+BcWia235LX5TEfm8HzLqcYsz34NE
gjmQy61a9lot9Fueg98Dy3GYV6vS2xwKBfm2yGp1jiPXWZOtMldEGhmxXRYs+wvtEThWSm0wh9fx
s3yt02huNttg3qX2cz4/F1oNWo0G4MQq86gVylfTXKab/BqjG5BMRl0mY3lO6KPVUkk+lVGkRnl5
KbBsClNTkt4sW0Fg+43A4mrEBZeG/CKzXL8mBSYmOqNtP6Rq4Dxtcuos2aHvupHs5GSd8+BcpdK0
67RhNctKGwUqVrBWCWmzopxlMsyz3ZZDIZ1uLxxSqSbfcsVe7hATZrB/CYS8QrxBvEd8QHxEfEZ8
RXxD/ED8RMwSQoCMRvUj8BvbKPYlRAL5hxov2nj0rQQpMKL6Ksk6E99MgLGzsNOe2+VGiRxndDmy
Dua24LLaONGXZM0q7hf2wodY1xHNxwHpg2j6B7X4OchvG3Jd8XkiHsf+hMYXZLykjBj3Wx3Cr+Dy
XS5Fptuaj5E7qWnuk5rpKFttTaLlcrqHjx3pI9nlEotgRFxG85GQc3fxm8LdB5WnuDeVp9Mav3+X
PN2T/swuNw6Deens9S3kzmiaI1LTkHvdr74GjS/WNKPFH9tlTc/kmv4hv2QC0p06jGuqmpjV+GKn
JoSX9F9e8jhLcClt/x25/+ke3CA5Ee2QpvEJih3PcW8qf3ND5O/pHuUvrqn4eK0oPl63Kt9XhziD
Cz3Ws/0fz2Dcm+Lj/yq1DytD/MPm9+AfJs7mjR6aRh/NK0NoqrXG4yt+pUcOhB+rx72g/ysGPQP6
/WFq90c8vhG7L9W9SPrco38AUEsDBAAAAAAIACEIIQIqxXj1gwIAABgGAAAuAAAAcmVzL2xheW91
dC9hYmNfYWxlcnRfZGlhbG9nX3RpdGxlX21hdGVyaWFsLnhtbJWTz2vUQBTH3yTd3XSb1u121QoK
olShwu6pl4oHQUFxT1q9iMi4GbOD2SQmY9sVwf4J/hOeBGsR9B/oH+BB1IN3/wD1IIj6TXbiTuOK
dpYPmfnmzfux78UmhxarRIyO0ndGtEh6Yf+IxssFh8BpsAJWwSVwHXjgPtgCT8BT8Ay8BrvgLfgE
PgMLfl1wElwBm2B6WgSBjFP5UFCt5id8Xaohzc0FfBg9ULcLYWYmSqQIFVcyCsmypAcp5p4nQ78r
7iqq1/VpLYrJdfXhqvT72bt1mco7Msg8ua52vSE91afZWX3si9y22dTnAU98GY4c2Haa9JBq2uOB
WBvGAi5TuA9EV4YCPpTYVOcD6YcD5EiNxh4fF0MPdy8PuC9uSLGBDLJbPOnmRqiah14SoaJWS+/a
yM0Xqn0t5j1BS0ta3mzzOO5Fg5irwuKC5EHkr0kVCFpe7isVr3Y6aa8vBjxtF95wpcPje51EpJ0i
VqWSqiEubTGHunnPGNsGL8EueAPegffgA/gIvoCv4Bs4whg7Bm6BHZuxV4BYI5+hbFZ+Yi3ovQVd
GXq2mti38JsiK5+x7J2t3ztEDaa1qbHGdsh5nGnThl32zLS6of3AM4uZzd+JCTGdPNLIPxvfm1/A
FJfzoAl5bOs8KmPN8sjOtapht0TVXKtNsPvfGl5AO2PUMK9rqOWZ/5lbFf92yX+FHR/Z1SdoM6bm
jDTX8FfEmDVys7XWKN21df/L+Ra9WDH0g3t64eT+aEIMy+iPrftj1nt2HzORaXNjrVnYHTDsip4e
Nnp2E/Ne1FauodDLc1bM/DlDb/2e+cm9e65rcYx8LG33j/rYKcxakUs5pl36Losc2V++119QSwME
AAAAAAgAIQghApkdSEvJAgAATAcAAC0AAAByZXMvbGF5b3V0L2FiY19jYXNjYWRpbmdfbWVudV9p
dGVtX2xheW91dC54bWy9lL1vEzEYxt9LeuSSfpC0KV+CASQkVKkJAwywVLQshSCQWsGAELiJSazm
PnTnJM2UMiCxMMPAvwACFTEwlx0hRia2LogBpAqJwnMXn2KOUMrCRT/Z98R+/byvfU6TRZUMkUFH
adsgOkjqQX+NBk8BnACnwVkwD66Cu6AF7oPH4Bl4Dd6Ad+Aj+AS+AxMx8+AIuAQ6YGJC8jV5wfM4
85lT5RCarOu25O26z9pCdml01PUFdySTwnUolRI1yuVWWHW17rstJ3xpi0CsiGY4uFistbymqDLJ
rzEfs5Ywj9PYmAraETXZoPFx9drgot6QlM+rd5v5deEsux5NTf0izbtSujZls0GVNfly1+NkWbZw
bkTxcrlAOPUmrwiHD4J3+sGz2UWb1fl1wTvwEQ5hfiUaQaa55LFqGGoZRYhGZDLMqfkukpydVb21
EvO8qmt7TJbaGFOyudMqVUQgr6CzKLkdzZyZaUjpnS+Xg2qD2ywoqeklTC0zb7Xs86AcBzfNQHab
nGjdsOgi9uYMGcYG2ARvwXvwAWyBL+Ar2AbfwDHDMObALXAPkJGnQ4hxGPzAM4V2GqSgS00PnyL6
RfxG1LmKxqn/rf7xiLSMpoVtqFmatqO0sYFmwny05hNox7U196s194WHWsVPD+YZN8nqhdqIpp2k
TG8PPkxkH8XL6tpIX8sltLSqU9Jb6PkB2lOanleezciz+Zvny8rzvoE2Gfv7i+dUm9K9sH9Ai/eC
Jnqhj83oLAx8TCofVrS6FfkgLdYWYk33r4tYK+SH1PjpHv3u7LLX44m5yRxeIYe4xskcwtzuoD2n
6QWVW1o7ixl9z5Q2bL8nBhp2dn0uXjcZP67pwj/U9PMea/rwP9R0Q6vpwpCaPkdbGfKtZaKvOkPJ
PApD8nik8jA1f6kh98BueYxqWhxHz+OllkfSb6wnv7904l6L7y/jD/fdT1BLAwQAAAAACAAhCCEC
2FJLNgsCAABcBAAAKAAAAHJlcy9sYXlvdXQvYWJjX2RpYWxvZ190aXRsZV9tYXRlcmlhbC54bWyN
kk2L00AYx59p2iZNmtquexDUoyArJL2uiKIHL/aki4IvyNDMNoNpEpJZuxVk6wfwC/gRFA/iRTzr
WU/qxW+hV/Wf7ISEUtGBHzPzn+dtZh6DLLrfJmJ0ht4xom3SA+uI6tEHZ8EFMAaXwQ1wF8TgKXgO
XoCX4D34CD6BFmL5YBdcA72eiCKZ5vKJoMEg4svkQD2cZfyxVEtynCSTIlZcySSmVksGkFIeBDKe
TcS+ItvWu70kpX5fb27KWahoNNqXKr+1zJWY35FxkCxymOgMCxmokFxXb0NRuth2DvdITGQs6sPF
8aHrKnGorkZyFs9RE1nWHva3pViQafI4yBKUNx7r1aHH03SazFOuPCSbCeVdl0rXUcTn2aQMTzs7
oVLpRd/Pp6GY89zTETx4+zx95Gci96v4pinjaXQQCOp2j8ujTidXy0jgbVfMokuYXxFjb8EH8Bl8
AV/BN/Ad/AA/wQPG2DPwxmCM2JBOwfc0+I0xwDws/2tIqqEX4wQVvbFNbd0PpZ0+t7BlWjNrbauY
C81q2FVab00rchY9d76R09U5HTKwcsr41PAzdE5WayODVqVm1Bp7TdZRobVrrRWQUWqdht056pZa
d4Pdv+7wS2v2hvv3G3ZVvpONHPfwL4b+i/X7V3/hNfTRhr/43/qcWoP76kqx3mq8AV77qKplPaex
1i9VX7C/9NEfUEsDBAAAAAAIACEIIQJo+yn05wAAAIQBAAAnAAAAcmVzL2xheW91dC9hYmNfZXhw
YW5kZWRfbWVudV9sYXlvdXQueG1sdZC9TsMwFIWPHUoztFKHVmLoyFSp9sLE3pEVMQFWY+EI0liN
+8MEA6+FxCPwMLAWTlJHRZW40if5nvvvBCneBCAwxgeAU0SjdoGDdciQnBNFbomUeYZe78k8l6tw
t8mz4NDvR9fZ/MEFdLtmkS1LJk6n8bVVxvt5WXgT1Dq3G1XYxUrNtp5xm13RuaaKycSF4C+1rubO
FqZSsVyxVBv/qJe20m1zvIq02e8TQnyRbwIxwBm1EfmhJfEOSf3+j17bSXPfEEl9eMxDjKf8jRuk
L539t7SafEfSaPKgDXb1nKO5bX/xzz6/UEsDBAAAAAAIACEIIQK6vaHgGgEAABACAAAqAAAAcmVz
L2xheW91dC9hYmNfbGlzdF9tZW51X2l0ZW1fY2hlY2tib3gueG1sdZC/S8NAGIbfS9Qk0pZUgjg4
iVOHZHdUuwu6y5mcTeiPlOSidtI/SfAfce7uIDjqqr4pF1KKfsfD991zv8+GC98CBA7xAWAXJgRw
jjb6ZJ8ckZAMyRVJSE4WpNebyEVe6etRIe8yvYBlZQk87zaPq1LeTBTreJLF41UdBEk1Z09qdSEL
NdOXmiU6HbPJfZboFN2u6aYqG6UarnuWqnh8mj/AceQsKXIeMRikWs9PoqiMUzWVZWgGwjifRnI+
jgpVRs1k4Em4OGZ+gRCvZEneyDv5JF8EwscB59T8MFxmj1j0z2u+Dod1wObAWv2VZ/7MrOv7xonW
iSHcx9V+rdtr1tp/uK01V+fabbfO/zZuZ8PZG+9o7iv+ed8vUEsDBAAAAAAIACEIIQJWFs5tfQEA
AAwDAAAmAAAAcmVzL2xheW91dC9hYmNfbGlzdF9tZW51X2l0ZW1faWNvbi54bWx1kT9OwzAUh58b
SlNIS/pHiIFeoBLNihATEgNSBwQVYitWY5qIpokSQ9UJRk7BAVgRrFwBcQBm2EEUBuCX4iptKS/6
ZPvze7Zja6SToRExWqWAES2RCvQPKYkCWAZrYBPUwRGIwCW4AtfgHjyCJ/AM8vkO7/unstkO+Zkr
+5RKuTaVy/Zp0HFbXIpdHoqu3JfokmGo5J5rS4dyOTV0hNt2JBUKauzxsO126+JYkmlOuIYfULE4
ofaGtaXShNzypfQ9ymajFu+IRj8Q02U4Ufhn+e2ujZodj7fFgSt6lMnwrh36+KNq1ZEy2LCsqOUI
j0c1NVFr+Z7FgxMrFJE1SkZcMJ3W0d4QYw/gBbyCN/AOBuADfIIKY+xWY+wOEDNpBXUV8I3IxXcM
UvBllvg4DPTL+AxKDd8wr94yntPxpKZyLHGsSfr5cL3EFeM2dlrizC/l5ma4dOLS+M3hHvMzXGbc
DX5r9Rl52bE9MurMCzPyFqfW06buanQn7J87/AFQSwMEAAAAAAgAIQghAm57e7JTAgAAdAUAACgA
AAByZXMvbGF5b3V0L2FiY19saXN0X21lbnVfaXRlbV9sYXlvdXQueG1slZO/ixNBFMffZBOzWZNz
E3PHFQpieXibQrGw8QdaCBEkHlqJjNlJMrjZLNlJcmejFjb++BvsRFFBsLW0s/E/sLERUioiyOl3
N5PsuuZQBz7szHfevHnv7RuDTFIFIkaHaMqI6qQH5h4lowoOAwccB2fANdABY/AAPAEvwVvwHnwC
P0AFvtbBUdACKytKbKuzQSD4kPttQaWS8DwZhPK2wKbHdwYjdaM75GOpdiiXky5ZVoe70u9ecLuC
6nV3FHiyzZW4zIfCV1cUplQu65MT6aoeVSp62ROy21NUrep1nw+70m+KjqJa7TetFRtaVoibPNGU
vki8TGZeFpfcFN5gQmtresk92fVn0cSeV1f/3NgaBEivJTyu5Fg0430yzS0U46oUEyoWue8OB0h3
c1PPth0eBO1BP+DKGcPG6Qt/5DRlqC5hclGJfnxyY6OnVHCq0QjbPdHnoaOPOzja4MGtxlCEjblz
ustMOo//coIYewHegA/gI/gMvoCv4Bv4Dq4zxu6B++AheASI2bROs375iRH1x0GQg95M6dGoxes6
5XQvRXb79L5JZEffSCsmWu4pGXciX6+hHUn5OqB9FVO+csm5qq21QqLV5v5TdxaYtkvdae9qOzMV
xzPEEWmllPZca/sTLY+qno7inUI7lorX1vFaZCzipZSvqfbFUnHktZ2RaOwVmbFdPpUr2f+U67L6
LnK1lpytLNFWMpqh/38216gG7/A9uaQGpu6AbA3Oocey+T7W+f4tt93/zK28pKaVPXLL5jDXs/1o
ZN7CvOfZHm/kF1BLAwQAAAAACAAhCCECxs53Qx8BAAAUAgAAJwAAAHJlcy9sYXlvdXQvYWJjX2xp
c3RfbWVudV9pdGVtX3JhZGlvLnhtbHWQP0+DQByG3wMVsH/SGmIcnIxTB9gdje5G3c0JWEj/HIFD
U2OiH8mkX8TZ3cHNQVf1pbmGptGXPPn97uHu4M6GC98CBPbxAWAbJgI4QZM+2SUHJCCn5JLEpCAP
pNsdy5mq9NWwkLeZnsGyshied6OiqpTX44R9NM6i0aL3/bjKOZI6OZNFMtUXmi3abbPJXRbrFJ2O
GaZJNkw1Wq1zGWfquNJaTeE4choXil8ZDFKt86MwLKM0mcgyMC+CSE1CmY/CIinD5WTmSbg4ZJ1D
iBfySt7IO/kkXwSihz3OqflhXFaPWPTPK76Ow97n48Ba3Jdn7s2s6/eME40T93AfF/s1bme51v7D
bay4utZus3G9b+O21py9do7l/4p/zvcLUEsDBAAAAAAIACEIIQJdoWy+sQEAAFADAAAwAAAAcmVz
L2xheW91dC9hYmNfcG9wdXBfbWVudV9oZWFkZXJfaXRlbV9sYXlvdXQueG1sjZG/T9tAFMffxaRx
nB91EIo6wNSNIR7oULEghnbKECFEFyJ0ii/2Cdux7GsCFRLd2j+gfwIbU8vMhsTKVGXjL2Cja+nX
5iJbUSv1WR+d7/veu/fenUEmDQwiRus0YEQ2acP/IRXWARugB7bALhiAIQjAGfgCvoEL8ANcg1vQ
bitxonbjWPCERyNB9boIAhmn8pOAM+Cnk4/qyEv4VKpTqlSkS41GzF1XRl5fjBU1m3q3Jz1fkWWN
ebZ753oCPp0/k67yqdXSW1/ksaYZyuhD7rKsFEmB6MtIIC7vKZBeFIpIoeD7hIeinycjax/eAylm
VKvxyE0m6Glz01cq3nacdOSLkKc97eiNJqHD42MnEamzCP7MTHqL2d8QY5fgCtyBn2AO7sEj+AV2
GGND8N1gjJhNr5DXBU+wNtaXoAL9a0nPrIn/NXxV/UZZ3Ir2m0RVpORa9S9ardDsbM00s9AqUzLO
M61ezr157mMO7XWpj5buo55Xfz6fSmc96LNYqebKYq5C69haMwqNdVEx016U4uj/ZrB/a80qtNVF
XKMUl92Poe99eS5j6T0W987+8U5/AFBLAwQAAAAACAAhCCEC8fL0uygDAAAYCAAAKQAAAHJlcy9s
YXlvdXQvYWJjX3BvcHVwX21lbnVfaXRlbV9sYXlvdXQueG1snZTNaxNBGMbfTZpms/0wta3Wj3oQ
ehFMEDyJIgoiYi1SiyJFZJqMyeBmd9mdptZL9CB4UC8evIj/gAh+3j0IXgU9ip6LHjwoiEL1mc1s
Mm6jVif82N0nM++8zzsfWbJpwiayaDudzBBtI90souvUbSNgEpTAfnAIzIB5UActcAvcA4/AS/Aa
vAMfwHfgIOZOUAIHwAw4CyrgNngOhoclvyQPBQFnIfMqnAoF7roiiMRljj9dtuwvyvO1kDWFXKaB
AT8U3JNMCt+jTEZUyXEWWOViLfQXPfXRFJFYEK7q7DgXWFV4tSPVGqexsepi4IoKk/wkCxHiFIJw
GhzUMyyJqqzT0JD+rHNRq0sqFvV3g4U14c35AY2O/iId9qX0G8g6qjCXzy0HnGy7IbwzcTzHiZCA
y6eFx7vBl9rBO3MvcNdfovFx/clcUfPaSaoJC4VjDVbjpwVfwhAViYXTcU/UZ5a7qEWTa8G251DN
uGs+z7xq6KNCu3frt0slFgQVvxEwWWqiT6nBvcXStIjkCbwck7wRj9y1qy5lsK9cjip13mBRSQ8v
YWiZBRfLIY/KSfBcLpLLLqcrlk1zWPO9ZFn3wRPwArwCb8Bb8B6sgM/gC/gKvoFJy7IOgnPgKrgG
bgCyijSBmJvAD7TNeG4BGejS0FVT/cbw69P7V/XL6v+x3YuW1gqGpp5KcwxtVWvDXS0HI/Gcd6Ht
MOYc1XP2q8Oj4/d1x1nzZLeUljO0Kcq31pFHDu7jeAOm1tfWBlNaVtcpnZvKWZ3pKUMf0znn4pxz
a3I+rnO2u9rGJL+/5JxpUral3rca8R7RcCup3R4jj/FO7VTrb69rd9xIUdfzL3nkknXttYbFrgaL
Vw6mc3usc/sI7YCR2yadmxPvICeOT4bPFfjc0r4yO3P29Vj/B7qWecOXSuo/69vxtaHH2I0pLe31
Gbwm+yTtVdUAW5yO9qiBHa+KvaYGn3QNTL8317l3Vv/R20iqpn/ylvaQ6Om9pzw/xHO2x3nOx57z
a/bkSI81vqM99xteMj3umj95HjK05K4w/T01/KXzTfT0Gc+m7s7kjrR+c6f+BFBLAwQAAAAACAAh
CCEC7leC3ykBAAAkAgAAKQAAAHJlcy9sYXlvdXQvYWJjX3NjcmVlbl9jb250ZW50X2luY2x1ZGUu
eG1sdZCxTsMwEIZ/J4SkVSs1UocOjBlQVSViQmJCQsCCxMyErMYkESSOXBfoAoy8Cy/ThykznIND
qgpO+mT7993Z/7kIEDkAwwE2AHqwwYBTdOERYyIijohz4pp4IT4IxylSDAYPfCWX+vapSHWO4dAe
c1FkuUa/fyeVyJRcVinCsDtcKv5Y6BV8n1epktRpNrO755jX9VyWNdcxdc2Ejs9kpUWlLxQvxVXz
AKbTXOv6JEkW81yUfBHb6pgqE17fJ0oskra355VCZQJ4YwG5BtZgbEN8Ej3GGByCjTChu5D4ojD+
feOT9GhLNxE0sxn/zsrkvNM62crZtzmeGaztBXtP9ewQwav/M/ZWG5m1efMPze0054b+bbS9TguP
TY71sPsPd8db64H94/kbUEsDBAAAAAAIACEIIQJj6Rb8iwEAAEADAAAgAAAAcmVzL2xheW91dC9h
YmNfc2NyZWVuX3NpbXBsZS54bWyFkctKw0AUhs80bVN7EW+gCxEXgtJF0oWCCIIgCEIXQkU3gozN
1Ay2SWimVFe69BV8Hx/AF/AhvK0E9W86aYdC8YSPM/kzZ86fMxYV6MAiYrRKp4yoQjqwPqFxzIJF
sAlqYB/UwQVogSfwDN7ANyiVwq4UgeJKhgFlMtKj+fmWVHHjLlaicy4DL+zHlM+3+V3YU1QsyqDV
5kp4xx6Vy0P1si895VOlol99Ia99RbbNA68b4shaTa9uHR5FzbATceWg6Foo50gq3aUuA8G79WGj
ra3pJWdS9Buqd3WYqFSt+kpFe64bN33R4bGjKx1UuTy6cbsidlMrti2DZrvnifE/PbACbSRzYewF
vIJ38AE+wRcgNkcr2LMMfhE2chFkoD8a+iAKWC/hyVEmuZOivhv9bY5pjY01VqXCfXLeWFsY5IGW
M2pTLT+hpT7WDB8zIx9s5MPsuaN7WoaWpVKiZQ1tW+/7z8cPsqXnNOlj4G8Xed3QS9ofM+ZTNvou
wUt63mSdNXEf6dzZlHv6A1BLAwQAAAAACAAhCCEC69QBSngBAAAYAwAANAAAAHJlcy9sYXlvdXQv
YWJjX3NjcmVlbl9zaW1wbGVfb3ZlcmxheV9hY3Rpb25fbW9kZS54bWyFkctKw0AUhs80vaQ3sNJF
hSIiCKWLZKMgLtwoBaG4Kag7ic20GWzS0EypXdWl+D6+hy/gxrUrL1v1HzuhIVA84eNM/pkz/5wZ
g0xqGESMmnTKiCqkA+MurSIHtsAusMExOAdX4BE8gVfwBjIZ4VKtNhAy6s0jyf1LEbjjWUT5/MiZ
j6eSSiURDEaO5O6ZS5XKUr2eCVd6VK3qX4+LoSepUHACdzLGlratR3eWE4b9sR860kLRkEurI6R2
6Uwcn3eXPq3W+ooLwWc9Ob05+VOp3fakDI9sO+p73HciS1daqLKd8Nae8Cj2x5lE0B9NXb5qCXHP
TNpBfibGXsA7+ACf4AsQ26AG5pvgB5FHLqr7gi4TuooCxnV8WfUQeh3peROv0yZzUVw+U6xtqqy0
7ErbiLVcSlOeh9C2E54l7ckSXuWEZ53KC0P3kK5T+z0g7yV0U++XW9PDge4hk9Cy8FCakdD29br/
+vpGjs+XPoeRuvv4jtmaN/kFUEsDBAAAAAAIACEIIQJPIcUZbAIAAOAFAAAhAAAAcmVzL2xheW91
dC9hYmNfc2NyZWVuX3Rvb2xiYXIueG1slZMxb9NAFMff2XGcpgkkISkghaEIKWpV4rAhNkoFC1Ir
UdERXZ0jPtXxWfYlaaYwMiCxMrAzQj8EM4wMIPVDwAq8cy7YmEYtZ/109t/37v7v7p0JJTi1AAi0
Yc8AaIFuBCCEtJWQBnIVuYXcRR4hB4hAXiLvkBPkFKlj/A7iIQHyBvmIfEK+IJYlPTZkYNuDiI65
nIJh8D6Uy2Me80PuK6Vef85l/GQaSzY84EFfTGKoVHw6FSP5bML70oNqVX96jA88Ca2W/qY+HwR7
NGKB3BchrK1JMXK92I0YC7Z94R7FD4U7iqHdDnD5AZVcBA9EIHH8DsNhPFQK2qNBPxLobGtLvx13
aRi6YhhS2UUTAya79101eJtGagbKAxZBt3vB4exYPuVsAr3eBQJ2xyzCBB8nOcL6+vKQfSH8QxqB
aeIv6HQ8KcN7jhO7uOs0XpjrYpBDwyMnYvFtOpICNjfPH+ks9sS2eeD6oz6DYnG+73iusZz6DF6Q
EvTmhUTeI5+Rr8g35DvyA3lFCHldIOQEzBmQGlzT9fULW1nVUBL+t34Z+xpioC4zumpVfG/iU1DF
q+MN/R/rl+xCaaa0Qqo1VK80K9VqC62Y09Saqu6vZ9Zs6DWJvidKu5JZswmrM1PnkI9T833A/mZG
X9Xz2YlzO8mBpPPVe2fktaHzOi+Hn1qzz8i/lNNUa6aaYeEZKb/qnm9k/F7Sfq3EpfWPt85/eFPn
upKJJVCd5X2sEPPPfuZ9KH9vsb+T0SvaXzFxVZzXVGa+G5hX3rOjPZsZf4be94vkkffchtRz3ttC
z9eAmav7RX2TJfeBLLk/vwFQSwMEAAAAAAgAIQghAtnqwcqdAgAAfAcAADMAAAByZXMvbGF5b3V0
L2FiY19zZWFyY2hfZHJvcGRvd25faXRlbV9pY29uc18ybGluZS54bWy9lE9rE0EYxt/JNt1N2sa0
NliopYIgWDDpwUsLHhQPViqI1oqHottkTIZudpfdaWpAqIh4EqF+C08e/XP2rgcPFfoZ9KLX6rOb
2WbYbCmF6oRfZveZeWff553dMciipyYRo7O0y4gqpBqufeq3cTANzoFL4Aq4CR4AATbBc7AD3oLP
YA/sgyLWmgYXwDxYA6WS5E/kVd/ndmC7dU6m2QzsjpBdyuVEg4rFdbu+0Qy8TbdBY2O+3WgIt3nN
k9JrY7AjQrEunGj66Khjd71N+XBLNGQLc9Vti4tmS1KhENZth690fY64EIs4fFm4vB9nr3sdTpVK
cuuIpnvbDrgrVzyfpqYGdZXGQUgdGg9WeSAFnkWzs3rIfSFbvbClx7dEGGWApJbadpOvCr6FStzh
ji1Fhy/HUWRZKyhNPGaattsIPNRjbq4lpb9Yq4X1Fm/bYVUNVOteu2b7G7WAh7Vkcj4fyq7Do317
xiy6jv4yMfYOfAXfwHewB36B32CGMbYGXoBX4DXYAW8AsTJNYY0z4A/aBPrTIAf9kaZHrYzrSfyM
+K0x4nnDatwiKkd9pJl9Lc8We9eTfY29p9J2tH70Hp3X1j+l1reiFxT/cR5anImsIi2vPZOpfLU8
2EUa3h7IY743z9JiTRU70tcmEg+jKS3t4QM8GKp2aQ+Rt1301QxvhdhbYcDbPbLinI2+lvtCxnba
b27Q74G3f+n3k+a3eojfhWP4tTL28n95i7TSEX4/an4XMvxGtm5o+rjyOxLv4EicC2l7+UPtJetr
4/PJt6Y9t6LqMqT7HerNO6JW2d/fTG9e4WTqknuJ8ySpS9p/8k3fzaiLFbu0BuryU9VFr8GkqsER
3sr7SsvyVsyo6dgxvKU9GKlzMjkP2SHn519QSwMEAAAAAAgAIQghAo+l4OVQBAAAkA0AAB4AAABy
ZXMvbGF5b3V0L2FiY19zZWFyY2hfdmlldy54bWzNlk1sG0UYhmfXdvwT/yZtGqCBlgSkBrAPRUSC
QxuaA5UitSpVOaAKTdZje9X17rI7jpMIKS2B8CckjhVC3BEgECAhpB574YDUA1RVxQlxROICgnIA
3tmdtafLmiQKB9Z6tON3d2a+7/1mxk6RHHmnRIhGDpNHU4Q8TOSlEfIFGV41MAOOgeNgCZwDz4Em
8MAV8DZ4F3wAvgLfgB/A7yCNMWtgFhwHJ8BZcBF4YAu8D74EX4PvwI/gZ3BH9NEJeQp0gAvKZc7W
+KLrMupR22AknxfCKcdyPLSZZZmub24wks22Pbpq8nV0sei60+MvRML4uOOZzOaUm45NdN1skkJh
hRqX2p7Ts5t47tJm07Tby6zFSbEov50z2x2OOVqO0fPpisXQa9X0zRXTEqMWi3KavtnkHVIqya8d
FvSr1eT3LvXaph0MPTFxlxZOMDl5l/i0w7nTxbS+QS12ft0V0/oIx2LLps1IpdL0aF+EczYMczhz
n8mITdvt8aBrudz0HHfJ6duLttGBZYWC2WVnXOGEj3gMx+ZwZon5hmcGqtLlmXC86emBAB830INa
Z1otn3EyNRU9usA8bhqDB5VKGNOS6TEjGDafP92lbXbBZH1YJ1Kh3nLwDsnlzqOkwZNsltoYEhVa
WJCttTp1XcPpupTXYXWb8fqz6Gt0RIe5sLnY484pvGIxzkgmY1jU98n8fIdz98lGwzc6rEv9uhyw
jsEa1L3U8JjfiKbLZHy+jhKn06siDnJZy5GXsJ4fJ5p2FXwIPgGfg+vgBvgW3AS3wG3wPfgF/Ap+
A3fAH2BG07SL4EVwBRzRNc0ATeCDLfAR+Bh8ltI0olXJNOYW/IXrCO6zQIfOFV1c96N9AJ800YM9
LN7LyOc5QqqRNjbUtC2S2xRaUXlP3IVWimlizlvQ5pQ5H5Bz5jFrND4Z9tMXkfNseLwMtCeklhpq
tWpCbC/L2MaVOHT5nhrvnyPiFVp1qGU0Pew7qWoiDulxPC+R76e4P6boMzLfbOBxNhgvvUMer8g8
CkNtIopvt3lMK+MdJKVN0Z5TPB0nqc0oj3i8Io/ruC8krJXcHtbKdsJa+beYy6rPuXC8SoJ2YKjB
yssnhHZYGS+l1OLkPmvx+u7WlHaMjG3G84pyrSlaVraVWmjXSHlQi5MJtXgP99MJtRgLdgQZmcdO
9Xljj/WJ+y5iW8OGeF6J7SEZWw2x1aKzJ1ab3fj+powtq2hRDjlFm5e+5xXtEakVY/s2lldGmwu1
iYR9lrTGDioxa5hRaFMJ6/2Q8l6U7z0JHt+bEN99MU20H8T9aJh36qhy/sR9j87bVsKazyv7difv
X/2n9/oNnBcx7wf7MZ+g/Vdn1yTOrijfeF6RHt8b0W+dvc/fuqt72B9izp+gbSR4X9iD96/t1vtq
gvfV0d7v5zdRrceUUo+NhLNKeLC9Tw/e+p97cEjxYHvEmoyvvUhfGKHH/5dpI/7H/Q1QSwMEAAAA
AAgAIQghAjGcyFUaAgAA/AMAACkAAAByZXMvbGF5b3V0L2FiY19zZWxlY3RfZGlhbG9nX21hdGVy
aWFsLnhtbIWSQYsTMRTHX2Y629ptZ9u6FgUPikLZBVtPexAP7hZBQddFi9clzsQ2OJ0MM2m39dK9
6zfw4GcQBcGbN4/iB9AP4MWD3gT9p03pKC6m/Jrkl5f3QiYuleinS8ToPH1jRGfINowTWrU6aIJL
4Cq4Ae6BQ1rEPQXPwAvwBnwAn8A68tTBOdA1OcEE+H7Ep2qkD/spH0s9JceRIZXLWZCqKHrE0wyT
xzyUcf9m2BdUrQaRTHrqgIfGUaVi9x/JUA+wbKcDIfsDjfQBDwaiqyKV3pKxpmIxlGMZihRLaizS
B/M6d1VoUmsx0buR7MdDgdBmM1kU2VNaq+G+2huhjzOq1+1CTyX7qid1JJCXx2GqcPadHTuatHmS
BGqYcG1G7d1IpLqrYm0qivTyfRFMg0jckZl+KMURuS6iyPOCiGcZtVoDrZNrnU6G8w951rZZ28jY
4cmTTiqyK3ykFW1v/z+yszyd52V6ivMWCmNTk45Zia7j+7wmxj6Cz+AL+Aq+gx/AtC3w3mHslcvY
W3Jn7wCxGp3F3hb4hVZF35i/mT/9hn03DvwBW3nTNjHexG+DHPLx37DvzKyVsM2l47ljK8eeU2lm
nJOLMxPj3Lyz5ymsXGPpvJWrmd64tX+4Yq7ucm9p5ZyXuAfjTuX2MhtXzjnP3sF6Lt8FWpsZV8m5
i3BmXIPzF7Vc366fzsXdZv7M/euel/fJTrh/dsL3+g1QSwMEAAAAAAgAIQghAmAHuJ/yAQAAIAQA
ABoAAAByZXMvbGF5b3V0L2FiY190b29sdGlwLnhtbI2SPW/TQBjHn7PTxkmckEKQGEAwQod6QUJC
LBQxIGWiFR3hiI/4lNjnni/qywJSv0GnzkxIbMDKxsDIgCiIlW/Ay1j4272QUxQkHumnu+f/vJzP
z/kU0JUaEaOL9IIRnSdr2Oc0sxVwCVwDN8AtcA9sgRgU4AAcgufgFXgL3oNj8A18BycgQO9Ox4hd
czvPBdc8GwhqNErhjhorjb0Yj2VeyH1BrZbSUmSGG6ky8jwZU7P5mA9GQ60mWYx4zuNYZsO+eGIQ
st6myikMrXNfDhND7bZ115UxKkV4zPfUxDzckbFJELZuImy69VOuhzKjIEj57laVWm37MhPF7IwN
w7Vz/l18WhiWOVz3qz6o2sQNH0ixQ/U6z2KtcJfV1cSY/GYUFYNEpLxYs4G1gUojno8iLYpomgx7
xgLqY71OjB2Bl+Ad+AA+gk/gGHwGX8AP8BP8ApcZYxvgtc/YG0CsSxfodOa/Yeew9oAH/ZGjl7ZS
xXrk2/dQ5vk2HhB1mdWajnaCtdRac1rZP0bBVaf/Wdu/S7W//WlWx75S52nv9FlONa/J/ErznP6+
ra05tSMKqrwlp7Zla5edvG1arrS6o02sFizIayzI+5/7l1ro1Gpb255pSxhOdY/OgrudWfAt3TnN
t7Od/8f+3Myns2X/eAt/AFBLAwQAAAAACAAhCCEC0InogCUCAAAUBQAAHAAAAHJlcy9sYXlvdXQv
YWN0aXZpdHlfbWFpbi54bWydk8FrE0EUxt/sZpONm7TbmgYFFS+CFNqACEJvWkXEgmJDD15kyQ7Z
ocnsmp1Q24N68NCLR8GDHrwp/gFePBmvghfxH1HwpH6zOzFLTGl14Mfb/ebNe9/O7NjkUsMhYnSK
9hlRk8zAs6LJ8MBJcAacB5fAdXAXBCCiPP8heAKegufgJXgN3oEP4BP4Ckqo77qKP1CbYo+T58UD
waUKlIglWZYIqVJJgjAUsku1Wi/YjYfq3o4IVUT1unmNuOhGinzfvPeDQVfIdpxQqaQrI0RCKqpW
hUyGqr2bcFSN5XpPdLbJti+HIZXLV4ZKoafrXguFautllnXjKpXdm6P3vXD0JkX/DSF5MNjI2iBT
Z20JvkMVd2v0qheke2soHMhwEMP48nKkVLLWaqWdiPeDdNVMrHbifitItlsDnrbGyZ6Xchne4feH
PNX795i5dBHxGTH2EXwGX8A38B38ALcYY7fBWYuxGBDz6QTWuOAXxnHEBrCgq4Kuh5/NNahkzrWR
H3U2jzyfGc2eaA7KZFqpkKej1pwpTffchzZf6Fk3PZ2sk/E2Wcfa5D46Qn2HXcjX6u+Zy6M9Z+pV
J3kLuott9mTax9hf8x/8bf6HP8/48w7x1zzA3+mCXjvE3/oMfz9nnM9Yq5h90f7mTb1jYMloSwV/
0z60vxeI5wr6gvFXzlzl9ai4Lyt/e357tD3947k843/U37FoPC8WPE97s6fux/gesAPuzW9QSwME
AAAAAAgAIQghAnLzq6U1AQAAZAIAABwAAAByZXMvbGF5b3V0L2N1c3RvbV9kaWFsb2cueG1sdZG7
TsNAEEXv+k1wIitKQUHhgipFXCJRUlFYighUNMiyrdhK/JC94dEAH8JH8TFBggaYtTeKsWCko9He
nbm7O6vCQqQADMfYAjiEDAZcYB86MSFOiFPCJ66IGyIkOPFEKEoawbbXwWOx4bf3acQTDIdymcTp
MuFwHLnOgmqZ5tdFifH4l7Ro6jSNxw8iufOVC8M433Be5BiNFvE64Old7Dc9MM0gj6qCDp5OE87L
M8+rwyTOgnomN2ZhkXlBufKquPZ2xXhhFly68xsY2xLvxAfxScwZY2AOjmhfI74pDigPxBtJ9zu6
CKuZzwSKnNegHSHkniNy09vThNcraXbHy5ReRuPQemHfxy5hPff8dUTybh3/L3mm2qljelun/aGJ
PzYI0lSRVfn+/t3U3lx272f/zOsHUEsDBAAAAAAIACEIIQI5V5RG5QEAABwEAAAmAAAAcmVzL2xh
eW91dC12MjEvbm90aWZpY2F0aW9uX2FjdGlvbi54bWyNkkFr1EAUx99sNk2ym1236sFD61kqbFoQ
CiJ4FnuziCBix2RIhmaTkIxu18uu4MG7H8APIIjQk2f9AB79At496NX6TzLbhBTRCT9m8n/vTf5v
MgbZtNUnYrRFjxjRJumB9RE1wwXb4CbYBXfAffAYhECB1+AteAc+gE/gM/gBHEfEscwK+VLQeBzz
RfpcPQ1z/kKqBQ2HaS5ForiSaUK9ngyQ78fSP+bPYkGuq/PnMlARjUb6NRIyjBRSC5/H4nCRCRoM
CpmEsTiQiWgS53Wi62Y8CBB/oHhe1t2b8VA8lGKOUFnB84OqgGz7UJyoKmJZPAnyFJZ2diKlstue
V/iRmPFiqgNTP515PDv2clF462TTLNQC3lfMplvo/z0xdgq+gK/gO/gJfoFtxtgT8AqcGowRm9A1
1JScYYwxXwI96B9bejnK/3IVj0U9rKw6T8dtognpWqPR2JTsZamZjWYynbfR1nZrzWk03JTV3VIb
tPP69XrS+sYRGy9Lv2+gXW/5HWq/ZuWy3p81dZtXaHXB795Fv4zTxrLj91yzWv2Xa0OfZ9dH6e8b
5hstfaT9OZUDp/JCrf2M//S8rz33G+3yut9WH5PfmDt9nGt2q/ZMa/86d45zX/fb7cvo3Kv1/WF/
uW9/AFBLAwQAAAAACAAhCCECOar8jxkCAADMBAAAMAAAAHJlcy9sYXlvdXQtdjIxL25vdGlmaWNh
dGlvbl9hY3Rpb25fdG9tYnN0b25lLnhtbI2SsW/TQBTG38Vx7cRJmtIKIQFiYEDqEMOAkLqUDSF1
a8WG4GKf4lMc27JdQhhIkNj4ExgZWRDsTIwgMTB0RuI/gJXy2bnUhyFST/r5zt+99+6+uzPIps9N
IkZX6CUj2iHVMA6pam1wEdwAt8EeuAcOwRCk4Dl4BV6DN+A9+Ai+gBPwHWyirmWJiA9D4VOrJcJQ
Jpl8JqjXC/ksPs4fjVL+ROYzcpw4lSLKeS7jiBoN6VO7PeTeeJTGx1GR7IXSGxeVqNNRyVPp5wF1
u+o3EHIU5AjNPB6Ko1kiUCOT0SgUBzISVeB0GWiaPEwCjnoJ933EHeY8LfLvT/hIPJBiiqkik6cH
ZSLZ9pF4mpczlsUjP42xz93dIM+TPdfNvEBMeDZQEwMvnrg8GbupyNxVsGlm+QweaMFsuosz6hFj
b8EH8Al8Bd/AD/AT/AJXGWMPwQtwzUAsINanS8i/DE7RttBfAA3oJ5petE0q7nqHWmRg1CrjSM3b
y7TyY1Raf6U1K40NyJ4Xmqlpqzir0kymNFvXbi41p9JQerFfaF09rrkcb2trPGa9eeHrHbTrmq+e
8mWVO6e1vhqVtrVNi3983VK+NA+M08a85uFMa2nnZKk1On/5on1D3U99v4WP4tRcTe8rH06Z6qz1
wbR1jXN6u6O8bfynnua3/xt9ze+Z1tZyT5VW93uee+S4x9W51P0btfe8erdszTv/A1BLAwQAAAAA
CAAhCCECZdmbvhUDAACYCQAAMwAAAHJlcy9sYXlvdXQtdjIxL25vdGlmaWNhdGlvbl90ZW1wbGF0
ZV9jdXN0b21fYmlnLnhtbKWVT2sTQRjG30maZPOnMU1b20qhqIhYpCnFQhGsWrBVKHpo7UnRbbIm
a5PduJm09qCp4MFvoAc/goIgCt7FswfRi9/Ai4hC8dD6TDObnW43/eeGH5N9ZvadZ955dzZMGr2I
EzEapFSI6BjJixE9Je/qAifAKBgHU+AGuAUMwKk5/jl4DT6AT+Ar+AE2QAox+8FpMAYugBnAwWOQ
TnPjIb9crRq6o1t5A0JZX7Xr/E7R0ZdNvkrJpO2YhsV1btoWhUJmgRKJRT2/VHTsuiVuqnqhYFrF
ebuKm2WzZi6aZfFkNNoMRamUjLliFniJOjvlbckwiyVOmYy8r+hO0bREnO7ubdKUzbldoXi8YlpX
mw8lEjXMWTZmTcvwIq40O7PZbY/Pcd3ZMc0VeE8mpx29Ysw2bcbj1yp60VgwjRVYFoF1R3Zp2jzS
tNWjaaKZ4/VFisV0q+DYyMjwcInz6vlcrpYvGRW9NiI7RvJ2JadXl3KOUcu5g2Mx08qX6wXDyxCt
MY1msV/niLG34CP4DL6Ab+A7+AV+gz9gHfwFlxhjt8ET8C7M2HtALEP9iNULNnEdRdsHQtDvKrq4
RI314BcWxSfHhWW/hop8QFpDaJqnZUQrtLiibaB14w8o8ftb8akVX4nF7lG04YvFkJeG+D+gaMcp
2QjLdfnji3mfoR1S9G45b0SZl3nxukbdnChrYDv9tV2r0I741uH6OBXoI9Tyoc4ZlPPaAXIutJQv
d8LHS2hnA/Y52mafnQPOmfS0CEp3K17a0zpQ0ReFlvGNc/fQ783N3ViA50gbz4+k54ii3Zf1pAV4
DlqH35+buwnFR28rd6HAWhqntR3eXklvUWXOkHw2pow7ibrer183d35vrufJ//Q8s0/PJw7heTLA
8xu004reIz3H5GnRJ99dd96flG7413EzYB35gFrerQYSag30NOft9LTsprIOv19X99etq/vPArfO
ryt6do86H5Xr6fC0Qfw9026v9niHI/hCtPz5fbi1tBBwhkUPcIZN7FJLhzhfI2zd2wO/N1cfaqP7
v3eszffxH1BLAwQAAAAACAAhCCECbkc+yKIBAADcAwAAMwAAAHJlcy9sYXlvdXQtdjIxL25vdGlm
aWNhdGlvbl90ZW1wbGF0ZV9pY29uX2dyb3VwLnhtbHWSTUrDQBzF/5NYm37SD1EXCoIrXRhx6bKo
ILizurVjOzZDm6YkY0tBsAfwDp7AlSi41gN4AI+hIG70RaY1pu2EHzN585+XeZMxyaI3k4jRCu0x
ojzphnGV/loRLIJ1sAMq4AS0QB/cgFtwB57AM8jn23zgXaqzps97Ug3IMGSD0umeDOS5bIdKNqtL
+rKhHMrl9KsjZNNRVCjod5f7Tdmpel0ql/9JFU8pz6VUKqjztqgOuoJKpX8Vx4r7E077nQZlMgc+
d8XRrw6HQ5c3xakUfUomeafhe9js5qajVHfXtoO6I1webOmJrbrn2rzbsn0R2KPiIbNoG7nvibFX
8AbewQf4BF9glTH2YDL2CIgVaBn1S+AbLYs+BwzotYgetjTGC3jM8MfoOqbnLQxrZF2HmhnRLmj+
V5uLaAJa6P8CbS3in9H+1gz/s0n/QtjH/MdaIrK2rvcxP0VLRtYm9XetKXWpmGbqs4tnGGXbmJrN
GGejP7/iCQ0n8l7pvEZkf4ZeGz1jOeWM5WTeBK4GzcqbitWNssUzmLH7MroXbMY9+gFQSwMEAAAA
AAgAIQghAmMqWRQFAQAAuAEAADUAAAByZXMvbGF5b3V0L25vdGlmaWNhdGlvbl90ZW1wbGF0ZV9w
YXJ0X2Nocm9ub21ldGVyLnhtbHWQu07DQBBF79gEW3lYIUJAQUuTIm6gQTRAQUNBjYTQyl5lLeKH
7EVABSWfxAfkA/gWBC1wHRyMEMzqaHbPrFaz48LHkwCCbcwBnpqgO0Aba2SD7JA9ckTOyDkJAqtv
7WFRaFWqLNJwnCRGvz9Td/m1vbxJYmswGDRHo5Opseh2qySbzvRpkmn0esemzLM81VaX8DyVxWXO
N8ZjY22xH4ZVZHSqqklTmER5GqriKix1FS4v40F8/gLYhcgzeSVv5EJEIENssbZJPhirzB5x6B9/
+Do63K9zdeAs/u41M6hrnI+8ILj3vkb07U7gL5zTuuE7c+3cP9xK60Z1dn/1t+xD/un7E1BLAwQA
AAAACAAhCCECLQJupwcBAAC4AQAALgAAAHJlcy9sYXlvdXQvbm90aWZpY2F0aW9uX3RlbXBsYXRl
X3BhcnRfdGltZS54bWx1kL9KxEAQh3+beCYcd+EUUQtbmysujTZio1xpI4iNiCzJcFm8/CFZOa20
9GF8AB/AB/BZRFv1lzNnRHSWj9n9Zllmx4WPRwUobOEJ4KkJun20sULWyTbZJYfkmJyRILBybQ+K
QnSps0jgOCZGrzfVN/mVvZiZ2Cbo95tjImaSWHS7lckmUzkymfDuWFs5MamcGpnB83QWlzkfGQ4T
a4u9MKyiRFJdjZrCKMrTUBeXYSlVuLh8p3z+AtiBUs/klbyRc6UU1ACbrG2QD8Yys0cc+vsfvo4O
92tcHTjzv3vNDOoa56NeENx6XyP6dg/w585p3eCduXbuH26pdat1dn/1t+hD/dP3J1BLAwQAAAAA
CAAhCCECDxgChF8BAACAAgAAKgAAAHJlcy9sYXlvdXQvc2VsZWN0X2RpYWxvZ19pdGVtX21hdGVy
aWFsLnhtbHWRMUvDQBTH3yWtTdq0tNDBQQdHOzSCDuKkCOLgIKKucjRnc5gmIT2tdbG7s+AnEMXB
r+Ikfogugq7qP+3VBMEXfty73927S15MsmhkEDFaoCYjqpIO5PuURQMsgmWwCtbBDjgCHlBgBG7A
LajVlLhUW3EseMLDjiDbTsV2FEQJchEEMu7LK0GlUjfhF1INyTCkR5VKzD1Pht09carIcfTsQHb9
dBrwYXSuTgbSUz5Vq3rqi8mybfdkuDvNLesQ1x1LMcANPPSSCIe3Wr5S8Ybr9ju+6PF+Wy+0O1HP
5fGZm4i+O9uM72EWrWBcI8buwBN4Bi/gFbyBD/AJNhljxOo0j/1L4BtRwegAA36c82mUkTfxlKk4
6a+j+5yuWSgZk3ntTH/Dr3vXzshcvaBrzcw16toVMseaeIvUFXPnPejz5nLuUbtS7o50TJ2Vc1/a
2bnae9Saf3ow+1b2T29+AFBLAwQAAAAACAAhCCECmr/V7r0BAABgAwAAMQAAAHJlcy9sYXlvdXQv
c2VsZWN0X2RpYWxvZ19tdWx0aWNob2ljZV9tYXRlcmlhbC54bWx1kj1P3DAYxx9f7rjLvR9iQFU7
dCwDGWComIooiIHhBG3X1j2bi0UuCTm3B6hS+w2QmFhZWBhQVT4AXwCpU8XG3LFSu7b9J3FIhOCJ
frKfv/282I5FNXpnETF6TJ8Y0TQZw1xQbj3wBDwDC+A5WAOvKd2nwRdwCE7AV3AJrsAN+AnabS33
9HIYSh5xfyDJtmNhJfCCCHPpeSocqwNJ1eow4h+V3qdSSQlqNEIuhPKHG3JbU7NpvE01dGPX4/vB
B/12ooR2qdUyriuTZdseKX9dmq0i4hP+3pNJok4nc/tpQgRnypbmUaFU6tbrxl31BaJXXDnYkeIV
jvBGyQm65r6IAjQ8N+dqHS45znjgyhEfz5uF+UEwcni440Ry7GSbcW+sRi8xLhJjx+AMnIPv4Ae4
Br/BH/CCMRaAXXBkMfYNXABiXZpFjqfgH6xr3qwEvc9yPbYO5jP4OlS5fVsy6zWELKNOL/0FbrVf
ZH1O8uVat2xirVzrZXXLucZm0EWsVQraEk0l+aYKNYSpUS3UiMdYqxW0v0azC7GnJrZe0B6V0nM0
cq2CZpL+mvfsa93TX/tOf9ade87ukz1w//8BUEsDBAAAAAAIACEIIQL5VFRZvQEAAGADAAAyAAAA
cmVzL2xheW91dC9zZWxlY3RfZGlhbG9nX3NpbmdsZWNob2ljZV9tYXRlcmlhbC54bWx1kj1P3DAY
xx9f7rjLvR9ioFI7dCwDGWComIooiIHhBG3X1j2bi0UuCTm3B6hS+w2QmFhZWBhQVT4AXwCpU8XG
3LFSu7b9J3FIhOCJfrKfv/282I5FNXpnETF6TJ8Y0TQZw1xQbj3wBDwDC+A5WAOvKd2nwRdwCE7A
V3AJrsAN+AnabS339HIYSh5xfyDJtmNhJfCCCHPpeSocqwNJ1eow4h+V3qdSSQlqNEIuhPKHG3Jb
U7NpvE01dGPX4/vBB/12ooR2qdUyriuTZdseKX9dmq0i4hP+3pNJok4nc/tpQgRnypbmUaFU6tbr
xl31BaJXXDnYkeIVjvBGyQm65r6IAjQ8N+dqHS45znjgyhEfz5uF+UEwcni440Ry7GSbcW+sRi8x
LhJjx+AMnIPv4Ae4Br/BH/CCMRaAXXBkMfYNXABiXZpFjqfgH6xr3qwEvc9yPbYO5jP4OlS5fVsy
6zWELKNOL/0FbrVfZH1O8uVat2xirVzrZXXLucZm0EWsVQraEk0l+aYKNYSpUS3UiMdYqxW0v0az
C7GnJrZe0B6V0nM0cq2CZpL+mvfsa93TX/tOf9ade87ukz1w//8BUEsDBAAAAAAIACEIIQJEPF/U
DQEAANABAAAzAAAAcmVzL2xheW91dC9zdXBwb3J0X3NpbXBsZV9zcGlubmVyX2Ryb3Bkb3duX2l0
ZW0ueG1sdY+xTsMwFEWvkyZxq1QqqANIDMwdGmYkJEYGJlSxIRQ1VmORJlFtKGUpH8If8COMHfkQ
mOGmSpQIiWcd+fm+6+dnFxI7AQic4ANAH3VQu0QbITkgp+SMXJArckO21b2+yjJdGv2i4Dg6QRhm
8aZ4tPdrndgUw2F9TJVepBaDgdH5IlPXOleQcqae7a1WawRBnCergg0mk9Ta8jyKzDxVy9hM68J0
XiyjuHyIVspEjdnzjN1kCngVkj8B3iHEjnyRb3InhIAY4Yi1Y/LD8LkHxKH+1tGr8JiPuXw4zPy9
D3VdAqNefVe0mhiz075fx1ftlea2mvMEd1tpvVY7bN6VHd8nfe6fmZvZxD9/+QVQSwMEAAAAAAgA
IQghArMvEiHWAQAAuAQAAD0AAAByZXMvbGF5b3V0LXdhdGNoLXYyMC9hYmNfYWxlcnRfZGlhbG9n
X2J1dHRvbl9iYXJfbWF0ZXJpYWwueG1srZI/a9tAGMbfkyxbkf8GOjSNO2WyAxKFDiVJKZhCFw+l
FLIUymHJlogtCfmSxpOdJeQjdM2codCpH6AfoFPdfoeO7er2kXRCwk0CgZz4cfc+9957z+lOJZ2+
lIgYtcllRC2SDeN3lDcDPASPwS54Bl6BQzAEJ+AcfASX4AosQQl1KpVRxE88MaNqNYg8xxdceIFP
iuLZkEJu254/6jtDQYYho7dBSLWaDN54I1dQvS7DXiBEMMH0mM+CY/H+g2cLF9MydB2Znk2ncbOZ
xi+9yBkk+5fLvWNU8mGQ+3YUwE2nI0enJg/DQTAJuTBRf+QIM03u8aif1KFu1xUi3LOs6cB1Jnxq
yqUmllk8PLIiZ2plhTVtKmZjhxZMp6f4L5+Isa/gG/gOluAH+Al+gz/gjDH2WWWMWCv5923wF62G
vgEU6L8KetzqGD/AZ5Ca3FtD3l88pxNtvpYay7VWlqfkGuuRPo81Ndc0VkvzSkWtlGraNXnla/Iq
hX3jPtb0graSmlHQVHnWC/Q7hbNW5Vm15DTaf2fYxqr1PVe37LmRa3C7eBGPm7mmHJA6V+VdrPvI
/HXv4O/RPfvbL/jr3uDvyR38bd2zv+cFf+s+1LU3nr1ldsPb/wdQSwMEAAAAAAgAIQghAqTEfH4k
AgAASAUAADgAAAByZXMvbGF5b3V0LXdhdGNoLXYyMC9hYmNfYWxlcnRfZGlhbG9nX3RpdGxlX21h
dGVyaWFsLnhtbJWTu2/TQBzHf+fUifPEqSJRCcRjKKIZElVigW6IoaBuVCDBgI7Ycg7ih+xL20zt
iMSKxMLGTnmsjPwBSKz8GSAhIRW+55yxMSnQiz6689f3+OTOVyGLNk0iRmfpGSNaJl3QdigvDXAG
rIEB2AC3wD3ggwPwFDwHL8Fb8B58At/BZcxXq3kx3xFyRp3OhM/CqXyQBc1mGAs3kFyKMCDDEA41
GjsiEQ/FRL1vtfSAXeHIMbXb+nHsCm8sybb1s89jTwTbYYSIO4+mibwj3N3r4TRwErIsn+/dTSeo
19HcnA+u12/63HNVR6yzJQKXx1vpdDDmgROHsOn1dGsAA8+Vg9sRH7m0uqrjvQGPolHoR1xmPW4I
Pgm9bSEnLvX7Yymja8NhMhq7Pk8G2WwYMuTR42HsJsNsLdNM5AyDDphFV7B3h8TYO/ABfASfwRfw
FXwD5xhj58EFQMymFYw5DX6gtFHbwED+pJCr0kK7h59JlfSMbX3W6p1F1F3PxuaZzXRWyTP2hqx9
lZmFfqpWWbWQHaFWHi+QXVzgUT3Gg/2nx+EJPFRWyzOTrcz36DWyfsGtqd1q6erzNdkCt6JHNZ3p
d4+jv3hYebac+dZLbra+g8Wsos+67Jud9XohP/XrrI3UrLzH3QX/Y+ME+6lKN8+M+/guM7+yR5aX
vwHlLVFfLeQd7b2U7vqfjq+041LBx9D9/uHNLlF1P3Mpr1kp3aPMkR1zv34CUEsDBAAAAAAIACEI
IQJN9PuyiQIAABgGAAAlAAAAcmVzL2xheW91dC12MjYvYWJjX3NjcmVlbl90b29sYmFyLnhtbJWU
P2/TQBjG37PrxP0TaEpbWikMFUgRVZtUiAExQUGwIIpERUe4OtfkVNdn2Ze2mcLAgBASX4CRHSHx
DWBF4gPAwMxaNgQ8l16wZVq1XPTT2Y/9vve8vvfikk9zJSJGNYodolmygxFpyoYPpsB5cAlcA3fB
BlDgOXgDPoBP4CdYRo4n4Bl4Ad6Db+A7OACepztiR1C53E74rtQ9chzZorGxXZnKTRkapVrdkjp9
2Eu12NmQUUvtpTQxEfKe6urHe7KlO1Sp2NuOkO2OppkZe89D2Y4e8EREel3FNDurVTfopEEiRLQa
qmA7vaOCbkrz89uit6l40roPG22upYpuhV0smVCtFmWaijRy3RZIIWOjwDqPWomC66Ule7Xf4HEc
qJ2Y6wYMtoVu3AzMy6s8MRm4jJC30Tjl62JfP5Jij1ZWThGwtisSFH9vUD8tLBwfsq5UuMkTcl08
onq9o3V8vdlMA+wIT4fmGghq8ni7mYh0mXe1osXFk99sDr9JuSyjIOy2BJVKh3uCPU91LxT0lPl0
9bDR2FvwGXwBX8EB+AFeMsZejTB2w2PsHbl9YpM0Z3vwN8a47cmiPom5ChzoOqebcQbX0/iNmAa3
8Y59jh5na+T3jTaSaVNmNpqXaZNDrVTQzJrmbMzn1jxn12T2LBltOrfmNI33XVtDMc7k+4j5Yk6f
sPn8gXN/UAPL8lVXjqjrsq3rpBp+Wa18RP3+EdpoQTNjJtMcD/tmajD/D4u5Gs7aGryBc+8fv/X/
8Gv2eiwXy6jSL/oYZe7fb1z0Yfy9xnwlp1esv9LAVemwz3L5LqCuouem9ezm/Dl2L05TR9FzjTLP
RW9DvdgXbuEsDHueHXNG2DFn6g9QSwMEAAAAAAAAIQghAkS0CK3WAwAA1gMAACMAAwByZXMvbWlw
bWFwLW1kcGktdjQvaWNfbGF1bmNoZXIud2VicAAAAFJJRkbOAwAAV0VCUFZQOFgKAAAAEAAAAC8A
AC8AAEFMUEiqAAAAAYBb29ay6PK+D3d3d6sCUtrzDhymKlzCUVzetxbZBBExAXiXQrKLx4igINED
BLhjUeaYG6A7BFNzvmGfN02ge+2jkj3NLQHP8vj5y/55XAUhriSyu+Pvkf33uC9B3sptFSk/sFOk
8o/RVpHyvcJOkeotgcj6+PnL/nncpG6BDP2jkmMj4ZYoz7aH/YF1f9h+VMUdkDFZa7DXk0bCfdKZ
bexmHeFhqWWXeJdWUDgg/gIAANAPAJ0BKjAAMAA+LRKGQqGhDjW3AAwBYlsALUhADmuDV/FXm1fU
O7+S/8t9kvaY21/ijfqT7zPPAdaB6AHleex5+z/pQRV+u2pU+Zz6I/5fuE/qj/kfzU7sx+Y5kvBH
6Fn7fYeC1xJ4M/WiRaqn8FYX6M92rTj1NY6hLvrmugiFXxIDGLWnSAD++6mvBHkhCMpoxgt8Difk
7WuklLoaS9/YtF5gJLv0HUp0K/tmsqFzrzhFgRqy2iCYeR8S0Ksf60V/XlN/3PBmcjyN+/hP7X4J
8J++RNl/E7Bv/1Daq/5UiMJ1Yvgyyf4+UNcx8hJSle4YeycNe1tKGtJf0qsV6okFankdvAZW0yEd
zbzeISzP+Z8NtEKTlHCXH/TkmNqnefLBJqWBuI44q0sV2RHKNxTJDdRuK6LP+u2g1Jy75LnFHW7g
449XrF/idumoB2LMy/bkitGWMQG+suUJEIGJ40M+pOvIrcfP/yJ/L7vQro155X4zumij9qKLQ52a
+QKj1QOkDxJNTOkV2ZfbenDDw9k4DL0jyJw8n9CcqpgRpg8xy0PVCP9NF66aTiK0FMoPilbjnv7z
rvyIiR30sfCYu2LtavjJm/zhNo1LDO14w6dhTIlk0C2Yg2ulklxfWq/kwtdQxHaq3zyv5OtQWpPc
FeWos7Cy+6Z0057RmImCQotibmUlx+Id9QZC2cYsEbAlAAKY7/lwSGivB4VHQNZ/8FDt/d7IlER6
/+acVv7uJo82KF0VfZGlIA0t7uBQzd5XwDLjXR+C/b/JXxP38inaN/mfS+hPGrkJ03mvzkr+/ygF
KSjFuf89N13F8bAHEzdQnXZaHHGv/xz/PfTrLdHqkOb7b2/ZYJ+nXLzMbir5RloFqbR1IRFx5uCH
QGZikUZ9fRw7EweaXfLjupw1m26bMllR+l4LUyRfCyxD0eMkTx1/3H3x40Uf2B1AHmmKXXNeN2od
7PTjaFeHNS25fB+ftchWPy6Qy6iuEo783iL9SY2P44ajmuA92c3M94AqAABQSwMEAAAAAAAAIQgh
AkIZ2l7sBgAA7AYAACkAAwByZXMvbWlwbWFwLW1kcGktdjQvaWNfbGF1bmNoZXJfcm91bmQud2Vi
cAAAAFJJRkbkBgAAV0VCUFZQOFgKAAAAEAAAAC8AAC8AAEFMUEhcAgAAAaBr27Zp2+pTe13bNiMb
mW3bVmbzA2zf2MbzdX7OLjd+tt9cY/anjTW/ICImACUr4wwKGmcUMtYW/63RtG3bpjXwX6uz0BZA
p0Unnue//P77L/PPTyzqBMDqsjmgxrwHP7Ponx/Mqw648igDtbKCZJAiA8mKlQpWlcEA/V6Q4oVF
ixfyRT/AlGSAjSklZRlTYboRMCUY4BjpA8saPHkCMEVp4CpFWHYRXlMwRSjgOEWYoQhPKqhCFhso
wkxFuBm2gEPflMKMhelAuP/RwAt6Zu75SkP/x2IFJWQXhGthAWhUq2DKCFNW1oIGLOZRGKVwCSwU
8IA+Ds/HGsqg48+UOIQ/d4dxWMLASANXwxmcpsQivKAM1EcxfWqBGvmY3tcFmn8R05dtgPbfxfR9
F6BjXN2BVl/G9FV7oG4+pveNgOTjmF5Ug7XnY7rirFNrGUIcIXCLcgY9fqTEIfypP6xCjaf0cXh+
UBsK1q5jCDGEwC3WAhotK5nGkDLfBhqArbKVIWQXAndVsQCg0fQNfXae71rA/Ac2mfgn06xS/jkt
cfh/W+cAg2QjgUfqWBRUptlVimQhwhvNjCoE7dreJNPypeTtds6gWJO0v0b6UJ7gyRsdEovibdLm
yB8MPpQWfOAfR9skFqXqXLNZb8jgJRQTxAfyzZxmOYPSVa5u172VJClFkmTlvm51cwpldUmTHls/
+IFF//DB1h5NEodyK1e1cecxO268yH/+zTef51/c2DGmS+OqTiNDbV2txm269ho2fPiwXl3bNK7l
rEbGyuZyrmr1mjWrV3U5ZxVKBlZQOCBiBAAAkBcAnQEqMAAwAD4tEoZCoaEONbYADAFiWwAnTKz+
g+vfir+wHSmcad5N3aK/CA2xPmA/Vr/R/273qvQ96AH9V/s3Wk+gB5ZX7EfBn+3nsAfsV//7yh+9
9Dz67SJ/JPhd2l/63vkHH+EvtgPUfv++1fO5/oPTx/zvMl9Ef7/3Bv5b/Pf8z+ZfxAeun0Iv1mRi
WSuHLK6vfqY5DjFtOslsHZRoX/HfkaXSNDMZ6/PxyOLpDOVlBNUs+SZjlZvuSQwVF7JF1qAA/v57
MY3tVUKPfVjl2XeHYXMYzgUmlv0INFdq7bwzUHN9qz3JSOrvssMPDwHxDI/pYNSfMcZ/V5DqAKOe
muWytefD9Sfi/Kcsg73/+lW4+J53KTey2f+fzqPj0Oun/0VXm+uVW65CQBBGHBVUqoCZ5SmTMAaK
Hr7L/cZLoXbTISXpubtyCLmrVPMRqVFjLhUMfqnphDczcb7v4RGB6AwKbslYelz1/WA2XwCba1Q8
Y17XoWWVYTMZ+BgPpb6s46D+nP/ir/4gt7+Cydq+ORYjEhlBaHbrFlHBBj2TJwIfNdEB119T54oX
rFSGs7Qp/CKbkRno9A/gPKPvePXzUBU07tTjXuYeaqgqBEcEqZ3+ornb7ewapvWLRg6DqanAfPi8
7VG47p+JMOeHlvBzvJqbfWYE1zTCuWcSo3alo+TNnrd76ntEFQYmaXi3lx8nf0q18tLyK9KyhG8O
5SF8QoOqvTYpFAr7QJQG5lec/MBwkU+4eBOkE+vC9ZcAU7b7YWRoNazlwjVxMKoEiIJetlOmqD2x
72c5orBjNMNKrRUz5ubKiLVj8Bd+CBFKFDvdgh0BXNhWyt5KtuiW+Ef/w0/Yb+InfpVCIFoQHl52
rPKpk7Mf7qZPrzm253g8a19dvdEcBm2ElVzxRuM0hOweLJvwrTIZ/e2X5IJhfP3kozXfY9lkeJLJ
JrXcsqQ1/uj6QQ6aAUTad22UEJMqr744zGeIKcJGC4T1w5fz3JSV4Y0AkuX5yh8jJxVCFCGPFbWP
JiUWgME3FkPk+HAzUyOr3MPJbL4AYPIR8Rx187KFEvdkT1A8lqVVJJb3W858CBC19eg653PaVcyG
C6q7AFvXzvd9tyWrDWv1zOWjtgQ/FYYSC4dm/QLeexZSqS5scmmVHNGjnCps+Ja5ICc+Ka+CFUxb
HgOxKYSTQ79MInvMOwxj7RyRTwSWp+uZ2KuxaOeOoCgS+QWbegbz9p0A8/auBOJKRfqz+a7nzfep
//3OokR4BEcfBfzdf/tApZnsLz8UHHM8XiWHqxAov5t//99USxFfLevI7F0jsSLL4wmWVjnMDoCL
f32aLpX2Z5T/NXs80ktdK75NtHEXXEoimRmVQz9IiJ97NU36sZ90D9IcwU7BMPX4XprwH1d9vpeK
TldyfA+3mXbPnMx6ADArD2CJs7JR05VQHl/NLaVbWdGGboJ+145/HYVo2P4uOJE+2kJqs3UoAunp
nXNBRDcOSAAAUEsDBAAAAAAAACEIIQLbBWFyfAUAAHwFAAAjAAMAcmVzL21pcG1hcC1oZHBpLXY0
L2ljX2xhdW5jaGVyLndlYnAAAABSSUZGdAUAAFdFQlBWUDhYCgAAABAAAABHAABHAABBTFBIzAAA
AAGAY9vW8uS+98c9waVNhc7AyixKanqmkDYVDpW7VCFjQAag07HXfS/rv1jFiogJwN+7JCilCwpS
dSnQaG2ub8R6fbPVANSh6L01ytteaJAAd/ZGaQ8KCUlgwd6M8s0WkQiSFZ4dCdNdnhMNS+zxnCYc
+zxnngOe8//u7fOceQ54zj3bPAeeJZ7lRDJEoqFHe6O0l9FIQhBVZl6M8nW+kkB4Zni6ed1p38S6
3bluTg9n4ZTcYH1sPPZj9YG8eIBkpbc/9r2VJLoqhPhLBVZQOCCCBAAA0BcAnQEqSABIAD4xFIhC
oiEhFmpuZCADBLULyTGQAg6KA6WsXMmqEQ9sqAfTP0Nba7zAdCfenfQA8rf9lPgy/aj9xfgH/Wr/
75xR/XbUf04X/7+8wYKWwgPU/0y/TPsC/q3/ofzK4yD9bgcSjB67A0ttUBgeWDs1c4PF8utmfmuw
iUPlGhqA3JkvO7yq1O9KouZq3gAJ7zdhaUOatD13kIzqtyu3nH2VtumAZISpyuGVa0m/V7LId6Pq
vpx1LTwaelg/3ZY/AAD+tEm/ipsdXHSYpu0IeHvkH/VshZdgbyOE3S5V9bA/v8vr8oLE3L6EOC0C
6V0Fa9zHAGLqrDgl//hyvwPsVw3AjbD/+/74JnyDiVNWn/ijkQJE3JH7pMltUkt2+IDWZaR/pELB
6OsFwE2qvgvtqkSTDd78plyUwbblitjL7gifbPEZID8E2qcXuJk/gB4eQ2KVejyfzZ7BOBiJUsSB
ewtt1OHL81DFCnI1X4oKhRQX0QNn/mvJLP3/4ZyRdnG4F4eO9HQvIV18NVFDZWdLIMtX35/vB7Pa
z4/se6TDf2hz9qSHeymc8nOE0w9P2HEvCQEXHcWwLItoYC2iYAGdQbJCr7L1aSS9AU4/gtThunAm
Dq9o4EoLn8X1JVTHBGlIB1gC/gXvDJ2PFMGwVdt6DF7KC6pUSIKdqr29oqJFGvV1iX00aqp777S1
ffk9POomoC4GzDQOKJ5JalaGcvXtr7Qt94tdcm8fEQCaEBHykJXryOqwtEfAJBi7/nGHneE8JayU
kySmUIGHImBuEdpsEpo/lzRPQ87ZztIuYLKhaEVjODUDx4KOMWwaMxBFDN47TDt8xY4/fr1ciiNh
u5zGFPYvRhdYo8E2lpQIbwnyeOTIJ9iPccG91ej/+2r1daXVdCxvB4MIZF5+6rOxi3y36UviVA1a
Si4+UI5+S8Is4KA/3Y7fv1Lr7fxar15dShpnD+EV5GqwafTuvkfDph4h+vM2Rq2qPPdE1MBh2pAX
IborJF9Sw3QQMi838AP06RmIVSQzPnGscxksl6pl997GP+UbTH4G6p6YrH6bbqLyz0G8h9XUYEvr
vgjF9pOL92XG/coIU9XEdloet0X6uKtoB1FKL18NL/NTExX5VZhEBtY/Nwm5v4ZnsYzrBFcFZzXa
g6wgT28gzjTpV+vvAbuGufyV0bQjLrWlXg0MdW2fZgcmQeeE7DJ5/xwcJXIYFtDNIF0O8mGjq2nv
5fOvh+HtDdDUMVbFxqPzeFTdRWd/r5+yMOicXOmETPmAnwZv+4bKbyNajUGEDSMbw2fGbdU9bxuA
jlJpQiOE+A73X/3NB99LKn/yHaVz8ZmjL/1HpIyf/xi/4ayfAvf87z/g0x2f/lOahmmGXyKQeB3/
Hsrrvo+N2gLYChIEbsSzWr7TjtTisdLD2LhxTtkF94nJdWHJMc3nyvxAf6r2WCLg5So55fJY5tpK
dHmYmkn9UAvEArsWshr3VG7OJ/OKA0m62QfRdSxV9g/PbVr/nz0rebvgieN0ypF0+ZeBMBhAAABQ
SwMEAAAAAAAAIQghAkIjqYpSCwAAUgsAACkAAQByZXMvbWlwbWFwLWhkcGktdjQvaWNfbGF1bmNo
ZXJfcm91bmQud2VicABSSUZGSgsAAFdFQlBWUDhYCgAAABAAAABHAABHAABBTFBIvQMAAAGgbtu2
MUnaF19kZvSIZHVFRjojy7bVtm3btt39CrZtW69Qtu2q79y7f4S/2w8QEROAWiuliyqFgJWxBmUa
a1QQ2moU1g3qHhjoHlSHQm110owF0HbY3W/8tWTzngMH9mxe8tcbdx3WBsCaJFkFZK/4fAMr3vDZ
FVlA2aQYDcx8eStJJyLOee+9cyLiSW59eSagTSIssOAHkiKOFTsRkj8sAGzttEb/ByTFs8peSH7Q
D61rFAG37KMXzxp68dx/CxDVJELTl2TMmsfkV02IahBhzHLGjgl0MZePRVQ1i2P2M2ZCY+4/FrZK
Ec4khYkV8hxEVYlwNClMsJDHI6qCxZj9FCZauH8CbEUajcspTLhwRQt0ZV8yZuJjfqMqsbiZMQOM
eSdsWQZ9e+lCcNw7FKa89xgzyJgfq3Is5tEzUM9jYEtpfE8JRfiz0iUMppE+FE/Ogylm8SKFwQrf
gC2icehmunAct3RBF1hcTseAHW+ALTDqU0pIwq+1AaDQuo4uJMcNOSjA4DB6Bu15AixgcRclLOHD
ygJGvxHee9pAKfNHeP+klFKoX0QXluOSDJTG4A3hbeyC1ujbEd7O4QXD9tKH5bl3XMHw/4PxBfmd
dGE57hoFrZDbEN7GPiiFzKLwlrZCKXXIn5SwhP81KgXT8FZ4HzYYwKYeDO/plAWMPYHBn20toHTv
WrqQHNcP0wqAbfqCEpLw+2aLgvTNdCE53puOClQ0ciNdOI6bJ0SqAKnWNyjhCD9oTaGoSZ9I+lA8
eWbaFkNd+0+UUIR/5OpQ0mbOIn0YnrwoE5VCfcdnjMOI+XVHPco0mTk76UJw3HlYxpaD+vZHKSEI
n2lvQNkqk/+OcfJi/jSQUeXBtoxfwjhpMZdObolQaTp7wk5KsoS7TsmmUXlj1+WOkiShu6a7UVVB
Nffd5BgnJ6a7ra9FoZq6JX/lDsZJibnzmnyrRnV1W//JS+lcEpzj0tP62zSqrVt7p35Pxr5WPiZ/
nNbbqlF91dQ55qntZOxr4WNy+7NjO5sUaqnSuWHHfElSXLWckPzq2GG5tEKNbVvP6Mt+c6QT5yvx
ThzpfrtidE+bRe1VOpsfd+H760lSRFxJESHJ9e9fNC6fTSsk0jTm8qMPe+i71ax49bcPHTY6n2s0
SKzJZLuHj5175Qsf/bNw7ZYdO7asXfjPRy9cOXfc8J5sxiDRuq4l2zUwYszEqXOPPu64o+dOmThm
xEBXtqVOI/k6lWkd3J7r6unt7enKtQ9uzaQ0glXaRnX19XWR1Qo1BgBWUDggZgcAADAjAJ0BKkgA
SAA+LRSGQqGhDW1rAAwBYlsALEe0IN3wv5FeyLYv7B99+acOR24frfuZ+bP+b/xnsR8wD9OP1H6x
fmA/Vz9VfeP9G/oAf1X+5dY36Dv67emB+0Xwhfs7+5/wH/yr+k/+m9NPyHSe+qT5j87w+7W/+A4B
DlPCd3If+z9Kf854rv0r0Ff6v/yPUe/3fMl9Ffsn8A38n/qv/E/ufZ0/aX2OP0zNvi/wVoyIrmIw
J5vK8Irx+vkovf0Cmtpg7rQGJsaqfH1GQkFRL2hWRM7O/uGLVL2/ULctLnvxnmHcwVirt3fB3Hj0
78ri9Lbj+YHCfhBz4JCKvltME++Y1mfBQago2tASUH6b5F4/0fnRtHehQfUGmOPuvCTqd/OgAP7/
/hiu/9RF97v42P9XR5pqWa5B4niFC42EpceoJX2cR4Cj2Bg11PLViDAzUO2S2MJLZTasRkFMhu55
NMkWYIk6sV5wvxVF74pxCngEJ8dL96y5QHDRnbeyvNwhEGJPvTegQv6RtR6Mwttqdxo0qsc+WN52
S+V5sEz+Nu6oNKnP4qLuGredYUu43wBCI7l0axx5psp7iqfhjaWr92LFBZvq1m5iAwWM53TUzrM6
I7Ip6/xeVyFoQLuOrzmjw0LQ6OAvDQHubV3Fvj21Kz3JR/ixLoVPaQtSVNVPSuwQvyk395HwiYk+
BH1nhzNJqRTNJc2tA3dDcDYghyEyHntxtyD/NPb+7MCHzVYthl5dn/8bXx5sFsNfRFz1Q8xVI/o6
fR2blk52m2HEu8b91IMtP9ZtP//9vjJ/eZOqRw8Tb24IX2dNju9VD0DEuMQ0KdnoPhmYAa0EpX7/
S4HlRDCw4GxVV92bz9RgFLl/qw0T/3m48+or/D7gc0ER+4XEl1hD/eP26P555bhhj7n5mFiEmc2n
20yHgy0uNYieSUr5HhhV3zAYZb4C0uCV5ZLc59L5mBEErd+fbbi3xLwfmuN/SmEeol7QvHIzKTVg
2jCMrSBtBW4BS+1E45xZD2RCdMYwowqe4U6ocU0HMzoMb5uhnNQGToMgY/sq5/jmRhQ2XyV/7gek
38CnAGpG+riOkW1360zGq7MSX3iemRasuZ3awrGQ1an/2l5AzS4FgzM/MxD+AXWFWuUBJpFsjFN1
FnHNHMUG0tJq9AaExE0hlyBvp30PLM0f3PcRKMN919eFZ+zzinriT1117HMn7lAiV2ZSEQV6sYIw
qqgI/XmnA6MmXyGz1GnnLue/L9yp/5ZOUF7JL5X+2PoUrwZOx5oYNajQUlm5Aed8r82jw/YgC1/S
b6B3PhuqvWEpfbCrM8rAeOAmd9oda8OOpg7bQ2lNHvv2O7WP/+zP4DNiJPJWUZdR/BXE9FV8jkn5
xCyzf/XWb5LQs3lrCnJQBiEWp/CqeU5DV+aj9UgcYuolUhTFF+poidBp8RzsrGIBmTHHBGrg/nlZ
+8by/8P/E8+rsZxVZT/3qEcvGAQfXcALC0lrCUV+e9f71zC8hOavQef63uNXJXCmMP1aQMgDRXXh
gGNI4o/8zHXjB6x5ags1pBsH9OU/z/7rv/N/uDaK376ViiBeLv3Jm4MiEpYaeX85cQUJ5NReGpEN
2WfHB90qRbePXhgRgQEZqXtcgk3K5AYj1dXbPnfFBMtkAMWx40WtQMCS2UgdMOPmEgaBltpGlg47
ezDp6qKn4dOoPcWbINZkM7Pxvh8c76ECBj8l0iaobLDkm2m3Cp+++Pw46J4XVRnwat4Mneod0D1V
Bg4xd+7ACl1dm5VQhVDNDoHS13gMnpPuwPLV+T/9aYrDD7iLy90K/LXUI19A7nxN3TjaRu0j1Tvo
Nvp6MOXdJynNmWBOVJ2bTzlsTr+z++NQ1wGQCoTmaIdO2yqvlVu4L8kSaJysG2e2ELDkhvvSnNW+
sI6pcMTdHbTZ9h1hnKaBe/Or5E8e4iknZJSkMe4oC9X3ZS4ZhhpNF3zjpV6mKbFuL06RhsjTOd1J
kBFeKjCV6X0B0v1n/cAj1Y2SCmrY2oHCXXhzqnvzjoCofy8ZvxQDXYFmf6ScRNSlthc9QJJeVvJO
paQO4ZsLPz4rhHrOZeBNYmZXGtm4v9eKHCYdWFe9qJgEvtYWlngzIJ6F0nBPkq+6ZRiuhm8SF4ep
Xkj8IMDXohKLT+QeID5Zgmw5q5o8YmVBhYeu9N/R7h7Gr7tycGMl1RENcyhpOy9YCh7FZL8rkCkB
fEg7bTiEK3clZPjYSbf7jn//fzMixuKy5jtmzY/so1yeFDYQYqlQF+OPHdhnc2Bl+2sNe4okp5ZS
7HKAFN7pmWdU5EetPFLbQuJyg9yELdFTlqy/9Ud+Z5zB1VJoVOof/hDSHZTeMHeeHMqdeW/Xouz5
o1LPfNIUHWqDrrZSKC//D3MQHWxdJw05Iqv7dz/ge6dxyeSyGAc87JTr7rpFaXt4JilPuU0JLtV/
6BEVmA3b8jxxcZ+WNaxNM/sehvxGYyZB2+A5u5t4+In/aMPoUuwWL5eEUjj8X8BrdU6/d0kEPeMA
Ahs6AABQSwMEAAAAAAAAIQghAljRYP5sBwAAbAcAACQAAAByZXMvbWlwbWFwLXhoZHBpLXY0L2lj
X2xhdW5jaGVyLndlYnBSSUZGZAcAAFdFQlBWUDhYCgAAABAAAABfAABfAABBTFBIMAEAAAGAY1ub
IuWv+qtxd3d395DDBlxWM4eQnJgIVuNukbuP0TJ/WMXpP0IjYgLgi7VEBuVnIAKLiMYUgFVSVenz
qhILQBlCyAis3b2+vPr65fVuLZABaERB0yExedgCygBC1hF9OC6Dzgcd5wKaWCA7RizGbFo0ICF+
g1xi0qWdFJA6CJUP5HHh0WMToJZoeeck2Cv0ZCsr731SD9tZCQ7gv/9++3g30sFKcNBE0yMnT916
EnN3yeXCpaNiPbDSl8iO8RCzaTndAr2UnjOyHY9Bx6aLgdQ4PZFSPH1BTF7OF6cKPVA5NaMrpy+h
YMjXwdDr6epYTa4CgyK+qKZteHxm2ucz4yNtNUXxwgTIhPzK2sYm3zfWVuYnSDArrOTsgsIinxcW
ZCdbAowLVJbvFQr4WgpWUDggDgYAAPAeAJ0BKmAAYAA+MRKHQqIhDVWDABABgloZ3tZPVBHTLYyG
4/A1tvv0f+J300fMB+ovqq9IB+qvWf/zr1MPLa9l79mf2O9o7/55zB/c813wGb77XFd5zhA7iL0l
8UuNDl5ZsfWU9AD9bg6Z1RGsPbZick2m+9O1f2tJEvbCqq1qj9rtYHgA/7BwkUoSQsFC4f92s00h
7CyenTHwMBHC1CkNJBDKkNV2Us8ecIlDMocYA1jhbzLQ6OYe9L7tcnH0qBAnZEAbvdhfap+KumZT
dgOFlBysngn2EWlCnOf+pbogdF5vjykO7EpBfA25KqZj6V5ciaL/nF7C/el6O+Qi/gAA/vwzX75o
4n5MpdvJRcDnXLRfApA9zmJmXZrRqqRq6ovC28eQ5lQ1AC+9TYLczgL+g8+76UzVZdSf4P4k9w+F
uycPmpa5RuxTzcAyC4rArd2Ds0295t/Rk0Bn0QFF47hPmg5ME+/jlLvdu1+zpPOV1FruWUaR1jQP
E/KEeV0CNe+QlOnop1YKe35R7orXG89tE6EoqMnQDgN6wVi/sRhYVgbad7vcqVmLJP0Mq+JetaHU
ZnpMAkMGjVLlro/BMh3lgYOIPC6l/L+kViPIfWigJbzMldOYfa+GuQ+swweH/D9/4m3/5jDKRZHn
+LVdgkFVcgJGSC6419duN192QJYANDypzrFjOVjcnF7XFI59b0ArS0aQGd8LGGWEA2bj9v4bHeSA
e4OjYumzJZ0LvO6GLqya/Ym2Nkcpn7C4EksKFZ8BwOM/2EfqqMo22L3tMtgQLAen/AaA72LqjqCw
9fzn/5Zv/Jgj92nawd37MajlJNE8xt4GVA8kXczKSkmr37oXbxVGIM6nTWc3r0i0YX+r+Xx60Agu
cnulSUV67eFHrLQGFM+kDOp1S/+rX8HJALsl4bYcLSWbMVDsNksxlpIH73t7hE7Z/4zYK/pMguYf
vvAG04OiFWjdgn4epcsYMJwLs2CBMzBzvnsyEfYw5he4QKiy49H77r8UZAKHn4drxcT85LK9psPZ
5inGaufSeauqVRpAwccrr1kBAwhDc2huI0cq6/V3Uq6WEMcj2HUyubWmjqZ3WbttJcT1fIfbCfN0
GfeLgy2mh7TfB1K+oVYkTVCg0husxnRhSceHHLWJnE/TO2A5SnTDf2ueNvX2gYsf7AXIfO42d0Uc
yNSZTu8U084SwaErd1AymGXnBzHxFOpqK4gQlc2jUWKmTRRd//yNDXSufAm6Fjz1jsxssGslM2i9
IMPBromfMtdbXUgzBf/r3zjU5H5Tsqu/Io6m+/yFqpZbb+4blnrHsFumrPMNijR2lE7dLjKer6PS
zbptEqDgg6OtIy3FDyg5aPtj89bkPfq397M0pAK0PtI+6/pyb/GERBtrGuMe2zxFqL3OL7u4LWdF
eUMckBM1HxuxE8UWseouhs5XMuBMcoGq+SamKyJalSSXQLa2MivzJtPBELBLVHG+SEbKtOxq9hf3
T8QLpWOHh5//3/4IwfuE6FQYIARkQyeXb6rUkvXkca+4jnZYRhfPFttkuEWaGUsKSDIsMBWlSy+W
LkUGaDcJguqrIe4u23R2HaUrt8cI9JwNNnZ1wtFIeKb7r22ilAyIPPQtuCI9F+W1kKLZTtdKgmbs
TRbtl6hCFqkkDGlLt2wI2O6OuD3RyPd/8P/YuAeebasfHkekd9HUSwGEEE7O9LbOsT2KD/PncLRO
QhiBEHGiX9iPWbOt50943PUrK/4XM7v+RH4NPfiTxJV/bPp9KEO/yM/ajj/7oK20WdyFVfPov/6D
mOkl41AJ9deK/fa20KEA2YKHzj2TTJwtv7W3fvWhTQ4+aJL1heKFIF24sWxM+jmui1PKL9x1Bc8v
+6zwp2e/PF935V8ncubIoQu0ohwvvYyAjHvvkDZ4zwo60zByYvxztBb5iWGOhVTdrRmu3oOyZDpN
hbYYNH1I5yTL/50xr1Atq82kf4g0pfhkBkGkRBebKe0DiWMEuCdMk5u0XB49fBGvzuX6Qg7qa1+/
eTS1mhdBZ4HswyQfn/a7Mu2H9gwP1bfsnfJ7lEirxAAAUEsDBAAAAAAAACEIIQL6d0lPTg8AAE4P
AAAqAAAAcmVzL21pcG1hcC14aGRwaS12NC9pY19sYXVuY2hlcl9yb3VuZC53ZWJwUklGRkYPAABX
RUJQVlA4WAoAAAAQAAAAXwAAXwAAQUxQSJ0FAAAB8IX/v+lm27b9/wNJG7RNimRXitQ+bB/Hadu2
bdu2bdvnuXTYtrH7sDrGf/wWMhvMObZzOSImgP5/ZKX0pkpxbJQxmjrUxqhYsLaaEgtj43NLS3Pj
YwVK1FZz9rRhIsotPOFd3/v3RTftv+e+++7Zf+NF//7eu56wkCMiNjpbRhPR1qd+7by70cW7z/3a
U7cSkTbZ0Zqo/MSf7ESrd855LyLivXPOo3XnT55YJtI6G1oTTb3vCgDwXgI6DuI9AFzxvikirdPH
hqj5xduBsCEBXQ+yEYDbv9gkMpwyQ1T50B2AdwE9Ds4Dd3yoQmTSxJboadcAziOV3gHXPJ3IcmqU
ptrPgA1BamUD+FmNtEqJJnrETYBDqh1w4yOIdCoM0buBjYCUhw3gPUwmBYb0DwCHDDrgh4ZMzyyV
/w4RZFIE/xgk2yNDQ6fDBWQ0OJxRJdMTQ+XT4JBhh9OHyPRAk/4bHDLt8A9LumuK6PtwIVvB4UdM
qlua3gUJyHgQvI90lyw9DBBkXoDHkO2KodqNcIigx03byXSBmX8Khyg6/Eoxd2boqUCIQwCeQ6Yj
TYNXwSOSHteMkO6IPwCPaHp8gjvRNLUfEg/B7Qtk2jP8OXhE1ONr3J6hib2QmAj2zZNtR/O7IYiq
4COs21BUugQ+Lh6XV0ltZvhxQIhLAJ7BZhNm9SM4RNbhl5o5SVH9ZkhsBLdOkE6y/CQgxCYAz+Vc
klZfhiC6gu8onaDInhWn8wqkWwzP3R6nO9bZJj0eccKz2bRo9XZIiE8QfEhpImI234ZHhD1+bJmJ
FOX+Eav/FUgRKS6dH6uLq6yJNNeujdUNjaTmTkiMBLuXE9TC7bG640CVsHpXrO4+LEGvxetwnbB0
e6zuODhpdmesdq8lbb8OPkYeN0xrQ6RU9fxYXVxXmojVwD9j9b+qUkRsSt+N1c/KhonIFt6DEOIT
Aj5RsNTS93RA4iPAi/tyLSZ30L443X5MzrawHT0rThdss6qF8pWvx+nHlTwllZ4LhNgE4FWlviTd
v3gjJDaCWw7sN0mUH/spXGwcflfL06a5oecAIS4BeMVQG7rQvAQ+Lh5XLBTMZlQY+ygkxCQIvjBW
oDZzA4fuhMREsPvYgXw7XNr6tdh8f2uJ26F85chdkHgI9pxQ6aO2ubz903H5yvYyt0e56vLlcLHw
uOrAap465PK2VwASBwHeuG2AOyFTbf4aPg4ef2xWDXXMhfoh18LFwOH6I+ol7oxUpfE8B8mewL20
UdHUTTs2/QlAsibA56bHLHWV++vzP4OEbAXBr+frBe4OqYFtK/+AD1kKHv9Z3TagqNu60lg/FT5k
J3iccVCjoqnrbEYnDjoNIlkRwZmHTowa7h6xHZs84J+AZEOA/xw8OWaZesm52tTaLwCXBQf8en2q
lmPqLedGJ1c+tQEvaROPjc+tTI7mmHrNdnhy6UXXAi5dDrjupUuTw5ap92wHJxaO/h0gPj1egD8c
uzAxZJnSyLq4Y2b1DZcDIiENQQS44k2rMzuKmimlqq/WXDz8SzuB4KVX4gOw8yuHLzZrfYrSy7bc
mFl56HdvA+B86F7wDsBt33v4ykyjbJnSzLpvdHJu9SGfvwQARERCJ0FEBAAu+cLDVucmR/s0U8rZ
FGtTcyuHvva3NyBRfKuIbxUkXv/b1x62MjdVKxqmDCpbrE3MLK2d8IYfnbNH0LHsPudHbzhhbWlm
ola0ijKqbGF4+9Tc8tohj37tp3/+3/OuvmXX3r27brn6vP/+7NOvefQha8tzU9uHC1ZRhlnnS6ON
5vT88ur6QYcde8qjH/vYR59yzGEHra8uz083G6OlvGbKOCuTL1bqOyammjNz8/MLCwvzczPNqYkd
9UoxbxRTFFmZXH9xsDpSq9fr9dpIdbDYnzOKKarMSmltjDFaK8VMqQUAVlA4IIIJAACwLQCdASpg
AGAAPjEUiEKiISEYebZYIAMEtgBep73EB96/ID2uKu/W/wF+6H+Y6oAyXar+q+6D4UerPzAP07/v
vVH8wv7GftL7vvpK9AD9Zusi/cD2AP2G9Ln9mPg2/av9s/gL/Yn/0dYBwqv9V7af9D+QvYX+VfbL
Ke/oPyy+QnYXtTf4zfU848Fb61/uvCX1Ee+vlIcongA+wT+J/3T/X/0D8mfkYz6vTn/g9wn+S/07
/Zf3n93P8V3+v3D9i/9a3E8UFqumSJLJV5vDBFGj0K7sQUq5g7T4T3/ilLHksiyqxYVuKNeugvom
q1K08cuW5mwNi0v/5VrKXeU9HIczr5pTYaMHhq9p2XPtbocYBecuem+sTLFBHvtGfHFgmehCr68C
CxUc5y/+wkHKi/TilwglotiL501PqhXz+en1eMg1w+dNVEA53eyqJS/PiS3MnDkzzR+CcIjzjFUs
XJqCXrB/VwvyMFrSHXKn3aLhPSE6IkTQAAD+/9yHf//yH4Ff7alnHsPik+vX98mdM0aqVjpygsck
pfEv+Zz5XtHmNsQ0uRg5FXlEiAFx4S+z8QgiXoyuDmU8lP0KZmweApXzfguUNPgdW1cV1H199quM
rcb+lYmcii617n5bnXViSOQPE3N+3fUEaeOz5jJ/C8QChNVulc3LuRSB53kPsMjf7F6JGjzIqsIC
hn12EimyLqN4n301r7SYcPJgH5TtuTKsLtzMcUYS2yVj2d9icJQsCVLOnSk7a8cfiolxV8rsACkQ
mLLn4NSrqQYufYvElWcxbnKgqt9vVv3i4FY3zhOGcKtfdX/6RGUgNKMdUGUAEPaBEplwmKY3EB1I
akZ+PJ0gqZwuTCsP8kP4/E7+4MZ2wCOjXITHUrOa5ZOQ+s+l78S2JyDX55i+SiTnqzrM9uDiTaYF
5CsA4erDIGrZelyMHwCTJEyFQnaW2gcuZdoq8mbQrE/7bD31RXFtBf4rK/S6ycH/RXAjGcJ0xhPK
rIFgKtGIkNQ2gik489I62cA8PbfhVBR1qHHR/l8jJsB+6mKjff9zOFmihgZXEkMPArwbxoXgNFlc
v9vQZIxBPfJXTDIjBVXmhEXvYD9PaSYQH+45w9iZ/DKDlUSomxKi+Lh4ot483AERmI39YEoAxrwz
8DCfXPWG/4minTRRwaF7PRJe+IYiEUuXkHIOrLd9kVIL68DVg5fDUHV73c3Rar5qm7vRQbhLGriI
dQxe8NDoNt+u8pbzhtJa/Aqo52oAZMpi+AHWnIt8r+Ft/pC76uVYPphwIgCh9MkhWz/pavmfkcg+
I8pIdPxm3BBlF2InNf3vDoK+RPBjnoc2LSFxqnf5fNcAzJmDeteQM4LfN+vL1OQM6ftCrmh3wCif
yI6/4UuJ3K+ul/ak2hv4nleY7SS/8Fyp/9f8E3cpd6msLf8aL17FYm+K2o66JX/30QV8cwl7XRbE
18zFMGvFAxu/4P9hPaXc9FUm283Neok0hHB2LE24xbGl5U3lo4QZ1ShxSfSCz3w/BBbgtPA5jMf/
davRo9Vt7mLwLAAPZpPP42PaoBNm3Y3yyyiv6uew6sVaP5rHUiga5EigCv4CnAbCkA7d6pQOC7mb
0UbkvkVYs/1L7gfKiOy8js/nOTvnvZosu+StqBdgMQXb5LqCD33XVgsep803OabvJW3bL4neYON8
V+xWmMnxU5Nphr1D3YxwrOt8TRGaN6UPjM4++BnR3zZZjfX8c987SmHKyuYDXOtz8J9CkE3LrPWW
DGvDeRz9/OmKbJ738cpcvgisLZDhCW/pY2ONvJNhA0+Pw3ogFEUYEz3aKlSbwwogQkU+pXzPcxWf
SmyQN4kg44Qt9ikBZ8qTfhRN25Ag2B+eYyyalwyrlswmLN0BsJz8kj+DiV8K6FxrOlR/Xk6HCgWW
pvl+Qb8d6bic/9/z3FmBQnG7pU9Go2ddpmVsRW3820qKouWS7T0/Ab9VwWMqc5v//4qDyQFPU9Kv
OZCJfkjCo3cEfvJXa4CXBGRXivBHXhUbUxeglhmqX1EvPtsbCij2t1eWLpdMvuRVeEHfu11lhDdp
XZgj2VeO8vY/8RmY6RzoCScVGU/JJzSDpmlb7u2r/7/6GBpWyUnNVZe2rU7RrPZRy7ETyOR7gVit
vVux/AbJxIQVzAO387tuAFhNcOJ90+eErFmzXmHN9+JqAf2YYNI0CKFBbtx1BOTBRJphGmu6a1lC
VCXfxps1XTYvr8vdBCOujUNdpLchbdN6zrV8y1453PVcxhnx+xhTx5c8l0a+byZbvsl4bpKD2Mhl
veowsMOUx0KJTX7m/GRwuZgCJpMnIn3jhqQ//Cid/OkQOsJ5RWky//qMOdjFlw8wd3fSLxkHNwf/
Q3pzeOIHYJLS6CTG+ovjTEi/rcjDoPz8/Y4Rq70nIF6y2bSr0fU+Wo+8DO+z9JauYkL9icKZA50w
LtENc7IQgVfueMkYFk33Grkp+YU2t67fWDW2VNGJ9tjnDtBiJd9jxh8Bb+9DVKLr7fbb1V86wVaD
7/By7CE0byMD5UtX8Q8JGSjht6X7jhvKu1mVTZwWRwdl7dvecHkduN1rj9QmeN+Hbb8rqIJYiGdj
1PXWzTn4CGycFP6cFOZfDEf3JkXzey83GZhDDsF/U/tL48G3zZD5gYRd+fCjYJTh7JBv7m9Fwrbi
jm7LGEG2WC7PJQk3cVnvp+TczWfQ0LlfeQr99UI8mq2Xq45qWdcNxPY4WupzIiOsL8Fp/EAe/feZ
4WjqEiW/j1YKciPy3F/0Zj7df2jcJCfY7/p4/hDmH1WMYTBZmowy9O6rRUZgc5SEwGKjwVd+pe+T
RyX/0ti0wCUTjqyzoZ4gYJInMsCVp1E7aze3cZtPAdj/8YzfQuo6XBgY8/1GImPKVk45U4uQef2V
y+36G9HtQTsR1hMYylYo7dAuKjDIMTS+3hadfbF9He8iBi7dSaQiPIz6PCAKx63pVU+B4aClpMbr
O6qjEFq0vrAB/1NCxKqRqHoWSbK+GnktX0DUHA2awdTfj+jnw4uz5TxEuVfYqfz1C3G5NFKzeY1A
tWTuO/4aq1WEe/MOOjRS4BhWatJhLZSpTSvD8MJz7xk72rCI/9X6M1tBz2w78mWAebfCC8bCaHRI
kCHWcZslUgRZiQ+7pzigoLi7+FqH5HOQ0gVIuPLtGMi7EfHpER9uhB7rO48bgxGc42i+/nXtNyKe
sOwER/K59KoyDmIYP5nTgk7hwGmWLZomyLwe/hJyAAAAUEsDBAAAAAAAACEIIQLefOYSRAsAAEQL
AAAlAAMAcmVzL21pcG1hcC14eGhkcGktdjQvaWNfbGF1bmNoZXIud2VicAAAAFJJRkY8CwAAV0VC
UFZQOFgKAAAAEAAAAI8AAI8AAEFMUEjWAQAAAZAj2bZqN+dc0EPhBzEzMzMOQWaMHDGNgB3Zc1E5
VG4Mmdm58N33/kn//fWuGSJiAuAvtch47DPMIRQMjMgE5ogAALu6vi7m66ttABA5wUEcXXu5EezG
fLDxcu2oAJ4DHGYfkzEfzwHXxuEAkVJRxoCRUkSHgWsSMEcUkDEDohUQWhDkEwrIoAE9dwB1CDxO
ioyq6CRKHYzfMc+64BoQ819TZJaI3qcQs8d48yZlzJKhrV7OsydEpzKPGhVSg+wODDQuNUirz0ST
Vp6OfhNNfVPZZrL/+++///7771eLAWWgaR3C7t00z9aELbPH7Yp3FJklok9NtsgecxLrFJolpLtJ
h2nwEpfMczXha0CruPkNKZMo+thebKMGmaw+QaTMoYjOVCelDuFXtVwmCsMoY8AoDIlutlT7QgMw
O9HYeeYjGfPTxc7GhM1AI0q/rK17/Najr9uhivlw++uj2xPdbWW+RB3ArKLK9q6+gYXV/bG/Z2Gw
r6u9sshioBW5XVTR1NXT02fAnp6upooim6MeQG4XpKrqW9u7Yr+9pb4qVWBzBN3I89yCRLqsvLwi
1svLy9KJQjePI+hH5NJyXM/zY93zXMeSHBFyEpExbkDGECGH0YDwp1JWUDggQAkAABAvAJ0BKpAA
kAA+MRSHQqIhDHSichABglibUrKV7MsGj1F++ftz4MWze2jfX9Lwh1a+V7zL/rPyZ/uXzS/4P6oe
8TzBf8F/UumL5hv5H/Uf2P92//cesX0AP1A66n+jf8D2AP49/u/TQ/Yf4dv2r/aT4C/2OulP42WR
njB4dzW7IluHmoeYH6x9GHrE+hz+kqYpLiUaulSkZTFt00DWazBv1Xr9iVYNi2uoQPuBtXeLo+qF
8dLd0sEc0q3PdAODLO05+lFry60LeOf+j/ugpn260B/+8+iK2dcmIPFAWYi/3tRA9zl/TCO1/e/p
21L9GTbNabTxbFBFJCH5erHG/LxE5jwhr85LkfL3eVTYx0awV50UjeRT8Kw8oEN3qI/pXksWOhfX
44uAdPXqShQEA1kOcD6cRZfnvHQrcZtW385uf0L02DPNO2vrv8kImDS47FyMy3kaolqprr0snfF/
Aw3X7AvOh//04i7PbuDCxdoLkv2ArVlefly2bj+YAoNY8AAA/v9gGOv//pq81EvmX4NfjAdMRhf8
t9bZnhxfnoGh3qsJWcPz2f9j1X/mTVXp+oNVSb9Qr+iwf8yQMfpdkjxr3PRCRQwUCsMTYxeFstZK
xS5aoZ2XLTzi5cOkkri1ujWuKqIk6p1XM6XfmutNyKVm5wgduEbeY1tRh5H/FRHf/oB9O4KAx/+q
lRc5+/6ViibFb7VOv9/5ov3sACl+jT9L76cc1/4S9Uu/mEBuyXDkcdTilDzf+qV4+/7KyGRmvzqf
pNGwpWpO89FH0udfnH4zEmMl41+SAOyme8gVR39guBCINoVJVLZx//9orAx+zYhDAC0BXxJMQ6fC
a8GY5zKYgQHISEW2/drSs3E4MYggum3gRrvVFC8GvmDiI1XQoHuepDXcE2SI8Ot7eUygAm95mjqY
563BTRBjn7r3Nu5ls3wnqRKr+NddoXVih2oXolYGPPE6WrAtDd31FXBRNCVL58qDP1EVL/0oj3EF
IfPgd5Mn7w2zgkXZBr7G/bd7j2ia2nABZfl6d0j/47aiUKv+CUdszywBoRZDGqXlmcDc7cm+jIGr
T2f0oD9q6YfkQ/PepWqx8u3xGIzmN6iee0vXjmVbJ/9cm8gBRr5WoPDhxkMH/ieXpdcobEfrtw6W
p6BbU8p43st4Qijl6gN3G/vqoH7n88j3OaU2ITbz39c+vdayMtx8qKQt0z8ittZG5asU3Wk8FX6N
QW1JJ0ITV/IaxG1lWuZahMQ1f3dEVRY+ICKydQsA5FMs21i9bT5XdNHYxwORyx9ZfXyTZLCYWfNR
TzFAp4tkrW0Osfumc2EJoyOwY14l6+Z7/VYmginB+bNoBFdTd/bJoXMq1Tj2Ul8+0VFe30qCCQTS
aJvoXMan17VT9H8DA6Pfgzhhl6XMROL4muJ3qbCo4b5UBMkd74fAsIrCVFZkf78As7vLg0c3qb35
lUCkeAG2RHxF6TaA49hGuFuFgrvOFKGrsn/6fvB0X/2nQb+Tv/F02PTZpJ9UdSNB4k3NrVZRDoKB
6C7NhNevtUsp/gj/jmUyicJYsgzvH4jFQdWepd1jQvfcR/eSZyRIHcthdFN1RH62f+z0XtJsX5OY
WnBuu8bGrI8suuQo0yzvj37QHFtzH89dMB429p2A3BvRxIi02AW46kmETsVGAlbmhUaidOSu3XXN
/Dg5xd6rTp/UkGP4bWgRIhFtyBWm8STaujnjsjaQuEb73TIFB569BohruA9W84furmkDSWLUa68e
F8DJOukVqqblaK3MAO9+5D7q0uJAnFRD/Eim/RqASh6orbUQEP5t/7B7RXweynCTPvx/mWWP0dU7
7zasuYiadnky1jO3wz4RQeqsFRXT5sTYI3pCURXYE0LHvDuwOVbdfXh6rvOwc1R9N/8VOvY86S37
5xVxVecNL16PFKbGDrPNyruogeTzKe+K83cajt79WVE4xFIc1Ilpb+MN4PHisQ085qmvpx/7rshB
gVh0aF8K2SquA3I/QEuJXDGduxdDWwC+1Jt1KoudsB9cX08y1pUuy2UgG9fyjhrgQyobVxAjxqVB
d/u2YU2dSHJgLB6hfHv//jojCWmoB1JCmbqDmvz/c5nlOD5a1zapI1IafhEe1bMm0uMo/gWbAn83
923qqivyFRhmI5WGpRnvopcqxfUHGoughHdi78xFQ3Ikqyd4Pqr73agduj/ETNmsw0uNQTVDBmx/
p+YojYpyt2TbBsBkjjgqntmzz3OWSPB/jI5RiSBfClddpHlzhSRucnL9IrCxe+6aSr8ovl1aNKjV
PPAB/OHHDtqXR8vOffeHCIlxqrkjscS7uBgK360xcgUj7YHbQVk8g2MUZML98rr+Pp23nVMO/dCH
kdbQ/WBweCIDsvz1Nli5Sbt+/Xwvvv5uhTZPZnr9M4ouO1PXKlQWDyx7zdJi0wYCEHvXywTU01ow
Qw6u7SGEHyaxTuMS/Veueah4xrfyqFQk9w6iGRvewoigmgvIcuNt80nbivKFldXbbi1/P/+Y6BPR
PriIH2e6uv33RsjwRRc6FyMsgZ2qlHB5ZNIjdbwuA1rCK2QrKn8LlX7Di9G5HdQwc0A1HdxvM/p3
jc6aWVUw2KIGks+L4lAGMQVDLUTFhv4r613poa7fQt4srgDzV1yH8JMGl4Rj3/O2Rb+//O6WRBp6
EiRL69pRdf+hh3/yaT63oOf+A1KPGleFtJKspiFt7FVOX4S8N5wKRrEalH//USFu1P7v52qSU88i
u5vWhnrni/L2Bs4QXQgxqynxuJjPNiUCAZm3XOpik4WhJqf463ygCWukd0EXnG2M7OSA/ntyGDif
TXlAv0/3HdJnqw8NmCune1oWDb9rItBY1AJxZW4Rv3dCfGbPV1pfhZRC2jjyTSD0LolEp4i+vlXz
MDX1kGZUApogVX6/O67KhU6lAzy5Ky+XR1nNsLy+yIOaCrpeuZuJf7+VdIT+iv8feiyXsO0eL/DH
rJDVrwQeyXrL+Jg+bIbuMog3OJs8x6+ytFB1RjZlfOepg7SQcqXuD1c69IFoV8gJtWMJ/m3FVATK
63NCbKRMElUfBJDKDQHAZpt5L/MOECFBhoJxPZvlNwLBgmZC6OgBaZzgpD07WndJZeLrx/qAS1f6
l+6+Nv1YGZB1vMC081W+zTvZcAAAAABQSwMEAAAAAAAAIQghArVLFqEaFwAAGhcAACsAAwByZXMv
bWlwbWFwLXh4aGRwaS12NC9pY19sYXVuY2hlcl9yb3VuZC53ZWJwAAAAUklGRhIXAABXRUJQVlA4
WAoAAAAQAAAAjwAAjwAAQUxQSCMIAAABGYVt27YxSHZ3I/ofgfZDFbAlp5OEIxBI2l98hIhIbUe1
bS3ZwV2mFCCA9S9AAQIwl9/1FkBnERMwAZa2bTsmSbrv5/0iUchs27Zt27Zt2/MH5piVtfPMzjbb
Xbbt6sqM+N73uReZERkZ8b25jogJIE53EmwiSDkjSciF1mmEJGWHNCWMyimT+vp7A1J9aHjbVmHU
QJfyQUMCgJ33P+SgfffeabuB/sIM7nFo88a1SxbNnb1gDQAEuHJAQwLskFNOP+6AXdDu1fM++fd/
ZzsQ4FVnFoGpZ1x6zpF9AOAOgmATQRDMAGB42l9/888tQLAKoyGhOOeGyw4EkESSaK8kMQCY9+uf
/Q2RgRUVXNj3ztuPApRoxHjLFQh88cq+SG5VFFw489EbJgPRDJ3qXuCoN75yJuShagISLnrlYiAy
oLNTxOS7370YQqgShojT37oCiIHo+BAicPFzZyCRlVFE7PfB3VAq0J0sonDFY/shhmpgiHz5zQGk
gC4uHLj2FgKsgJBwxtdORAxEd1vEwK2nI1rXmUp88DaiGbqeFnHCZYB1l+EP+3//HMQClWgAzt0f
zi4y/KD1zcEYiKoMEceegsSuMQCVDGKBCiUweALBLjHAVYLIUK0UDukBu8KAWAE/BqJqLWH3qWAX
CFI5iAEVTGG7QajzEMlgwQcmo9MNEAcWvYdgRwlu3rDwja1QBwlmIyz+ps1QxwhuZljBLVuhDhF8
DLCKK+pQR4gFPRjWgJijoE4wSQc2WQMV+FDWAWF4v7eQihzAseFD+Lgx8vuIvcijMHMeOF7B30Xs
Qz7/7mGcQuPUyxCQTRX4ZSrGhdG+iljLBxI+KiLHI/jTiH3I68sM42DlPvfDkFUvXj4oWfuItxF7
8gLf7j2ybaE85WgEZFa47Rwv2iV7DbGWG0R71bxNIZ63vWrIbqHLLlfRHtnzcMsPHM+atyXEk3eD
IcOGi85R0Q7wQaQiR0x4iGqDxT3PBJFl4soDPLRBtyLV8mRp8C7amBiLW5HxG3oix2I6FbBcGY4+
j2Fs1yIVuWLCdeQYWE45D0S2ifMHI1sznQRYvgyHnMXQGnkhUsgXEi4xtMxYOwuZP7WW2BL2GYDl
zHDYobRWgp8ADzmjTzmFoRWFkyDmDMLJ5i3Qw9HI/hGF2MrAbmDeiP13bMW0d5m/nQ9kaEbsD1nm
VBxENoMdADFvEA4yNCf2mgjsyRbc9sIEcPfgzcDdwNwROwdwNEMxgAnglL5mxKQpE4FJU2CjgZP6
JwJ9k4lmPb1g7oieXrRYKzABLHrYxBhsIhCMNhpATASF5kJKE4Hk0GhAjFDuhBjRYlnHBLDRaCYM
D00E6sPQaMC2rROBbZubido0EdgS2QxaBeVOWJvQ3LQcE8DVbmoiLQVzRywXWtSCicD8VlyLhqm8
ifX58mbJl61E7rB2oacmEobn5m/RZrlGg5i+QPZnlSY0d/8YljfDJ+5orpQ+X0/PmXPTx8nVDK7V
XyDzcxYpoblc6V+5+7gOVzPI4z+SKV+y9JfkQisxfj4NOcPc/8ayJSSWf0DW/7HNElqVYvm7hilX
svK3ZZRagRppxkfIF6b/P9WFlhkm991+mlueqN0G0UOM0XqLnZ9BpsVDl4sYU9Hf//RuyXJEn7x7
vSaOhdZbO/wu5MkOWQ9i7Fbr73u8JzE/9LDz2gCOjdZfO+YKWIZs33UIQjtqvX33FIm5odvUVebg
2MDQVzv4UlhuzPZcBkNbyVp/z82TEvPCVKutLdQesOgL21+K3GCnaU60y4r+2sV7uOXEfNetQ8Hb
BVqNtcvgOXFcPM2T2seir3bQSbB8GI4+QkHtA63oq53Z75YL876zayEJ48BQMJwM5UI4MbAUxpWh
1wYPQzYP3Mn6XBofK3qLw3YHc0DselTRWwjjS4aiCEeYWH2UHR5CEcYLoAXYvnBWHR37GoKxE6wg
d0YGdwismRHjB4aahQGo2oSBwopAdABAs8D+qaj4yf0MZkRnkmbsK6qt6GMwEp1KEkQJVhVRgiKJ
zgFJNLYCqiIBX9ZBEh0EgCSHNsFUPTJsGiJJdBRBEPJ1oKpGxLokEETny6XFCZWblrhc6Ep5Ms1Y
Dnp1OLFyBsxHqOMESQmaOQfmVeGGudOdURKIziegkVs//BLBq8ADvvxok0aiSyXJU6T+8Qko7zYX
8dnfxTK5BHUHACkF68GW2kED5mQXSQHLf7/A1UhJErrZzUIIWL7j/r2WwC7xFLDlz39wxBjd0eUi
zdiDcsX2+xXmYBe4CtT/+tPNruGYktR1AM3Matq8auqeNYOTHSVHwLY//XBhYiPG5N59AEHQYIXW
LcCOAzQJ7BAJBiz7xbenORv1sowuVCZBGbXp0y/7t6+RcoDjJIkGbJv2g6/PT94YqjdiclUGMZKy
oDhrzubaYEGjHALbIkE0AMOz//2XWVsTyqFGo4wuVKwACYG+7uM5a8reyaCRcoAtCaBh5Oo5n/53
enRoeGi43ojJVTkY4e5m0pqP/zdj6ZZU9IJo5+Y1S+ZMm7nW5YjD24bqjTK6hCqWy+UpGaFtiz/8
8z8//HzeTjsMTKr1BIOnRmNo8/q1K5YtWVWXBMV6WZb1eiO5hKqW5Mk9RhHyuGnJNNCKvt5R6sPJ
HZIEeNmIsSxTLJNLqHBJ7p5SKsvSAVAYSQDCSLqnGFNMMabo7i6h6iW5p5TKWJaNhpFmBkJwd8nd
U0qekru7ICGLkntKKZZlaRwVgEZ1d7m7JEHIqCC5pxhJEsRIQSMhQRAyLEECAYAABAACIHQ1AFZQ
OCDIDgAAsD8AnQEqkACQAD4xFolCoiEhFuqFpCADBLMAZvzov2b8gOxM5v4j8kfyK+YG1P4X+zfo
r8cufUOd2e/p/uk+cf+k9UvmAfp5/mup75g/6H/i/2Q93n/U+t30AP2T///tT+ql/b/957AH8u/u
/7/+2H/4f9F8Jf7T/sr8Cv68/+nrAOF1/sH0q+W/+I+rvuPfS583+y9eH9B347Ym9bc8/tXfoauP
fL/M+qn+uf6TkT5mH9x/0f3JfJn/wfdj7kvp//1+4R/Nf6n/rvzj7tX7d+xP+rjashfPjdT0sAca
WdrxH8KebDjz7BrW8G2k8TC8y8gQIMUW+aNzgmZdvNZJ0BKwPrYxyqlwT7tRcYGo/naKVFL+3scP
Gvc2QYGN2rntlHIn634gjytsFiF5hGwXTTi7bfc0OyYWT/nsZLPLoQiwM1N5qqdHKhTyHbFRBWEP
CJFCioUdOpK/RQBZnHSKj724WEqYnyma6U32oydw5jlAwoh778jK1ofIN5WcW4NOBPsbNnkE4HWA
fEg7mvKFs0lyEaInB0nVimNDaW5WmzmjqmThGVJrkIobv5QZdo8cNqucLVkJMp0EYH8mxRbD2t/I
IW3qNHT56Y/c9YU7H5SRN1WAOg5Ut6bVvP1l7Mz+/E7X19oZrF7Nb4eiPn7KZgmLtO5shvZCs1r6
oWRv9pVE/vqbnhgA/v+PvBFf6AIGgU7kMZnVqmkXGlF1Ro60vvoDP1jB73EZAAZYhnYYxPzeUPXt
YSCUK3jtFxR4ouP6f8vO2lfV6qaIB9I980n8UENkznhGZe3IZqZKp3ZRBUo0Y12Lrje/De/gSkvT
uTZz6aF1sMO6+JjxvDp432WPVxtm/4i3WeVQHjCx2KNNZyG15leP+jyj+O1++//ciTd+E1mgG4gg
pi4OuW8Jviccp8BuovCbi3/J7+cE6J4T4n41bPr3PHZb3etsvjVtBzc+BlMUPnZlNN0pEJVxNXAR
Wv31WwpX9xHzPlYt9n3y/44Q6DOd/wcH16VXETT+e92O43nP/Jk9Jv54pDN/qlfHb43+bwPLJUSC
vhe3cDHC9Cc11nkHo7SmgbbQJ3K6U3YGQrl1wpBhvFlskiIbFN1X8i5V2XmG4/9VIR/FMVS+34JW
+3ibvEv9syrQmc+X+WJ8gm0oACk/oAmztb/dvKJ6UMXmp3HyP/JUgh1j2yy4JU+HXwdyEXdd13kT
nfqSmJjj3XZAJllujmthhBMqgen7X8J3TWY3EMBJDgpe6XLk9/5e8cfGs+z7otnzCLLXtd8Oz/pc
CRZQPRxuuJaytKzg5vnQTWh1/3Bawh2G/6VQAQUctVBdpz+vhCAI4cf9CqaNlj7vHaPhtcySDT3q
Ty+fFKxefR+6NOqtlLukK0FQYYcOvVjxGJTykpXQq/A0NPi5UFU/GdL4oIwTnWVlMVqxYqAFu6o0
/RBDUqwZJUl0YzlH4QKIWu1JAtkddcS26G9/FFsxJvK8qOnn6wLseiXcFt/SkN7+rDyPjJVhbjKe
bBWVz7hYYRR6kg3ukQpwlGRk9ZfgOwsqSxBaFvoy9w8B0Tf9d5gWJz/R7RH/aIY+MKvWTnxcS9EZ
avkpw5aFj3HB5uI6YOkDW+hEQ/wU8Tga9Sseo5uOH806ZczFGB/7xON0nvw8ML8XcO/x5M4tp3PE
xA3W3Jnwl/kR0NXyzRRh+b5h9qR9iCJLg1Q7SntTxzs4sGNFGleqki3PDA2NNlNcXN0MCwlU5gKN
kMq2aBlWxB9KgpBlPwGolNce9HR3R2JX5rSDF1TZS36087xVNZdUiELTXGVrs9FLlAmpIiWArpiC
3fhsa00K2Tk5ewmTbPjztE+NiM5GpVB871hJYMMF1TgHfqzDMes1x/DMguXmwPnJRF+Cdn1S1a5X
k6Jd/AL/fx8+XYHmM4RsV7Yy3M2Ct/NNshrJQZ53NrnrMJ0oNTqKIZJ4aS1exIHgwhMSKTx9f4k8
cqlud7wMs273cPD2unOnurrBcS0OwNv8GE9rToxOOPGs3hXyEywQuf7kJnINUY/jQ7GkGMN5TjGo
RmW4G0MLRlZlSHhpyocjf4RRJ95eiiwqEzztpwsp9JATpmWmIA08Yvzdn7Pm3hcv/1pN/DsydKzE
+Oef7TRcrju/7lF8Obbdq3Q3/0OWPdkf8iX+flEWl0MdDXnklna5Y7BkRxVtk/b866nleb3FfPkS
kLIUxvYqxYwr67ftejGl4MoXltpEp9JK20N0wPzQzZs1MytFenHW7WUF0v616ilFRdveq+lZ+atX
Yyx+Dd8Dp3dpxubcuLfqNUmklHuYJbpPyPoct5NmN1mHh967WgNmrxNQjb5pbQ6Fq1s/gfI4yIqe
L8SUjxUEM8BtHwC16+swfmwTGwZB6U8RivRTmVUp7pgiOPBLYWixYI4/3R4QY2RPa3laChqej6nw
+9f51s7P5oFYZviLgnM/fv1Ws5FgzYoMS3AmetBCGYCGLmU7OeP5cJFX8fW3cpATkP/TQk8gftI4
RYaytzpxBaCoKMFZ1yYLYnul3xLEdkCtOX3NqN+duuVVESomvdMamToudHzfNI5e9sSA9pgOajfZ
KRLbMW3hGZ5ekxImEjYohYwfg9rKgodxZcSoIjcqT4SksTcELAqpNSyDj8Dul8hZ/zpWfwco7iWJ
hfgr8qut7T2sRPOm34MaEo707m8svt1xrEy790tpBvP438ebrCM3+DM8fR1sO+dZJbeZLcXSlc6J
QUC9m5096I2Hn/tONc1iY3BFvjqn27J7F+bhwV25UQv/t0XsueDONTs5Lpje3AN4ojOLzyU7J1T/
blesxfDUiUeLj4bChZe7mgAUx6WOispLzcxn8ZiTIxjuXSpgr4hfrTcr0BjQm/qIcwrbdkiV2rdQ
f2lovHJ3WXAA1lB4xZu7XiovFnbno08BMae2kMjmgANQZ5SD4dhvXvOcwW3nnC81lE3doaKcPrHH
9/QeOzH6tDO84Gc7SVhSHofgCto5weeYsY7klhNXGtvKskmHpj86cap8PsQLekoMEYm08e2ZMHri
9f4CJlw2t6/vcmRAfAAEe91ItMKWW4HYzu00G3IP+YWHX/bivXkCrqXAs4uYb/2TujzB0GRqlewZ
I6gWL62211gCcBhtq0u+EYt0+tdl+jfKAwYFLjEuZGdHJCMNTupDjbm0I5wNeTmBQMhRJ1ua7Z/D
h4CsKK58ruB8aAovYgHBMwEts+4Er0TcYtKA7SPbYV/6NIx4Q9NHFrR0sS3yphmME7O2hGGRvV9B
KAIegmCreNNRv7U04BlNUf7dvKX8+l6fsplcySvVqr3svkqt9o10Flj71BHkNSfPl/Kov/fqLepe
ADELJC6I1OhFnpHgzJr+GGC65pKmC1akP75Qcx+udAZbGXLaR6dQUGB63fXgBusvM8OJIf5Bi1gW
CXFjdznKwSO77n+HK8C8IgwcKFRBxKEyLcCEzVTHYtic04SfcP+/XtMVyYdKsOCGklrGjfvhJKgz
PN7oTWV++GVK0uUC7/bmBgCKWTY+OvPno3UjfbC/r89kLffPTrT43ZDXnYw2n55BJJQuMJ8+C7vA
VPDQ/xjzmbssbAzocOlODO7IjCnZ9xoUaBMmXort2k6xwdJr46oMywO79GzFV87e0yc50l0HZPoh
JOfMy/GlgraRnl97nDFfpXadwM10ygh5E+enllhypztpIjSqoqEf2qehUMTe0BGlhDmHDvbj/7ma
66ajDjFNwI/e7JuYKqk9d7VgQMho0EQH4aylH+vEj50oAzQLVTlmRErYosrA1DFiOLR+NuvserPW
lCet/DDsmgn0n+wGuYv8YZoguG8QDaDrRYXNfQ/Z/Ik9WtSIFrnAWYCJtDSK0HDKeVn085mJFjzl
2l/p2ST7pkRIjZLc+uN8KWfWFCDUm21gPnMFiMPMjdHxVQYnVFdw0SvmdSY16awtoXWscScrg98n
UMGDayqS2XJbg+RkvRRZWS0EpzjKFPzG1+QQo5ZglLiRT60j6po/W8b1iltb0Ejt0Sx94KIhNTFw
XFp3MZVwjopmnW630b7Li94whP423gW+6YLMAzRRWhAXCw7gGEJmROnYp0inku4S/enGeeXp6KUc
ji8Hazdhz3/ZCLrKiEEFgg48Y3yW6ZiLIFxbdn/6HXfUXUqrUA6eMkAug3hJ9fHMVzvZXCNwmMWK
El9FHGbn4gmubhvA+mOXVBOITqLLbLpuxZBzLB4V1463FjU2ur8mTH/tSh1iOR4N4otKz7vCfaqA
3k2/uxEwUaFzIjjcoOmwa8XiqgQPGy6xS70kLq3HqyFbmXmLqcG0DISwd95mXVOaSSSBQ0xxE2Hl
xlT0gwH5bY+EN1vy3T8dY973MkPHOwiwtD3Wvsul7xJ42xp3yD8fkW0ONqdudYXaagowkTHssgJS
tzpgbSYdynRcVWupZMZWU9VY6CpTUH6lSfGXhtM3/2Ed4G8GUHjgFg9WAM729kZgwZzSz6VWyMb7
e1y6oQ9R9EOAhG3kWnGvkH3bcUt4D3tGXTT+1R8uGNuazIA1TU77ma5+6zszRtzzKTnB70wkxuEK
Q93vmnuvhtwHF4iY9VHZFuQkGzIOxcefTvfJxaWgzuN+UvVInZZtyK5JUUUsdvhVuNADrFZjH727
nnCr2xdkAcISxRllQ0UJeu+GYMnMBThowQf2M0Pdi5jqdx0G+9nAX7c9aoUn7SkEXGQtfg6Y+As7
jiSFr0di3/RjLnm6QXPU2Sa7xnuBDERWKVxZBp1ZIcKI+QlUSWbCwZuou/nniUpfTosh/M94SHAE
uvN73+i/XkNAcJL1OUCB1mRlRwSN35LMVhT6HNbRq5YJILqaggLV7d34gwwk4jxnjXczuB2wLL7J
SlbDoeWgDSeRmqyQsRMYzhRuJcXJ9Y47i/31Hc97yBWEdBn+yQZGawPddf3Xk4uZUv6qGl0DegAm
+Jl4MSdF1a4MgdlAwu7gAfxgL/d0tdtrbcebnvVZ+u32UQBdM2evz9Os1BY/5Jv0fVRcqsxOzs7Y
uBKfXQYMIVWrpDQ5tdEnV1hww6At+jgAAAAAAFBLAwQAAAAAAAAhCCECJKaeCQQPAAAEDwAAJgAC
AHJlcy9taXBtYXAteHh4aGRwaS12NC9pY19sYXVuY2hlci53ZWJwAABSSUZG/A4AAFdFQlBWUDhY
CgAAABAAAAC/AAC/AABBTFBIhwIAAA2gs22bIll536+qj7u7uysQOYQeEbnLH3CHyCFyDd3dPYLI
3d2d7q7vxaFrr64TwUTEBGCwTRrZe5JrqDCodan3AAQmDQGGJgEzJlvv+RcfJyEm5WZqsOu+m6KZ
eo5K7XO3PNwaPa/QYMfT8afsOYRpczbta6c+ipByCjVO2wVIf+h9Cgg7n/7oqSmkfKzBJUBdxSIA
ATXDTpl+XGueC8VTIR+JcmSV7NjZJ4nKJLQ77wyvUJQh2fHP3xNTHmzsVNQjUZihHnbKOb9QWQTf
FahQnBV2mHJnbLOA7Y0Uy4Mp7HdrQo5McQMKde2rP5lnEHwmS2XaqHcsZWCYjFKdVH0Gz4CICSwR
IlgLqDOCEkrVICFD0stFQoYEVCwE1B3FohHV2TYgVTAU1Z0IqlhAZQBQGPh/4P+B/wf+H/j//6Gy
7ET3WCiJJuaArzWpUL5px+TAZJ9oRqF88eNomTqDV+mF1YXy+tSRtSFD6oE9TCwOBTww1Rzdi214
ctTmNhZHG198e0qK6g5SbC4/qnIrDB+OS+eOrI0ZQG312DsH0K0oPOCGMXPriuhekIDzV+7JJrIY
1A7HA88sokh2B8jTsOa0tftX8GIIETc9u7z6JRqVgSRvRqZzvzh0hRUDXrlqzKr4U2UkcoBLzQg8
dP2cXRZOHBvUc/Rvv3r70XfXr8XPFWnIUnJXG4fXDz/64cgI9hw8/TRz4/rhv7SRZsxF7pIPD/j5
o68Tel5xwswRbH8x0ozI1d3lEmyYkew7uepE0nIS5EkSmCCo5whTEEgGI7IV5O6SUIokzYzIWILL
HdIf2GP6AwkzEpkLLjkEEeoxQgRhJJG9AEEChH4nQIIYkoKwDaji+w9sAFZQOCBODAAAEDoAnQEq
wADAAD4xFopDIiEhFVkswCADBKbg7ArGUMJu+Ptb4Z+1/Jf8jvnMt7+z/DHyB3knaGb31I/qvu3+
dX/D9S3+Q9QD9UP87+VXa8/svoh/Vv9ufdz/6XrO9AD+ef2Pre/6P/2/YP/YX1oP+1+4Xw1/2X/Y
f9j1Y//Bewv7LbDGJPPn2uzOGEXG34XBmzR29Q+pV/Z/+B2G/RpMuwhkpyU5JSNR9KBKbZD927Ze
fupn7y5lURjd+BOG1w8wSQkh4dvv6Cel1LB2jQaR8o/73IZbF//4b+gfhGJeqAGZ4fdXucrlTsv/
9xtBwmgAyMzz3Yi2z+RW+yx80nc+LTkzsElmFCMjBegOQbjMN2mSVGX32+N+FzFXh1XstYWpHsLt
XSWvc8TzsJkzEqwkhBZI6OzrwzUTeF8hH+ceRjRL9CZBRDX6ECwdepPYqIXldjPzNgz8p7lZZSfV
IFAc0V2/N4gzUPqWEsb0SmNKyRA1j8mylZTA4I0qCv668zD6Rf38em4pTGH3Gjn/9L2f/Q9xyngS
Xf/XeOp2JanwCgbO3///8gFM4rJcnUaJyVNzpRKUftFPspaav5qXSUUcIaP6dNtvIQkffgshNy2t
t4i85JUyBW0ZkIAA/vDpAAAAE9//1B9fLipbFAJR3/LULlLE5xj1wxRgIbKYCPan+680GBL7wrzn
HTjPff51hfwsdUyV/8dsh2AaSUm/5nF3I//aPc9q3Q8GqadP/xAKlmvEuQaZBLicQKG5JYb/C+a6
89jIA+rdv/AdJGvAVijQqZ+D4DAjVbpRX54sol79GKXo96OyJFvj9h/yI0nERYi7oBA1fr7eTYye
Uoh694a8LQaKr3BKubk7rdZjyGMQJmVOkkfdkH0IAGlY8UPDfzFc13j81uwvlYjxF3AVBPRjPzsv
p1qAi58/2a8IdT1hcBy6cZwnyDb86j6CpU34geioVFGBfR3WNo7EWlBRPSLMpFZ0Bz+2gbj7itlH
30R4JQ6F+x7N/cb2fglZYBDTGuiQsViM+6AntRtc8DhuvAOD9HXNGX6QlDWYLmxWhuT4pr4N63RW
lWm+bLH1pShsyjbpLLKQPLVVwlO4gf5ePt3VQ/8juhTo71qu7mYnWXdf+KTV14CyXo81O8IP8DXv
GovvJ/nw3haWw+2Yu58fEbpDop7K0gTha8B9/TkKsbEw9w5IIyXQfEZc4Nd60vD+ToGu3a+YmD/D
2KmTSa+BiZGH8y5v+bZKz/HTXeQuvUI50iQDRd0eIYatTyp9mdZ5WiQ/lDemru0O5pk/FNhcjOUr
vZs9DwFIlzzYB1pD/n0kdrxqzcRX1CyWZjDg49kbca5IcPrAxUs7xuR5p+s4IDjwZChzHb0QD4cH
fySLosa1F8sk7gcZpS/OOUWSKz7YxxFZIZSo0EM0P8ZzQZQgBJZyLeetlluUr4VBw27eJRj+1//f
8eT//6QZjTBx3vFf4mW6kP5u0aUSN7M4BE+iKZszfYoTKmAx0kwkicd6pxcCIhI84rtDgsb5xWZp
tGMKfNYcBKlp4ucNVvi4rcBTY9Cuho4afTStZXGuyW+HBQOJUR1obm1hsuIHfbqfvALgfkMT2SZj
SBC2IAky1N8zhbrXTsmLfDcOpl/YnFw8oSNo35JCu/COeFCwgV5kZW8MGd8gfiq8EjfTtuULQhx7
5gkPAKk/cBibNJ5zY9x+veEpIvlDcEbtR6TJgZGdTeNXCj6VEs5Qu2LLhj+v5DkLKCae2idV3uPR
/5WKWRvdsZYUeIBJTtTB4mr1Cd7I2iVzZY3gNKeeGpi6pyicaGmr+fO7c8z4JjvdVF3N7FiqV6Mt
I2OgfEsFTJuzITXg/lgLJf0KVdA2aBBW5u3hr8ToZ/LiOjKP8TP28uq0l+FUPZN/L3jLJpU1g/I4
OduUG4qvd09IIu92yj59So0z18dO5ziYgqmjzVsrEyFb2qBPXtNLzeHUV5KIn+YN/fAvclPZ359k
VRJh1Nra8zGqyQnkOzn3+xrUiFo0J60DlhxL0Gv0O71oOpTfqnYlGz7Z4GAh5Bo5uH/tuaA2dztx
nKRgYXNGQuwqzcaoHROv6E5IrI9dS8ccnwd9Uf6kl3IgjBRgeAA4Vn4amlTylwtsFdL+xf/Ny3PH
oKemxQmIpOrJW95GXwOdOsS/LUmbxwS0kwnLwak6RNDB5YNHylWHTSbPaXw0H5dd/LRL2LMBf3af
mZo1aP1AeuotNoB0xgPFE/sqW9pOXh68uMXyIiedYZ9lrOjAN7R/QC9oS4x9jDJPahNCUnutbphg
nw7ltzQeJP1FUiEnI7DVpl062f8fKQthO/gQZ7Cbbua0EUMAAUy3vYxSOCagoyiNE7h3Cf+mP5Sx
POQp5D2SuTitEx0y8w9zxdeCbW+vGU7M2ATGUSMugEHUYMNaViFHrbJOq6NNew1qbZf4wAtJetvZ
+nBdU/eYemHg+2+Z6hXfLcahYD1S8UU6A6XybE4a/6Z/WPixiWeHC84QZ6ek17JOqnOZnZRyRcIF
54R9DDWManKjR11KXjAc98t+ULecgmqw/0TzB+PemxnoZ/W6dQbqh+U/DxNiyvE6t+NuoK5WHjV7
/RiI6sY9UVpaMRSKedgn2pdb/uLY7kPhiODO5+KFSMbJzcx94iyg0SZq7xFWJKA7iqEazvPl0itw
B/tWAU9kYbgsl1zd07fSGSZA1zD0cMubGy9+eSHycKjvQr3o7ZuS3P827pg6D0922aYAy6X2BpG4
xg4G2+vSjrwnmPWGjzPcPP4Dg37OekrR7nP0lECVhr0ZeShiQsw8/WioH7u6ErJEhDT0WIfy8QRj
wXryB5khN6N/wXTh4klWBzv8c7SvalbOKKp2SPbsXyE5KinEeQRZKaycLLEsphM+YdO/vT9NBgG6
XVk6OfxNhKJeT61yvwj2PcFWcYAFjQrwFZ06t2o3V37GvJng7177yYRXG9OXYYUsTf4yDWq9bdv+
IDIbAFqqmr14hx9x0kX1CmtOEglln6UTpvSmXm35Dg7npsSgnoQjPtBrqZMmsyqP/BKEemyK/i/3
56UvEyKLY8xF3h0d5ZrOAAD/emUokQE5w9+Sfhjbk5PxfydYrcA9MZx0ezY4wR2Gjykg/O+82Ato
rj1fif7Kf2ISwSpy7EVW9Uy5KojueGzETUjv1um/NLyGbfAKGLF5GwNO8d4mAqBiL1xQ0Cy+6hOg
bBNMp7v7kggW8S7jv9u+ZVlHAHchFseVkxbO0qsnj924nE4JLkcIdFi3WQ+j9CBMrKnGzbe3xfbs
3G1M6335f8Gh+Cbd90qOV+ZU1iuptkQIEmNVulAvSlOnPBTEecI7S+iNnk9wgVEC/jzHU5lpXcuJ
hDMI/itywJ/dxdyhJiH5m7k95L7MXj3ioj1+DndIMwhZAud3fdfLx1pM1IZv3VaYTOODnMpTV+6h
L/PM1WkgwYdLNnH/xc+8kpg3O8EZYEe5x645gv2uIH97onZ/T15/rL/E4r/47f33PRcuHTsHBaiV
pPin2DLD1gK6o/dPmZjRzgxI3WmH5jUcKficXqz/f0Hv9/O+D7Z0BkQkqRGUmnavfKqpXqDDh363
kya2KaP8JEDCWQQlcOLadrd2vtw0Y9VCJbkAIV3JZ7ZjiIYRqv+z/0tzakmm5HPIKc/l6RqyMdDW
kv6v9CYitFuNQEcKFF1WB0+rV1s4iO+cp4GTgs6WqtS/PbCzGe2XG9j/rhL1RqXX5Zv4drjCoILU
6EkIr+q5EDPoILbyNbQwstXiaWYspRqeu8eLDLF8AeNwl+Z//K5wgEOMkASuT+bSzF/bIQPHdXmk
9nhn/eJzVgtyUiKtEcNgkgIR7+HP7zLJPV3pWN/t2xw4vBH8z/9554mBddvTmdcmw8WGWDh8QYRZ
CuObCf6UvKO6i3dVRjq7UwFo82e/zx1myzjaLCi2Nz/9BuiUgbZ0RwEbmycagKgeXSw4MZXNhJmB
fp3AacozXvhXuy5vIMQYNvvw++tnhEho/jdB1TetpcTjViRPrBetxYNh3GsxZSda2mbnYlYRrqri
W+iuDGkIa9k3jP9NZwqww7jtelfyL+WXH8rvc1mhByc7ORLfpcLS/pk6j/URVqMMjfvsdE2eNENE
dpsJCSCAOOaKExh3JFBEvNNTnuPyw2MejQ/DO2FGiJqPD+0l940zOOjpjLi7g7M2kuOmmWmRgAAA
AAAAAAAAAAAAUEsDBAAAAAAAACEIIQLLa/31Yh4AAGIeAAAsAAIAcmVzL21pcG1hcC14eHhoZHBp
LXY0L2ljX2xhdW5jaGVyX3JvdW5kLndlYnAAAFJJRkZaHgAAV0VCUFZQOFgKAAAAEAAAAL8AAL8A
AEFMUEhmCwAAARmFbds2kO2k8/+H2yMi+h8YEn/XgKQ3A16jweYIBJL2B18hIlKrB0mSJEVORvWu
mJmZmRlvLP3/L1LXSdVtNlcdIiZgAjxh27a8bbZt236clwION0mZmXszMzOMHubh8wyZhvw8o2d5
ZszMzE+Zmbl10obRIUe6zmMf2HVsWTrHETEBKv8TSkJLMrbbSAvTyXKGwgvbRRJOFh9s3LBu/fp1
ZcCozp85M3/q5IjFQ9huj5B6Fm644OpLrrjiwm1bN29YV4qEXev8qbljR/fNzr79+v5TLOzsbIkI
V2DdVTfdfuPNF+wIlj8P7X/+xadeeHMeKMpsg5AT4vr3ffjdN25joe1FtAQvIomFR1984oFHX04I
OadeocLMuz/7ydt3AFRLQiy3sa0CcOjpu/73idNQylRTl5XB+77yhTvWAtUhMY52qgBnn/qvf3t0
VLPTtIrozdXf+PYH10JaEuNsWwFnH/r7q3EfMY2KKvrML/zM+VAdwWrMVIGf+YXPiKoybUKVme/5
+R88H9cIVm9m4fwf/PnvmaEqpkmoZ/MP/PinoWaI1e2s8Okf/8Et9Ippoahs+J4fuwP3UcSqV4ne
3PGj372BGpoKUdE3f+RmXIuYkCrV3Pwj3xA1Jp9kPv4D78VZxARVSfPeH/w4liZc6bn4Oz4FtYgJ
q1LhU99xMX2ZZAI++5U19IWJXHrWfOWzgCZW9FzxtSupISa0onLl166gjwkl+PDHwcEED8PHPwya
RDJbPnkRfWHCl56LPrUFa+JE5eaPAGLiC/jQLdSYMILbrqYvTMXoueY20GQhbtgIYkoGbLyhMFm3
XgNiigqu2TZRzruUKqaqKpdunxSCLedhMWVlztsCmgRm60Yspq7Mhm14ApgNM0ztmQ141UmloGkl
SietLoueKV+RVxOcnH4nWd3HTzH1Tx1fTZ47iaedOXXMq8UcPkoTHjuMV4U5tgu1gNh9BK8Cw2uE
W8DBm4nHzh0vEKYJHbxE53GDZ49jGtHMPc242y+9hmlG8+bzeKxSJx6mMR8/So6RO/6fLlsiO+6i
8/gk9+8macpkz92MT3rP3TTo/bOuY+LO/0zn1nDHv2XnMeHOl6k0Z+W1/2E8axz8V0SDiv95O/px
kP/yVMkWyXL6Lx1jUHnkf0maNLn3HvoVc/BHdG4Td/xZhlfM//YAlUatPPZ3Xqnszv4OnVvFHX98
apArU/1XT5A0a/LcH7muSHanf4vidnHhd453dSWq/+xBKg1beeJ3nSuQZfgbdG4Zd/zmqVKXr/of
/5VK01b+78+8fO7yl4ddtk12o1/rB16ukR78bUzjmj//Hw2XS/7VXaW2Ti17ftGxXOhLEK1jZMY3
uErRd9+kH7QOfsibDpmp5Ns2EjSvkTMXkNRxfI7sGijr8wJZlahrPoPVPuLkWQ9nqviWNYgGhuw6
g6SG+BiOJnJ9nkAqxmjwCbI0USa32n6ZCr5kB828bQ2SMvFuUBtBpl0CipTlPWTXRiaTUyZDSdTy
Hqw2EieHOrikRFwyQ0MvWQWUXZ1EKxmZtK1I1q1kaSVkZh8cCrLcgNVK4mSDKYHBVTT1sh5SGN6y
pa1mjEMSE5eeRO0EGbACCCnyUtqq1wIkiIAuwtFQTmZB4o5LsNpJnMxAFsvuwtaaYmKR2o5oaMiw
RExExEYae0AXhNCMWqvbAEhQyg00Vx8x+Au0trk6dQMkKAbN1dYJEu/UXC0SFkFrmxYg5NJcSSIR
AW4tA3onLNfWqpZZoqjZWu7RUmA0bK1hz5LN6GxrjYZ4KTA/31pnz7BkM3+6tc6cxktJTp9srjly
KdhzrXViaC/BDg601hGH/U4g722tgxZLtbwPtZTY6/BSSO9FbifLe50s2X5rjpbi5G57SU7vO0xT
z806vQSTnpvF7WT2HnHidwIrX6OpZ88qWbLxS4RbycGrxkuyM18aqp00eiFtLwWcb75FQ+9/Jc3S
XfPwK7iVzK63s/ocMvJJwm3k4LlhnIOx8+leraT6VGK8FHDN53fRzHufzGqWbvd5+Kl2eumtHNlL
w6n6AOEWcvDoKNKcU5+PHKSNOHp/9udk3Nc3n2ylF5+rI+OlYVfqnYTbx8H9Q6rNuTprvf+AWkhH
7qyZ5lxt9/3sQzTx0y/0ve1zwdmr/jeRrZPB/41ilOacJQWHrsZqG5mrDjgknRuIrt+yo322Xni2
QyyvCkdukNvGumqOTiyrBJrbvq6qZVTXXngIkJYDUNHJ64KmjStH6sRyS7BvR6TaRakLdiNpmQR0
OnVl0LBxSc/AoOUBhHdvJ9UqSna+kRLLLsFAJy6NdokLRgxAWq6Fzt0zSrWJUpteS7PSRQcvCRo1
zj9Gx4qbvSpWi8hl3S4MaCUE4dd3yC1ibdvlAmIlBWSZO7OBJp0ZHS4JaCXANn52rapaQ1Xrn0nZ
ZmUFZMldO4LmjK17+5KAVgYw6T0nitUYLvNvkphxtOXHB8qmkLXmMctmTLLU1zZHUxAbZ0clx8Tg
nj37OreEu8O76A0eB2GbfPKsrFaQ1T+aso3GAbAz8tEIt4JDj6fSZmztrDr53JpohRi8elx1zJw9
u18eyC1gda+9Tp8eJ3A685lZGnHP42mnGWc7s+L7D8rTzzpyj6mZ9jgJO3vl3UdlTTdZc3en+rTR
OIHt7BnefZKpf+ruefVpm3F3ZvY6ddd6PM3Murvm6DPTjJ+z1pGODgpTPdYejlGtacZfZNY6gg40
rYQChllzVYBdax1BVvA0MtTEo75Wm9VpgG6tNn96O9L0EWfOKgAgzbXNYLCWwScuwpoyFidPIkmk
SRi6rhuIj16ljKliMXcCgyANd+m6MsC334ZjmsD+M7YBQcOI0pVujXTFewaWpoRhfndiFmm8opSu
dBGb371F1lRwcGgWcmKgKF0pA4Z3XK6UJp4tdr/skl44CZCiRFdKx5lLbxmAJpzF6Wf3OattmAxI
ESW60il80/mq0gRzBrOPGNuJmZiSIkopXeHwpdcPwppY7ph/4hkrM52eIEhSRCka4NFVF2FrIiXw
0j1nrdECM1ElFFGilODAtis3KtHESQf773vc9FkzPWkASREl1MHh7ZevCVsTJSmceui/R2ZUF8Ge
OCikiIjOJ07suKQo0cRIB6PH/nWXo6+11rTNBJaQQhEUef/89gsjEk2EdKF/4h8fTeqo1j4zzcTW
oqEidp/YdEEXmFhlmSrMP/iXd9ke1b6vNW17UkkskFAxuw4MdsyIRFo1NiGO/M8f3ZkZo1Hf9zUz
meQC0EJUrH1vjDZeF1AlrQLbBerLf/d7jzk1HPV9X2tNe6KBBCCQFeL48x/99B0XAQnSGNkQwN6n
7vyDWcNo2I9GfV/TMOkWCkCAI1K6+EMfvukigLSkMbCtANj7wkMPvuVUDoej0WjU17RtpqBY1GAy
iiUufc/7r794BiAtkJbJBisATu95+bHH3rKtfn40HA1HfV8zzbTUAsCGrhuEJTbfeOuNV1ywiUXt
ZZFY9MT+2ZeeffE4trIfjYbD4ajva6aZHqB3MF3Xla4rtqRNV1597SUXbp9Zz3KfOX1439uvvvHG
ybSlOqq174fD4aivmcZMVy3AlK7rSldiUJRCxPptl124/fytmzasXVO6Ilz7Opw/PXfs4JG9bx09
nRiH6yhrX/u+H436PtOY6SvALqWUrpSuROkiBCBAirUza9ZEkDkcnj6bNmAAZ/Y1a19rX2vt+0xj
prZDEWXxKLGw0FFlzlUu9NRcWLMunum0baa6JEVEiQUlIhSSFAoggATSadvpzKwLsmamF2XqCy2M
UNFiocVBgMGL52KuzvRCTCMKoYWhUEixCAJhMIuknU6nF2JMUwqE0KJIQkIsNDa28aIYg2lSgUAI
gVgCBmMMBtO2YqFYVIBZ1Cw0ExdWUDggzhIAAJBTAJ0BKsAAwAA+MRaIQqIhIRc6XZwgAwSyNx17
SICF5ob/TfiT3I3W/J/3T9p/yQ+da3P3T8G/kP+M2OP5Jl59EX577cPol6F/MA/Uv/Zf1X/D/r13
Nv2d9Qv7Bf8H/k+7x/uP2j96f+J+wD5AP5R/Wf//7W//L9oH+4+oP/PP8X/7fXM/bv4TP2r/an4G
/5x/av+3+f/cAdPf1l/sP4s/rv5cf6HpZ/ZXt9nLvud+i/q3ts7NeAF693q0AX5d/dO/o1TfCPmk
f7b147+2Zx/UP9H9w3yu/UPoY+nf/D7hP8y/rf+5/wH70f5H5s/YL6IH6qpLIrZm2QKIeACkLoe9
llsRXQryUjpVgQCI2Q7WaKZDwnbYkRrxaAXME7YyIO5rT+CD/j0fMaBpWB1HAdTKqQ/V+s85+o4A
5DzKyjt4pEzy3/3G+SgC+ZsMliwPEZEJt10l3MRIjCDoGuMxCiAfSJiYY4abUysMD6BiMT2V8dnW
ekVzisguuvG2mj84U2+dZahVbSovw7NzP//Tr90IB0Dw16n217YDkjthYkjzvqMJ8atwlslsl1wu
7cQeet9c9SwZcSecouvV/XzljvURNBKzhyya7jDpHZlbQFV5VQPY2MoDXkzhRKP3eUAR2Xr3MchK
yZWeDJWe/naZLmcWgcHlNeI+mWXDOfzeVoVwN0Dro5QRLlBhcEoSnTlHYQHaBmYGgN51LTvsB6p+
wm8Obv1M3Sy/qhxd+YlU0wYH58VnN8BxppHeDBLOMa2yflLMB0aUe+bzvgfTMauZq0towRoSzeJ5
f9ict/9xugvJe28BcVMmBpvhej4GIDrT66xih8cmsfx7WiOSLPmSaaSV9gHO9wqxnn7dVxpofufJ
zeSi8idIr9sfzbBucD+zROeomJEgAP7/DWQSP5SbJXPddRAhY+RnSOCLXBsomN5zMNXz1LXWuB/n
gHRlTdDTe+A1aPi25CX0IcwJWnThQhINPgzBTd+E1s7Bga/BFjTNv3EOZr+/WAYnTCwwW8BLHWpU
ZgAmwhjm8egZ7d+FexKJMgF+KdIgYKXndWVedaWdisyxftowena/LMu3F7rqqGgOERdJYyq+KAhh
XmIXDnb4YoERr+7JNLqGtObVfNhW0mlzvivbPiFol4HY8qHAkZzhaeLvhN11G5xt9EPdMkkP8Nsf
DSgBJMWqM2ETuCa67lrVwTkGp3PErPOrRxiBxyWSK5v5Kg7rkpxjzq4zRldi6FWK2rhaGopL7DIL
iGt5EBoi45mgYA4f/+a18S1y7qNGRLi05LpqgStfFOkQvt+YXBw28PECoDHwcTLjFh2NCtp4fV/v
p0wVRpSVsXk8dPmCjnSv4DVo+Bkr5NU8YZQVwekI/xGasSIASf5KT8N3y4NY2GBn9538tO/KjoFZ
9+AfsLzFSFkDA+7pg6YQmliSVm5mHyWl8K0sl0KXFuMR2aj387aDDB8vzwxbZ6k+SYvKh3FOD73c
rbOZEF+2+0/9CINOuYChaHI1gmuZUOFvTshSENKN6wu4yBqghbyl3cKAX3BgBpFDHOPmoNeclPEv
dvyNAKxamulHBg2/4GbqCol+N6cEHi+2n7nXIv1s/4iZt9fLHMNRKv4LOqccj6LvhcUPC2nEOhfC
upd9vld2f92RomDOjv/1Eupq0CODEqN1s3fOIuU7cjwokv0PoXTR//tXbF+0wiFcUjUjOqWRgQCf
k1giNPh+GAjfUiS6ng2P8qaHS6YHzNQ0cSlaxzKVjlGcnu3a+ckKT0DG2/1NsWXacJhNoo29yvGu
LnYY2e6osn5V0aV/71jiY2RpiOWouQ/2aCDFVY96qBxHHmkn6mTywZNgC/tKzbLr+Dzljh/Tv+si
kzc/kUP45QUwQ3u48afQ8xbCF/9rmYk7NJ+vcxr+Hd4V9HEQ0EKq78lRW8WNxQpnKXLGJjw3dAhW
mVcbe58PWoYcIY3lErPvMip0uzJw8oA3t2EeouZxTe60h6JJy8srUJxKxA16A95PD0ZSveLQ42xM
hYOwKt/QltKuKmL4BWbUk/GNVwP3rhdYUb5s4p85Y8CiqC972wANB0JcQQZ854z+TKEUw8nz3HQ1
OUaMPGfBlkMy3Kh24XUjx5jCJNGerJ0kses8FeA88NX9Um/LwqN8m9xyVc2mdncKo57ldl41qpK9
+sogdJ6t+c460kaxJ1I3Xvg2fgqdBL/gn91HkGSl/LHtWAl3vpVlDz6G9xIIPoXzgkG7abwYipNM
RJ3z7AViRkd4jdTRluVLgr99GR8C/zKc2wspQpa/HZyb6FGqTAgip8NVMF/murL+R1+oiY2jjrIP
w0pqcQFIK+zk8wTF27rKuDCn3Fx9rSWl9zs6B7YsGaWFgFkdLXkhOPHoW8V380vmEps31UP+JRJI
Q5qvDB7/ruOQOyPT/MUyiN3h2Uxp60DtcPoJGBV5TZ+EY4/7p8e40Xw0lB1nLpIxOdVi4sgvbVu/
iGg7y/8qbzKdgMLEujdv2yn1oJ6iQgN7YleLyHx3E02ruaBUyXtSlBOcd961JLTgcPW7r/7/pttj
TVkLOxCzmbM1teO9Zowr/fr11YXbAOX8j2o0n9OiUvOkdlPX8aKWGCf+h4R54PagIhPQJ2DJoD8i
JDp3FHIpXq3nHh2rfFdQzjhSMjc2o2mdht+jtmXMd/EFsIUo5gVWi6pfoHGCP8XK8eB8ZEvkG6p+
JLR8dhN9ksRQ+Lg4iA4e7ujALlDLFtZyz2W2szfP67ptJTrMyJBLgYeaqM9j6QuaX5Z5B9PZkzTF
sJDkVhht60xjTT81sbb//0rZ7OsjEuMivSOAD7sehPUan+nPZe+Y/Um0R/a3zPpLGTdrm8l1Up3y
6uYLrObzISh4QgFqRqaBZEjAUjN8/oJHuLNIWSqb7mAW5QaWH1Unp+pCth9w42lIV6wHtz8zFL9r
ERFOQGX/xF8wup4w1c+by6s2GpJvJHlB2SQKoL+ajAC9w8eLkPW0s5C/ZY9XmvVUG3od6e1GgF8w
CW4nCTx7trdr7kwLjmMnyR1mp/qIBtK9Lores2GrSuIvKwq0BuEEKiB70+y37638/SayAlBi/+2V
+f7eeLmC6bfsqU7K2LChiOyOZ5gn4ESjBrSAeKDHP8JfnLP4tNSweJ10DfMMRcU0hxEUGJlDerdn
qpVgIXYx9JpLfzC2SSUT8BfLAibY3iaRMqKcSdxYPShghryq5Xthta+vE/LuVXj/oD9qUPjUKBNP
nvcWWcDgFN2ESlTl+QAz1c77nXMEwMtKkExtjKYYT1D1xwW85OfcnsfrVAb7zzh9Y8hDE8D009Id
CoMlEk5mywk2nStLkrO2TJOj2TusnnGYU/u99epybKtujjjhTKSp/zE0BvLF/yweZRAxeVFkvD//
/+YpXAoy6Lm4RtN49bD5dkoluBVaqXO6K7BtViCpEB9ei5C3WH2n7HAbE3DUp7+/8ZLlVLt/0MGR
HvClRastw7PpuV3LpK3xn7XlyxhBrayW858wWmt22LHupQ3JtLs8RJl78t6ZOpGA9UjsmZwCf8e9
s8ZvE0/YK0gX23G2ZiJX41LC3wGTcezX26qJfp1ULBnSIRkFB0OEAVY2AafTCWKgcX5pYE2ZZL1V
B7iSRSGzUS/gUHOnwIw1ql/+sPXdPnXcMjdQDXWnyPbjAAdB78eSKhDrpNt1FTIf4gNeUMO5aws5
KYk98Sl2PEEAHDTrOxRwtO/syOB+GawBjsNqMJeXQgvmzbk2JiwL8dwmWL8JxEnRIXmgurmSfm60
e0tduVbcXgFURBisEWx1rhvlxnXD6c1ajvs+N57uyES4B694tKrAPKeFS1UCC5IgAKNQpv9R9pNP
8j6AqC33FK4EEtcOtOWpbJRqqdoPgP5KV2GJ1sNp24sbf09K5TecPv3Xmv3At9El/53arMH5eqpu
SdVfx41TSN9Jor4e5GiCcy0h0Ri9YUe647z3N2JN0UxAI3rBWXCM1FWfkbn1YO6CWlIcp4xL6bfZ
+TfqF0eOEiEGP4p5DFtRR3/lfgT7eG8TN1P2FtdygU+QSuUnsizrRmjlUVBuXUjseQR+l/VHhvw3
DwBoLQawn3yj1/CXJNWRrF/QQMvgkOASEw5rekJxdmX0vsGa6cEqgByRPTcUxu76/2uf8DoSOxrp
GmDOxK8BCEzHfwc/nUH+iVS7reaEt7UaVj2qoEHBj+XEAL0RCjckYexSHlNffWOqfe24bA14C9uL
HRJdddyWk/uJNnF6OdT3+Ywkui99DMv2Ogj4QR5CImTwRZAmtgzuzv+krdLUfL90wHuc9a8V5l4R
+t5Ptq2spHawjDI32LMcvRNNaZ5XKwiyfa8l9SW7cb8N0NVP5YwnlCTpNcYOAW8EkkCjCLSA7d58
svNbzYKsi1dm0lvisH396cLJvxz3eFfG3e514t8silbNK/lDtka+9WvQhkSzDweasYdKp1IVjqSN
je7P36PjNIz56+YZ/AxVyPQ9EHIbx0RMLrfNSYI/C3x73kcQSUHt/uRDMbYGC7s5NrJvVGwSI6a4
kQLSGLvWsnlJtVa9OmRK8R/go9+d16kVIo+2/NQspt0qkUYuVPxCksAEPbF7fMqImul7n7QsPkf5
jkHJE+Vj2bEUkuklDV95QgRg88988a/tOl8rY3wMlCLA48+1FPDjCvTtyy4cN/OC/CdzyBttvOUl
0qSuIObQUPE8L7iO0H1Cx/Lq3cFjaomPhFwH7YO1FzLkG3ai3ZRkRg92vQUvIACN23iHlPX7jnT2
Oerk7Ipcul2IIieIRkaic0wjRj2HRiYqoWi3zAufIcsUhbOylbkii+o911fV7FxfAXvC2xJe0LVv
8az5wvkYkU6lMKu/vLVDtEqcu1I2k1NWHGG7Rc6pmAyu6/xQ8i4EN8+QYRkPKMzIKS0wQvl/kqI6
0uGCU3VOh9NG1s0jj1wvCXjO15JXPV2JflHO0Cr/vDQHTSZX5ATsUPU4mm2ic8bi8/xxneQKTRRO
dBXmxy+xY4NZMsxNnxqIID6DVcLn40wPhWearAuzCrri2mDHw+2VBxx3sKQFAnpEc4fDc2mqhcW9
xbqfXxJQvI+q/FolofY1nslFx/I3LGhcOGFXaMJ9VpilUa5VqoqjmmZjwZ7CygCYIoSATqniitMP
8M2S6vhDV0M01b2c1D8ZlL2x1Y2U2mp73uS2T8irqkv2zg0kKRcboq1CIiTy4oMD/JQdPhK+t9ys
aRXZiGTwydHkzYFHygRULat/5h0WyZjGEpJNEl7Q9XJgLNc3NFzwqoCWGkjH1m0dwRnAnwx+sQU9
+T0o4Rw0jAYMUTlT3VpQv8TF1CytJWbnK+xufltuUyyYdQMCCf+Bv7nwRTm9lP7652+/Hy59ghGu
Ql96eMSkdEdM8ybg/YmrRW1fbSbI5bVUIb38MP7Nk2XEoNxs67EVqVcE/x/P3jN5nNNXl9Ou93Lb
uDRxiPAZE5s6zdIgGvPZ2OigF+rvm3OuFw9991jSeNc72FdhFAFQ3khIPfQgvtMYU37OZTMVdmjf
f5nA7HG1dvbDYSiWnqIZeXvUfMS01hSkC1+jI/QXGhTVh9j5acTUT5aw+GbOlWQgkzNHQn2QzRoz
EGn8rPz73n8jp9OYCqbQ5K01ki9K1fezE6sKLKQgPakGwTnOJ9Xs3Xg9vxsDrg7ZHj8zzn96j2/N
gIwCRePhAcoKDjaveknRr7wBGH8mMSTbA2sM4CpOToiw6OgAANCVOC2Ff4Z65g+vXlS3sr+Js5+G
0GHNehzpPrkpG3+3uJdAvjqhwsxnb8y/o3Nk1sQ4K9O1991dd9M5Shk5RgfnYPOHucxYLJ81ZZUA
zoLr1fxvWqh/CowOF0RNHNHXSZma7EmXINVcOowdgs98HH1ZmUwHJC7DrGqoYm65EZdWMBeGtTG+
nemNNO8MAN20B7UxGqrlTV24E6j0Z7FJG7h5NliwY7/QeOCaF3ZuRsXg+7Vt5rIfTEkFRtiJ8Rwh
jYtyWyUnEM2O9rBBkNZZ1c1b7/8VYnEh9xWOf1FaPx4L8LFVhS4rYWqAxqleJzeukrMLqCo9C17u
mI4BmNr6v9n4RYMK/yFAJrHsanYXpJYLpVGXoVXydtNDr1dD1dcaUrFa1pAAAACKsFjBPXFnzJQ8
BRoFukrN7u0iaSdmtf7Bfn+Cut7Ju8N1uNoNlF0f2qj3OoUyiQzD66V5+K/TVpvLFlowq1KFHw6A
u0/j9I+uLK4VboUuf48StPGztf96Q6T9HXSZQsqnsIFMCffUE5o/W0xnQlYG3fbOJFh+TxHPg7hu
ie8Zs7m+1bB0wrOeFoWgEiMX1u0m5KjY9SHKIceph5ZjgO1pHIThBn76qVBsISX/Ut/Bsrb5tWQD
O73y8suBPyU3ENFc+mnRBeB919hLQEQ5c3lDQ+e/7DD2tAw8o5tUUH3DKCS7L+bQAAAAAAAAUEsD
BAAAAAAIACEIIQK1v91e8QAAACQCAAAlAAAAcmVzL21pcG1hcC1hbnlkcGktdjI2L2ljX2xhdW5j
aGVyLnhtbJVQQU7DMBCcxQ2xWipx4FAJjuVSiVrihLjwE5DrGBK1iSMnhSN8g3/wP1hLjmpFqlAn
Gm12vDv2roDE8gwg3OAHQI4IAh5wwIx5zbxl3jOfmDumlIXXH3qzs5jPdaHbvnq3d5VxDfJcN4V3
VYHpdKPN9s27fROSV+dtTFarsu/bR6U6U9pad+vYsjauVrrdKm87dbCpXeNM6V1tw5u+SOKC4zcR
gS6x4H8eBb+MELOQs75M9AAeDVf8DQg1YVaR1IhYQ7EmizGcSd7OM/JPEe8c9w1+k0Sf/OP3kviN
+wa/LNHPT/Ab94nRroad0JEd/gFQSwMEAAAAAAgAIQghArW/3V7xAAAAJAIAACsAAAByZXMvbWlw
bWFwLWFueWRwaS12MjYvaWNfbGF1bmNoZXJfcm91bmQueG1slVBBTsMwEJzFDbFaKnHgUAmO5VKJ
WuKEuPATkOsYErWJIyeFI3yDf/A/WEuOakWqUCcabXa8O/augMTyDCDc4AdAjggCHnDAjHnNvGXe
M5+YO6aUhdcferOzmM91odu+erd3lXEN8lw3hXdVgel0o832zbt9E5JX521MVquy79tHpTpT2lp3
69iyNq5Wut0qbzt1sKld40zpXW3Dm75I4oLjNxGBLrHgfx4Fv4wQs5Czvkz0AB4NV/wNCDVhVpHU
iFhDsSaLMZxJ3s4z8k8R7xz3DX6TRJ/84/eS+I37Br8s0c9P8Bv3idGuhp3QkR3+AVBLAwQAAAAA
CAAhCCECs1izTEwAAACEAAAAGAAAAHJlcy94bWwvYmFja3VwX3J1bGVzLnhtbGNm4GBoYWBgYGSQ
YbAA01AAZCgwIICwcFppTo5uUmJydmmBbnJ+XklqXglQvIGRA2gCAwMTowCDCpAGsf9DAUifCBDC
ADNQjQQWNQBQSwMEAAAAAAgAIQghAvaL7U5vAAAA1AAAACEAAAByZXMveG1sL2RhdGFfZXh0cmFj
dGlvbl9ydWxlcy54bWxjZuBguMLAwMDIIMPgA6SZGKCAkYFBhQEB+IGYhyc5J780RTcpMTm7tIBB
VDQlsSRRN7WipCgxuSQzP0+3qDQntZiBoYGRA2gq0CxGAbAZbED8HwqAxjKIACEMwNSwI6lhQFPD
DFQjgUUNTBzdfABQSwMEAAAAAAAAIQghAhofzAQEUwkABFMJAA4AAAByZXNvdXJjZXMuYXJzYwIA
DAAEUwkAAQAAAAEAHACkmAQAjB0AAAAAAAAAAQAATHYAAAAAAAAAAAAADwAAACAAAAAzAAAAZgAA
AIEAAACdAAAAyQAAAOgAAAAGAQAANQEAAFgBAAB4AQAAnAEAAL0BAADeAQAA/gEAAEACAACCAgAA
vQIAAAEDAABGAwAAgwMAALwDAAD2AwAANQQAAG0EAACmBAAA5AQAAAwFAAAzBQAAWgUAAIAFAACn
BQAAzQUAAAoGAAA8BgAAbQYAAJgGAAC9BgAA4wYAAAsHAAAwBwAAWgcAAJsHAADdBwAADwgAAEII
AAB+CAAAuwgAAOoIAAAaCQAAPgkAAG8JAAChCQAAzAkAAPgJAAAaCgAAQgoAAG8KAACgCgAA0woA
AAoLAAA4CwAAagsAAKQLAADcCwAAFAwAAEwMAACEDAAAwQwAAP4MAAA9DQAAfA0AALUNAADoDQAA
Hw4AAFcOAACQDgAA0g4AABUPAABTDwAAjw8AAM4PAAASEAAAVhAAAJMQAADOEAAABREAAD4RAAB4
EQAAtBEAAPIRAAAvEgAAbxIAAK0SAAD0EgAAORMAAGMTAACREwAAwRMAAPUTAAAgFAAATxQAAIcU
AADAFAAA9BQAADAVAABtFQAAlxUAAMUVAAD1FQAAKRYAAFQWAACDFgAAwRYAAP8WAAA+FwAAfhcA
AL8XAAD5FwAAMRgAAGkYAAChGAAA2RgAABYZAABTGQAAkhkAANEZAAAKGgAAPRoAAHQaAACsGgAA
5RoAACcbAABqGwAAqBsAAOQbAAAjHAAAZxwAAKscAADoHAAAIx0AAFodAACTHQAAzR0AAAkeAABH
HgAAhB4AAMQeAAACHwAASR8AAI4fAAC4HwAA5h8AABYgAABKIAAAdSAAAKQgAADcIAAAFSEAAEkh
AACFIQAAwiEAAAEiAAAxIgAAZyIAAJUiAADGIgAA/CIAADMjAABvIwAAqiMAAOMjAAAcJAAAVSQA
AI4kAADMJAAACiUAAEolAACKJQAAxCUAAPglAAAwJgAAaSYAAKMmAADmJgAAKicAAGknAACmJwAA
5icAACsoAABwKAAArigAAOooAAAiKQAAXCkAAJcpAADUKQAAEyoAAFEqAACSKgAA0SoAABkrAABf
KwAAiisAALkrAADqKwAAHywAAEssAAB7LAAAtCwAAO4sAAAjLQAAYC0AAJ4tAADaLQAAFC4AAE4u
AACILgAAwi4AAAEvAABALwAAgS8AAMIvAAD9LwAAMjAAAGswAAClMAAA4DAAACQxAABpMQAAqTEA
AOcxAAAoMgAAbjIAALQyAADzMgAAMDMAAGkzAACkMwAA4DMAAB40AABeNAAAnTQAAN80AAAfNQAA
aDUAAK81AADbNQAACzYAAD02AABzNgAAoDYAANE2AAAMNwAARzcAAII3AAC9NwAA/TcAAD04AACE
OAAAyzgAAAU5AABBOQAAfjkAAL05AAD9OQAAKjoAAFs6AACOOgAAxToAAPM6AAAlOwAAUzsAAII7
AACsOwAA2zsAAAk8AAAzPAAAYjwAAJQ8AADHPAAA8jwAACg9AABRPQAAgj0AALQ9AADiPQAAEz4A
AEY+AAB6PgAAqj4AANg+AAAMPwAAPT8AAG8/AAC0PwAA+j8AAClAAABZQAAAjUAAALdAAADnQAAA
FUEAAEdBAAB1QQAAskEAANlBAAAFQgAAMkIAAGBCAACMQgAAvUIAAOBCAAANQwAAUUMAAIBDAADE
QwAA6kMAACBEAABFRAAAe0QAAKVEAADPRAAA8kQAABlFAABJRQAAcUUAAJdFAAC+RQAACEYAAFJG
AACeRgAA6kYAADBHAAB1RwAAnUcAAMZHAAD5RwAAL0gAAGVIAACNSAAAzUgAAAhJAAAzSQAAYEkA
AI1JAAC1SQAA2kkAAA9KAAA6SgAAb0oAAKVKAADQSgAAAUsAADFLAABcSwAAhksAALNLAADcSwAA
B0wAADFMAABkTAAAkEwAALxMAADfTAAAFk0AADpNAABwTQAAkU0AAL1NAADaTQAA+U0AABhOAABQ
TgAAgU4AAK5OAADiTgAAF08AAE1PAAB1TwAAo08AAMlPAAD1TwAAG1AAAEdQAABuUAAAm1AAAMNQ
AADxUAAAGlEAAElRAABkUQAAiFEAAJVRAACpUQAAuFEAAMVRAADTUQAA41EAAOxRAAD2UQAADFIA
ABNSAAA0UgAATVIAAGZSAACdUgAAxVIAAMtSAADTUgAA41IAAO5SAAD/UgAAE1MAACdTAAAzUwAA
OlMAAElTAABhUwAAdFMAAI1TAAClUwAAuVMAAMZTAADdUwAAB1QAADFUAABeVAAAiVQAAKVUAAC6
VAAAxFQAAM5UAADiVAAA+FQAAABVAAAGVQAAGVUAAC1VAAA4VQAAP1UAAEhVAABiVQAAeFUAAIZV
AACdVQAAuFUAAOxVAAAvVgAAdlYAAH1WAACSVgAAqFYAALxWAADFVgAA5lYAAPZWAAAFVwAAGFcA
ADNXAABWVwAAZ1cAAG9XAAB6VwAAhFcAAI5XAACpVwAAslcAALtXAADiVwAA81cAACRYAAA0WAAA
SVgAAGFYAAB1WAAAilgAAKFYAAC9WAAAy1gAAORYAAD9WAAAG1kAACJZAAAyWQAAUVkAAGNZAAB1
WQAAflkAAI1ZAACeWQAArlkAALtZAADDWQAA2FkAAOdZAAD2WQAAC1oAABRaAAAbWgAAOloAAHZa
AACrWgAAtVoAAMJaAADVWgAA4loAAAJbAAAIWwAAD1sAABtbAAAyWwAARVsAAEtbAABUWwAAX1sA
AGdbAABwWwAAh1sAAJRbAACvWwAAw1sAANtbAADjWwAA7VsAAPlbAAANXAAAJVwAADBcAABCXAAA
WVwAAGlcAACKXAAAqlwAAMdcAADnXAAA81wAAAddAAARXQAAJF0AAD9dAABnXQAAjF0AAKZdAAC+
XQAAxl0AANxdAADlXQAA8F0AAP9dAAALXgAAG14AAGxeAABzXgAAiF4AAJJeAACYXgAAp14AAK1e
AAC0XgAAvV4AANNeAADdXgAAAV8AABJfAAAaXwAAJ18AADtfAABIXwAAV18AAGZfAAB3XwAAhF8A
AJRfAACjXwAArl8AALlfAADFXwAAzF8AAOZfAAD3XwAAE2AAAEJgAABaYAAAZ2AAAINgAACdYAAA
t2AAAM9gAADjYAAABWEAADNhAABNYQAAVmEAANNhAADpYQAA/WEAAEBiAACDYgAAvWIAAPdiAAAz
YwAAPmMAAEljAABbYwAAfGMAAIljAAClYwAAu2MAANdjAADvYwAAHmQAAElkAABrZAAAjWQAAK5k
AADEZAAAz2QAANxkAAD4ZAAAC2UAADFlAABDZQAAUGUAAGRlAAB8ZQAAsWUAAM1lAADrZQAA+GUA
AApmAAAaZgAAPmYAAGJmAAB7ZgAArmYAANtmAADmZgAA8WYAAAlnAAAWZwAAH2cAADFnAABwZwAA
emcAAJJnAACvZwAA0mcAAOpnAAADaAAAH2gAADNoAABPaAAAXGgAAHBoAACRaAAAq2gAAMVoAADj
aAAACWkAAB9pAAAqaQAAPmkAAF9pAABsaQAAemkAAIxpAACaaQAAqWkAALZpAADLaQAA3mkAAP9p
AABSagAAmmoAAMJqAADnagAA+moAAB1rAAAoawAAM2sAAEFrAABaawAAaGsAAHBrAAC+awAADGwA
AB5sAAA8bAAARWwAAFpsAABjbAAAbGwAAJxsAAC0bAAADm0AABdtAAApbQAAPm0AAGVtAACSbQAA
rm0AANJtAAACbgAADm4AAC1uAABCbgAAb24AAJNuAAC3bgAA224AAOduAADwbgAACG8AACZvAABN
bwAAaG8AAHFvAACJbwAAj28AAJ5vAACwbwAAv28AAAFwAAATcAAANHAAAD1wAABRcAAAaXAAAIpw
AACTcAAA1XAAACVxAAA3cQAAQHEAAElxAABbcQAAbXEAAH9xAACacQAArHEAALVxAADBcQAAynEA
ANZxAADucQAAD3IAADByAABXcgAAmXIAALFyAAC6cgAA3nIAAPByAAACcwAADnMAABpzAAAscwAA
WXMAAGVzAAB0cwAAiXMAAJhzAACtcwAAuXMAAM5zAADacwAA6XMAAPtzAAAQdAAAMXQAAEh0AABW
dAAAZHQAAIt0AACzdAAA2HQAAPp0AAAldQAATXUAAHh1AACsdQAA73UAABt2AAA2dgAATnYAAHl2
AAC0dgAAzHYAAEF3AACtdwAAEHgAAHl4AACUeAAAYnkAAIF5AACZeQAAtHkAANJ5AAD8eQAAMHoA
AF56AAB2egAAjnoAAMt6AAAIewAAF3sAADl7AABLewAAdnsAAKd7AADbewAA8HsAAHd8AADkfAAA
IX0AAIp9AACffQAA030AAP59AAAcfgAAU34AAJB+AADQfgAA/n4AABx/AABNfwAAl38AAN1/AADy
fwAAIIAAADKAAABygAAAoIAAAACBAAAYgQAARoEAAH6BAAC8gQAA+oEAAB+CAABdggAAsIIAAAOD
AAAxgwAAaIMAAJ+DAADQgwAAQoQAAFeEAABvhAAAioQAAL6EAADWhAAA64QAAAOFAAAVhQAAKoUA
AGKFAACjhQAAsoUAANqFAADuhQAACIYAAByGAAAthgAAVoYAAHWGAADLhgAA/IYAABuHAAA9hwAA
X4cAAKOHAACvhwAA0YcAADuIAACciAAA44gAABCJAAAwiQAASYkAAJ2JAAC2iQAAaIoAAIGKAACN
igAAsooAAMGKAADQigAA/4oAABuLAAAqiwAAQIsAAE+LAABliwAAe4sAAKGLAADEiwAA3YsAAPaL
AAAMjAAAJYwAAE6MAABajAAAhowAAJiMAAC3jAAAJo0AAJaNAAC7jQAA6o0AAB2OAABWjgAAgY4A
AMCOAAAzjwAAjI8AAMCPAAD1jwAAKpAAAFCQAAC9kAAAyZAAANyQAADukAAA/ZAAABmRAAA1kQAA
WpEAAHaRAACVkQAAtJEAAAKSAAAukgAAQJIAAFKSAABokgAAhJIAAKmSAADIkgAA2pIAAPaSAAAZ
kwAAR5MAAGqTAACkkwAA4JMAAAmUAABMlAAAjJQAAMWUAADYlAAA9pQAABKVAAAwlQAAVpUAAGeV
AACHlQAAuZUAAN6VAAAzlgAAT5YAAGyWAACNlgAAqpYAAMeWAADllgAAAZcAAEuXAADNlwAABJgA
ABOYAACemAAA0pkAAFeaAABjmgAAnZoAAL+aAAAymwAAlJsAAKabAADcmwAAHJwAAEmcAACPnAAA
qpwAANKcAAAAnQAAMZ0AAKCdAAA9ngAAnZ4AALueAADyngAAUZ8AAK2fAAAJoAAAK6AAAJGgAAD8
oAAALKEAAE2hAAB0oQAAvqEAACGiAABJogAAsqIAAMeiAADfogAA8aIAABajAAArowAAQKMAAE+j
AACMowAA2KMAACekAAB2pAAAvqQAAAelAABVpQAAfaUAAKqlAAAFpgAAHaYAADWmAABKpgAAnaYA
AMmmAABSpwAAZ6cAAJSnAADvpwAACqgAACioAABrqAAApKgAAMKoAADqqAAAc6kAAMCpAABGqgAA
W6oAAJWqAAC9qgAA96oAACWrAABNqwAAgasAAM6rAAD/qwAARawAAHWsAACKrAAAsqwAAMKsAADH
rAAA1awAAOmsAADurAAA9qwAAP+sAAAkrQAARq0AAGGtAACArQAAv60AAPWtAAAHrgAAJK4AAEyu
AABnrgAAgK4AAImuAACqrgAAv64AANCuAADcrgAA5q4AAPmuAAAErwAAF68AACuvAAA9rwAASK8A
AE+vAABcrwAAcq8AAIuvAACTrwAAnK8AAK6vAAC9rwAAzK8AANuvAADhrwAA568AAPyvAAAGsAAA
LrAAAFSwAABysAAAk7AAAKWwAAC8sAAAy7AAANewAADesAAAKbEAADCxAAA7sQAARrEAAFmxAABp
sQAAd7EAAIqxAACWsQAApLEAALKxAADCsQAAzrEAAN2xAADysQAABbIAAA2yAAAZsgAAJbIAAC2y
AABGsgAAVrIAAGKyAABrsgAAdbIAAH6yAACGsgAAjrIAAJiyAACjsgAArLIAAMqyAAD+sgAAEbMA
ADGzAABEswAAfLMAAJ6zAAC+swAA2rMAAOazAAA0tAAAVrQAAHK0AACOtAAAsrQAANS0AADltAAA
B7UAACO1AABBtQAAVrUAAHK1AAB/tQAAkLUAAK61AAC9tQAA57UAAPK1AABOtgAAdLYAAJS2AADI
tgAA4rYAAAK3AAAXtwAAKLcAAES3AABxtwAAmLcAAKu3AADUtwAA57cAAAW4AAAtuAAAS7gAAFm4
AABvuAAAgrgAAJy4AADbuAAA97gAABm5AABHuQAAgbkAAL25AAD3uQAAGboAADe6AABWugAAnboA
AN66AADrugAACbsAABm7AAAouwAAvLsAABe8AAB2vAAA1bwAADK9AABSvQAAbr0AAJu9AACyvQAA
v70AAOi9AAD8vQAABr4AACa+AABEvgAAaL4AAKq+AADGvgAA174AAOq+AAAOvwAATb8AAF6/AABv
vwAAg78AAJ2/AACuvwAAvr8AAM+/AADfvwAA678AAAPAAAAIwAAADsAAABnAAAAywAAARMAAAFTA
AABZwAAAasAAAIvAAACWwAAAu8AAAODAAAAFwQAAFsEAACHBAAAnwQAANcEAAEvBAABawQAAasEA
AH3BAACOwQAAocEAANbBAAAbwgAAKMIAADrCAABKwgAAX8IAAG7CAACCwgAAjcIAAJbCAAC2wgAA
ysIAANLCAADgwgAA8cIAABjDAAA7wwAAVMMAAGHDAABpwwAAdMMAAIjDAACUwwAAn8MAAKvDAAC7
wwAAy8MAANjDAADkwwAA7cMAAALEAAASxAAAHsQAADHEAABPxAAAY8QAAHTEAACBxAAAj8QAAJzE
AACmxAAAr8QAAMPEAADRxAAA6MQAAPDEAAD5xAAABcUAABTFAAApxQAANsUAAEzFAABfxQAAdMUA
AJDFAACkxQAAr8UAAMLFAAAYxgAAJMYAAFDGAAB9xgAAqMYAANDGAADqxgAACccAACnHAABGxwAA
V8cAAGbHAAB0xwAAi8cAAKvHAADCxwAAA8gAABDIAAAdyAAAncgAAMXIAAAHyQAAHckAAFDJAADU
yQAACcoAAD7KAABvygAAkMoAALDKAADWygAAjcsAALvLAAD5ywAANMwAAEDMAABfzAAAgMwAAKTM
AAAbzQAAVs0AAGjNAACgzQAAxc0AABDOAAAzzgAAXM4AAIjOAACwzgAAxc4AAPbOAABXzwAAac8A
AHvPAACjzwAA1M8AAPnPAAA30AAAeNAAAJbQAAC+0AAAD9EAADHRAACV0QAAzdEAAC3SAACK0gAA
ztIAAC/TAABa0wAAe9MAAJrTAACv0wAA8NMAAP/TAAA01AAAedQAALfUAADu1AAAANUAADjVAABd
1QAAodUAAOPVAABq1gAApNYAALnWAADk1gAAENcAADLXAABj1wAAuNcAAOvXAAAq2AAAU9gAAHTY
AAAW2QAAstkAANfZAAD82QAAjNoAALfaAAA72wAAUtsAAHLbAACH2wAAzNsAAADcAAA33AAAXNwA
AGjcAACK3AAAltwAALjcAADm3AAASd0AAHrdAACN3QAABt4AADHeAABY3gAAf94AAK7eAADj3gAA
/N4AABzfAACS3wAAsd8AAOXfAAAM4AAAMOAAAKngAAC14AAA4+AAAA7hAAAs4QAAaeEAANzhAADx
4QAABuIAADfiAADE4gAA0+IAAEzjAAB34wAAqOMAAPnjAAAt5AAAaOQAAMXkAAAr5QAAkeUAALzl
AAAG5gAAG+YAADnmAABz5gAAreYAANvmAAAA5wAARucAAG/nAACU5wAAtecAAPnnAAA86AAAf+gA
ALDoAADV6AAADOkAADrpAABY6QAAfekAAPrpAAA76gAAy+oAAP/qAAAq6wAAoesAANzrAAD+6wAA
LuwAAFXsAAB37AAAtewAANDsAADy7AAAI+0AAHPtAACH7gAAyO4AAN3uAAAF7wAAGu8AAGfvAAB3
7wAAhu8AAJLvAACZ7wAAn+8AAKTvAACq7wAAr+8AAL/vAADG7wAA0e8AAN7vAADr7wAA8+8AAAXw
AAAN8AAAFfAAAEfwAACH8AAAn/AAAL3wAADi8AAA7fAAAPvwAAAF8QAAF/EAACPxAAAv8QAAOvEA
AE7xAABi8QAAbPEAAIHxAACI8QAAkfEAAKfxAAC98QAAx/EAANrxAADv8QAAD/IAACHyAAAu8gAA
PPIAAEryAABV8gAAZ/IAAHLyAAB68gAAg/IAAJ/yAAC48gAAy/IAANbyAADe8gAA5/IAAPryAAAL
8wAAGPMAACPzAABA8wAAU/MAAF3zAABz8wAAhfMAAKzzAADR8wAA8PMAABH0AAAa9AAAJ/QAADL0
AAA/9AAAY/QAAIb0AACm9AAAuPQAAL/0AADK9AAA2/QAAOn0AAA09QAAP/UAAEX1AABO9QAAYPUA
AH31AACY9QAAoPUAALH1AADI9QAA0fUAAOj1AAAA9gAACfYAABj2AAAh9gAAKfYAAC/2AAA89gAA
SfYAAFP2AABZ9gAAbfYAAIb2AACW9gAAn/YAALf2AADD9gAAzfYAAOr2AAD09gAAFvcAAFr3AAB2
9wAAmPcAAMX3AADh9wAAAfgAABD4AABw+AAAsPgAAOD4AAAE+QAAD/kAACT5AABj+QAAkPkAALP5
AAC/+QAA3/kAAAf6AAAo+gAASfoAAG76AACN+gAAp/oAALj6AADE+gAA7/oAABP7AABA+wAAi/sA
AKr7AADC+wAAC/wAAC78AAA9/AAAa/wAAKX8AADJ/AAA4/wAAAb9AAAf/QAAKv0AADv9AABS/QAA
hP0AAJj9AACw/QAAxf0AAPL9AAAN/gAAUv4AAKv+AAAA/wAATf8AAJr/AADr/wAAOAABAFsAAQCV
AAEAxQABAGsBAQCpAQEA5wEBABcCAQAsAgEAOwIBAEwCAQB4AgEAhQIBAKICAQDCAgEA4AIBAAAD
AQARAwEAJQMBAC4DAQBUAwEAbAMBAHwDAQCjAwEAwAMBANQDAQDuAwEAFwQBACYEAQBKBAEAsAQB
AOkEAQAWBQEAWwUBAGoFAQCGBQEAngUBALAFAQDdBQEA8gUBACgGAQBhBgEAeQYBAJcGAQC+BgEA
zQYBAPoGAQAPBwEAtQcBAMEHAQDaBwEA7wcBAB8IAQBACAEAfwgBAIsIAQCkCAEAuQgBAMIIAQDm
CAEA+wgBACgJAQBJCQEAcAkBAJoJAQAVCgEAQgoBAKUKAQC6CgEAzwoBAOQKAQA4CwEAkgsBAMIL
AQDpCwEAEwwBADQMAQBVDAEAhQwBANAMAQADDQEAPA0BAFQNAQCZDQEA5w0BACwOAQA7DgEASw4B
AHIOAQCiDgEAxw4BAO4OAQAMDwEAMw8BAFcPAQByDwEAjQ8BAOQPAQA4EAEAjxABAN0QAQDvEAEA
BxEBACIRAQAxEQEAXhEBAKMRAQDNEQEA6hEBAPwRAQBNEgEAcRIBAIISAQCUEgEAnhIBAKMSAQC0
EgEAwhIBANESAQDkEgEA9hIBAAMTAQAJEwEAEBMBAB0TAQAnEwEAMhMBAEgTAQBNEwEAVxMBAGAT
AQBtEwEAdhMBAJETAQCnEwEAtRMBAMYTAQDhEwEAAhQBAB0UAQAtFAEAPxQBAEoUAQBeFAEAdxQB
AIgUAQCeFAEAtRQBAMYUAQDNFAEA3xQBAOoUAQD2FAEACBUBACwVAQBzFQEAphUBALIVAQDHFQEA
2BUBAPUVAQAJFgEAHxYBAC4WAQBIFgEAWRYBAGcWAQBzFgEAihYBAJIWAQClFgEAsRYBALoWAQDZ
FgEA+BYBABsXAQA6FwEAVBcBAF4XAQBpFwEAeRcBAI0XAQCgFwEAuhcBANUXAQDoFwEA+BcBAEUY
AQBPGAEAaRgBAH8YAQCIGAEAlBgBALsYAQDnGAEAEhkBAD4ZAQBMGQEAZRkBAHsZAQCXGQEApBkB
ALYZAQDEGQEA0xkBANkZAQDtGQEACxoBABwaAQAwGgEAVhoBAHUaAQDvGgEAIhsBAEcbAQBvGwEA
eBsBALMbAQAXHAEAQRwBAIQcAQDaHAEA9hwBAC4dAQBHHQEAeR0BAKEdAQDUHQEA8x0BADgeAQBK
HgEAXx4BAG4eAQCNHgEArR4BALweAQDSHgEA6x4BABEfAQAtHwEAUx8BAGwfAQCXHwEArR8BAMIf
AQDnHwEAPSABAEkgAQBeIAEAhCABALAgAQDhIAEA8yABADghAQDHIQEA6SEBAFYiAQB+IgEApiIB
AMwiAQD6IgEAPyMBAGwjAQDpIwEAHyQBAJwkAQC/JAEAAyUBAA8lAQAiJQEASCUBAM0lAQAKJgEA
RCYBAH4mAQCgJgEAryYBAM8mAQDuJgEAKycBAFQnAQB3JwEAkCcBAKwnAQDBJwEA5CcBABcoAQAz
KAEAVSgBAHooAQDLKAEAjCkBANYpAQAPKgEALioBAEEqAQBrKgEAdSoBALAqAQDZKgEADCsBABUr
AQBRKwEAcCsBAIwrAQCuKwEA1CsBAPYrAQArLAEAgCwBAKgsAQDKLAEA4ywBACgtAQBRLQEAky0B
AJ8tAQDJLQEA+S0BABsuAQAqLgEATC4BAGguAQCBLgEAmi4BAL0uAQDpLgEACC8BAGcvAQB2LwEA
0C8BADswAQBqMAEAjDABAJcwAQCzMAEA2DABAPcwAQAZMQEANTEBAIcxAQCjMQEA3zEBAB4yAQBW
MgEAgTIBAKkyAQC1MgEAxjIBAOUyAQAEMwEAJzMBADUzAQBmMwEAuzMBAA00AQBcNAEAbjQBAI00
AQCtNAEA5TQBABM1AQBbNQEAfTUBALg1AQDjNQEAHzYBAEo2AQB/NgEAvTYBAPw2AQDJNwEA3jcB
ABA4AQBCOAEAajgBAH84AQCkOAEA2TgBAO44AQAUOQEALDkBAFE5AQBjOQEAizkBAKM5AQC/OQEA
1zkBAPA5AQD9OQEACjoBABQ6AQAcOgEAPDoBAFw6AQBhOgEAczoBAIg6AQCTOgEAvToBAOs6AQAH
OwEAKjsBAEo7AQBmOwEAfzsBAI47AQCqOwEAwDsBAM87AQDrOwEA+jsBAAk8AQAsPAEAQjwBAGk8
AQCVPAEAtjwBANw8AQABPQEAGT0BACw9AQBSPQEAWj0BAG09AQCTPQEAnj0BAK49AQC7PQEAyT0B
AOs9AQAOPgEAFj4BACs+AQBoPgEAqD4BAMw+AQDgPgEA9D4BAAg/AQAiPwEAMT8BAD0/AQBFPwEA
dT8BAHo/AQCGPwEApz8BAK8/AQDAPwEA2T8BAPY/AQAWQAEAJEABADJAAQBUQAEAZUABAHlAAQCB
QAEAj0ABAOtAAQD8QAEAA0EBABVBAQAnQQEAOUEBAEdBAQBvQQEAhUEBAJNBAQC0QQEA1EEBAOJB
AQABQgEAFEIBACVCAQAuQgEAQ0IBAGpCAQChQgEAs0IBAMZCAQDYQgEABUMBABFDAQAeQwEAOEMB
AEhDAQCUQwEAvUMBABFEAQAvRAEATUQBAFpEAQB4RAEAkkQBAK5EAQDIRAEA5kQBAPNEAQAARQEA
D0UBABxFAQA6RQEAi0UBALFFAQDdRQEAFkYBADhGAQBoRgEAe0YBAIZGAQCXRgEA3EYBAAVHAQAS
RwEAIUcBACpHAQBLRwEAVEcBAMdHAQDoRwEAPEgBAGdIAQCxSAEA2EgBAPRIAQAKSQEALkkBAEpJ
AQBwSQEAjkkBANBJAQDbSQEAE0oBAEZKAQBgSgEAg0oBALlKAQDbSgEACEsBACtLAQBCSwEAXEsB
AGlLAQCHSwEAp0sBAMVLAQDhSwEA9EsBAAtMAQAnTAEAP0wBAGxMAQCXTAEAwkwBAOpMAQD8TAEA
CU0BABZNAQAuTQEASE0BAFNNAQBqTQEAjk0BAKpNAQDZTQEA+00BAAxOAQAwTgEAP04BAFBOAQBd
TgEAbk4BAIdOAQCZTgEArE4BAL9OAQDZTgEA+U4BABdPAQBdTwEAb08BAH1PAQCnTwEAtE8BANtP
AQAEUAEAYlABAJJQAQC0UAEA01ABAPdQAQAEUQEAFVEBADNRAQBaUQEAm1EBALBRAQDOUQEA7lEB
AA5SAQBOUgEAaFIBAIxSAQDDUgEA3VIBAPJSAQAQUwEALlMBAEFTAQBgUwEAu1MBABRUAQBrVAEA
vFQBAOFUAQAnVQEAR1UBAFJVAQBfVQEAclUBAJpVAQCpVQEA1VUBAO9VAQAJVgEAlFYBALlWAQDM
VgEA7FYBAAVXAQAhVwEAW1cBAHJXAQCiVwEA9VcBADlYAQBYWAEAhlgBALpYAQDyWAEAJFkBADlZ
AQBnWQEAiFkBAKxZAQC7WQEA51kBAPhZAQAXWgEALVoBAEZaAQBVWgEAd1oBAJNaAQCkWgEAuFoB
AMZaAQDXWgEA6loBAAFbAQAMWwEAGFsBADFbAQBEWwEAdVsBALpbAQDOWwEA4FsBAPpbAQAFXAEA
FlwBACBcAQA1XAEAR1wBAGFcAQB8XAEAiVwBAKBcAQCtXAEAvlwBAMZcAQDzXAEAHF0BAE1dAQB0
XQEAv10BAMpdAQDgXQEA9l0BAApeAQAaXgEAJl4BAFFeAQB3XgEAkl4BAKBeAQDFXgEA3V4BAOde
AQD0XgEADl8BACVfAQAsXwEAQl8BAFRfAQBfXwEAcV8BAIZfAQCXXwEAqF8BALpfAQDKXwEA4V8B
APJfAQADYAEADmABACJgAQAvYAEATGABAFNgAQBlYAEAdmABAI1gAQCYYAEAo2ABALxgAQDOYAEA
7GABAABhAQALYQEAFWEBAC1hAQA7YQEAWWEBAGRhAQCFYQEAqmEBALthAQDPYQEA2GEBAOVhAQDv
YQEA/WEBABliAQAuYgEAOGIBAEJiAQBQYgEAcGIBAIpiAQCkYgEAxGIBAO9iAQAJYwEAO2MBAF1j
AQB5YwEAlWMBAK9jAQDAYwEA3mMBAPhjAQAaZAEAOmQBAFNkAQBmZAEAhGQBALFkAQC+ZAEA1WQB
APFkAQAGZQEAE2UBACJlAQBCZQEASWUBAKllAQDJZQEAGmYBADRmAQBDZgEAWGYBAGlmAQCFZgEA
smYBANtmAQDuZgEAGWcBACxnAQBOZwEAdGcBAJJnAQCwZwEAxmcBAO5nAQD7ZwEAGWgBACBoAQBm
aAEAo2gBAL9oAQDjaAEAD2kBAEdpAQCDaQEAqGkBAL1pAQDxaQEACWoBACNqAQBHagEAf2oBAKNq
AQDHagEA52oBAJFrAQDnawEAOWwBAJFsAQDfbAEA/WwBACxtAQBDbQEAW20BAIFtAQChbQEAtG0B
AMxtAQDabQEA720BACtuAQA8bgEAXm4BAHJuAQCIbgEAl24BAKhuAQC6bgEA1m4BAAFvAQAKbwEA
GG8BADdvAQBnbwEAn28BANVvAQD9bwEAEnABACpwAQBScAEAZXABAH5wAQCRcAEApHABALxwAQDL
cAEA8HABABhxAQBPcQEAanEBAJRxAQDEcQEA7nEBABJyAQAucgEAQXIBAHNyAQDMcgEAH3MBAC5z
AQBIcwEAcHMBAJtzAQC/cwEA63MBAAJ0AQAqdAEAUnQBAHB0AQCKdAEAsHQBABl1AQBXdQEAyXUB
AOB1AQAGdgEAKHYBAHR2AQDIdgEAG3cBAHZ3AQCDdwEAlHcBALV3AQDtdwEADXgBACt4AQBheAEA
f3gBAIx4AQCTeAEAs3gBANt4AQAkeQEATXkBAFR5AQBpeQEAoXkBAMV5AQDxeQEAHXoBAFN6AQB5
egEAn3oBAK56AQDEegEA3XoBAPB6AQAmewEAwHsBAM17AQDnewEAAHwBAEp8AQByfAEAmHwBAL58
AQDSfAEA4nwBAPV8AQAEfQEAFn0BACR9AQArfQEAbH0BAJx9AQCvfQEAt30BAMp9AQDafQEA5X0B
APl9AQARfgEAMH4BAEp+AQBkfgEAj34BALp+AQDNfgEA4H4BAAZ/AQAdfwEAKX8BADN/AQBNfwEA
ZX8BAHZ/AQCGfwEAnH8BALd/AQDNfwEA2n8BAPV/AQAggAEATIABAHaAAQCggAEAtIABALyAAQDZ
gAEA7IABAPmAAQASgQEAGYEBACuBAQBggQEAdoEBAIeBAQCSgQEAqYEBALOBAQDHgQEA54EBAPiB
AQADggEAFoIBADeCAQCSggEAm4IBAKqCAQDIggEA4IIBAPGCAQD8ggEAEIMBACaDAQBEgwEAY4MB
AHaDAQCQgwEAnIMBAKyDAQC+gwEA0YMBANaDAQDhgwEA6oMBAO+DAQD8gwEACIQBABmEAQA5hAEA
VIQBAKCEAQDdhAEASYUBAJuFAQDuhQEAKIYBAGWGAQCchgEA7oYBAACHAQAnhwEATIcBAKmHAQDg
hwEABYgBACaIAQA4iAEASogBAFaIAQBfiAEAvIgBAOqIAQAPiQEAM4kBAFGJAQB5iQEArYkBAOeJ
AQD2iQEAFIoBAE6KAQC9igEA0ooBAAaLAQA6iwEAcYsBAKSLAQDOiwEA44sBAPuLAQANjAEASowB
AIeMAQDhjAEAJI0BAEyNAQB0jQEAu40BAAGOAQAijgEAaI4BAIqOAQCyjgEAzY4BAE+PAQB/jwEA
o48BANiPAQB8kAEAHJEBADiRAQB8kQEA05EBACaSAQB5kgEAlJIBANqSAQAXkwEAPJMBAE6TAQBp
kwEAr5MBAOyTAQAglAEAk5QBAO+UAQBZlQEAaZUBAHyVAQDLlQEA+JUBAA2WAQBIlgEAdpcBAN6X
AQASmAEAQ5gBAHSYAQCxmAEA05gBAPSYAQAlmQEANJkBAD+ZAQBVmQEAZpkBAHiZAQCHmQEAj5kB
AJ+ZAQC7mQEA05kBAO2ZAQD8mQEAMJoBAE6aAQBhmgEAcpoBAIaaAQDDmgEAz5oBAN6aAQDvmgEA
/poBABObAQAzmwEAQpsBAE6bAQBimwEAfJsBAIubAQChmwEAupsBANKbAQDrmwEA/psBABecAQAl
nAEALpwBAEOcAQBenAEAd5wBAIecAQCfnAEAvZwBANGcAQDknAEABJ0BABadAQAunQEAOZ0BAEmd
AQBxnQEAl50BAKedAQC3nQEAxZ0BAOydAQATngEAOJ4BAFueAQB9ngEAh54BAJGeAQCgngEAt54B
AAqfAQAUnwEAJJ8BACqfAQAwnwEAPp8BAE+fAQBZnwEAZJ8BAG2fAQB5nwEAiJ8BAKGfAQC3nwEA
wJ8BAM+fAQDanwEA6p8BAPufAQACoAEAG6ABACugAQBaoAEAdKABAIegAQC4oAEAwqABAM6gAQD1
oAEAAqEBAAyhAQAVoQEAJqEBAC2hAQBAoQEATqEBAG+hAQCLoQEAo6EBAK2hAQC3oQEAy6EBAN+h
AQDxoQEADqIBAC+iAQBHogEAZ6IBAHmiAQDJogEA96IBACejAQBWowEAhqMBAKKjAQCyowEAwKMB
ANqjAQDmowEA76MBAPujAQAPpAEAKaQBAD6kAQBWpAEAXqQBAGakAQB/pAEAj6QBAKOkAQC9pAEA
zqQBAOKkAQD3pAEABqUBABalAQAppQEAOqUBAEmlAQBTpQEAaaUBAIClAQCPpQEAp6UBALWlAQDJ
pQEA06UBAOGlAQDopQEAGqYBAD2mAQBKpgEAVKYBAGWmAQCApgEAmqYBAKamAQDFpgEA5KYBAPCm
AQD4pgEAEKcBAB6nAQAqpwEAM6cBAESnAQBTpwEAWqcBAGKnAQCapwEAzKcBAN2nAQDspwEA86cB
AAaoAQAPqAEAI6gBAC2oAQA7qAEATagBAHqoAQCOqAEAnqgBAK2oAQC6qAEA06gBAOOoAQDtqAEA
AKkBAA6pAQAeqQEAKakBADmpAQBSqQEAW6kBAHCpAQCCqQEAnakBAKqpAQDNqQEA26kBAOSpAQAI
qgEAGaoBACiqAQA+qgEATKoBAHmqAQCiqgEAz6oBAPmqAQAOqwEAHqsBACerAQCAqwEAmKsBAK2r
AQC8qwEA36sBAAOsAQAdrAEAO6wBAGGsAQBvrAEAhqwBALGsAQDCrAEAzKwBAOqsAQAIrQEAF60B
ACGtAQAsrQEAT60BAFqtAQByrQEAeK0BAICtAQCRrQEAnq0BAK6tAQDErQEA1a0BAOKtAQD9rQEA
B64BABCuAQAjrgEANK4BAEauAQBNrgEAVK4BAGKuAQBrrgEAfq4BAJWuAQChrgEAt64BAMuuAQDg
rgEA9K4BAAOvAQAnrwEAX68BAGevAQBurwEAgq8BAI+vAQCtrwEAua8BANavAQDerwEA9a8BAAaw
AQAasAEANLABAFqwAQBtsAEAg7ABAKKwAQC0sAEAwrABANawAQDysAEAB7EBAByxAQAmsQEAQ7EB
AGCxAQCTsQEAwLEBAN6xAQADsgEAGbIBADCyAQBjsgEAkbIBAMCyAQD2sgEAQbMBAEyzAQBaswEA
crMBAH+zAQCUswEArbMBANCzAQDgswEA7rMBAPmzAQADtAEAIbQBACq0AQAztAEAOrQBAFe0AQB0
tAEAh7QBAI+0AQCmtAEAvLQBANG0AQDitAEA8rQBAAm1AQAftQEAMLUBAEK1AQBYtQEAYrUBAHS1
AQCAtQEAi7UBAJu1AQCitQEA3rUBAPG1AQAFtgEAF7YBACu2AQA8tgEAULYBAGe2AQBztgEAe7YB
AIK2AQChtgEAs7YBAMK2AQDXtgEA6rYBAB63AQA+twEASrcBAHC3AQCGtwEAn7cBAK63AQDKtwEA
47cBAP+3AQALuAEAF7gBACa4AQAyuAEASLgBAF64AQCzuAEAz7gBAOu4AQD0uAEAG7kBAGi5AQB+
uQEAwbkBAPq5AQAwugEARroBAFW6AQB0ugEAjboBAKq6AQC2ugEAyLoBAN26AQD5ugEADrsBACO7
AQBCuwEAS7sBAF27AQBpuwEAe7sBAKe7AQC3uwEAw7sBAOa7AQD1uwEAQrwBAFG8AQBrvAEAkrwB
ALS8AQDevAEAC70BAEy9AQCAvQEABr4BACm+AQAyvgEATr4BAGq+AQCDvgEAn74BAMC+AQDyvgEA
Eb8BAC2/AQBGvwEAab8BAIK/AQCYvwEAtr8BANm/AQACwAEAHsABADPAAQBFwAEAUcABAG3AAQB9
wAEAmsABAKbAAQDZwAEA6MABAPTAAQAIwQEAIsEBADbBAQCDwQEAtsEBAC7CAQB2wgEAu8IBANzC
AQAAwwEASMMBAJjDAQDpwwEASMQBAOXEAQB1xQEAt8UBAPDFAQAXxgEAQcYBAIbGAQCqxgEAvMYB
AOzGAQAixwEAT8cBAHPHAQCOxwEA1scBAOjHAQAVyAEAOsgBAGHIAQCdyAEA3MgBAB7JAQA/yQEA
VMkBAIfJAQCiyQEAuskBAMzJAQDhyQEAI8oBAF/KAQCYygEArcoBANHKAQDyygEAE8sBADTLAQBA
ywEAbcsBAIvLAQCXywEAwcsBAAzMAQBmzAEAt8wBAPDMAQAdzQEAMs0BAHTNAQCkzQEAxc0BAPXN
AQAZzgEAKM4BADzOAQB1zgEArs4BAObOAQD+zgEASc8BAI7PAQDozwEAPNABAF3QAQBp0AEAkNAB
AKXQAQDM0AEA5NABAA7RAQBE0QEAX9EBALbRAQB40gEAnNIBALPSAQDB0gEA2NIBABHTAQBr0wEA
ttMBANzTAQAh1AEAatQBALPUAQD11AEA/tQBAC3VAQBM1QEAa9UBAMDVAQDc1QEADtYBAD3WAQBy
1gEAstYBAOjWAQDK1wEA89cBAB/YAQB92AEAndgBALbYAQAT2QEANdkBAGHZAQCW2QEAv9kBANjZ
AQD02QEAF9oBADzaAQB02gEAhtoBAKvaAQDT2gEA5doBAA7bAQAw2wEAtdsBAOrbAQAo3AEAUNwB
AJLcAQC13AEA/twBAEfdAQDE3QEAOt4BAJzeAQDF3gEA3t4BADLfAQBR3wEAg98BALXfAQDq3wEA
GeABACvgAQBH4AEAcOABAILgAQCh4AEAveABAOPgAQAV4QEAN+EBAGbhAQCO4QEAs+EBANLhAQD0
4QEAHOIBAD7iAQBN4gEAv+IBACvjAQCd4wEAueMBAOvjAQD24wEAA+QBABLkAQAa5AEAIuQBACzk
AQA95AEAUeQBAGzkAQCN5AEAquQBALTkAQDD5AEA0+QBAN/kAQDr5AEAAOUBAArlAQBd5QEAbOUB
AHrlAQCF5QEAqeUBAL3lAQDD5QEAy+UBANzlAQDu5QEA/OUBAArmAQAd5gEANeYBAE7mAQBW5gEA
ZuYBAHbmAQCM5gEAqOYBALPmAQC+5gEAyuYBANzmAQD75gEAFOcBACjnAQA75wEATOcBAFjnAQBm
5wEAeecBAInnAQCi5wEAr+cBAL/nAQDO5wEA3+cBAAvoAQA36AEAY+gBAI/oAQCZ6AEAregBALfo
AQDH6AEAA+kBABPpAQBL6QEAa+kBAIXpAQCl6QEAvOkBAMfpAQDY6QEA5ukBAPLpAQAC6gEACuoB
ACXqAQAt6gEAQ+oBAFHqAQBs6gEAh+oBAI/qAQCb6gEAqeoBAMfqAQDb6gEA++oBABPrAQBf6wEA
mesBAMrrAQDv6wEAHewBACnsAQBF7AEAUewBAG3sAQCV7AEAwuwBAOTsAQAt7QEAPO0BAHDtAQCt
7QEAyO0BAPPtAQDv7gEADu8BAH3vAQCo7wEA0u8BAO3vAQA78AEAjPABAN3wAQBA8QEAT/EBAHDx
AQCn8QEAxfEBAAbyAQAb8gEAMPIBAGHyAQB28gEA5fIBACjzAQBl8wEAxvMBABX0AQBV9AEA6vQB
ABL1AQB/9QEArfUBAOH1AQDz9QEAM/YBAFr2AQB49gEAJ/cBAFv3AQCo9wEA+fcBACL4AQBM+AEA
lfgBANL4AQAM+QEAPfkBAFL5AQCP+QEA/PkBAD36AQBY+gEAnPoBAL76AQDc+gEAI/sBAHT7AQCh
+wEAtvsBAOb7AQAO/AEANvwBAGT8AQCb/AEA6PwBAFj9AQCZ/QEADP4BACH+AQA5/gEAff4BAL7+
AQDP/gEA3f4BAP3+AQAc/wEANv8BAEv/AQBr/wEAif8BAJr/AQCp/wEAwf8BAN3/AQDu/wEACgAC
AGYAAgCYAAIA7AACABQBAgBBAQIAagECAJcBAgC5AQIA5gECAAACAgAWAgIAKQICAEECAgBrAgIA
fAICAJ4CAgDKAgIA3QICAPACAgAOAwIASAMCAIkDAgCVAwIAogMCAMMDAgDhAwIA+wMCABcEAgBC
BAIAcAQCAH0EAgDVBAIA8QQCAAsFAgAzBQIAZQUCAPkFAgAXBgIAOwYCAFEGAgBmBgIAeQYCAJcG
AgCmBgIArwYCAL4GAgDTBgIADgcCAF0HAgBzBwIAjAcCAJoHAgClBwIAvwcCAM0HAgDpBwIA/AcC
AEcIAgBaCAIAhggCAKQIAgDECAIAzQgCAOMIAgDtCAIABwkCABMJAgArCQIANAkCAE4JAgBfCQIA
bgkCAIYJAgCNCQIApQkCAMUJAgDMCQIABgoCAFoKAgCECgIA0AoCAOEKAgDrCgIA/AoCAAkLAgAZ
CwIAMAsCAEQLAgBNCwIAVgsCAGILAgBuCwIAhAsCAJcLAgCoCwIAtgsCAMcLAgDQCwIA2QsCAOkL
AgD5CwIAEAwCABkMAgAoDAIASQwCAIUMAgC/DAIAywwCAN4MAgDqDAIA/QwCABMNAgAgDQIALQ0C
AD0NAgBDDQIAUA0CAFkNAgBpDQIAfw0CAIsNAgCeDQIArg0CAMkNAgAnDgIAMw4CAFcOAgB7DgIA
og4CAMkOAgDbDgIA5A4CAPQOAgAADwIAEA8CAC0PAgA6DwIAQw8CAGEPAgB+DwIAhw8CAJAPAgC7
DwIAxA8CAM0PAgDdDwIA7Q8CAAQQAgAXEAIALRACAEAQAgBZEAIAcxACAIMQAgCTEAIAnBACAKUQ
AgCxEAIAvhACANUQAgDlEAIACRECABIRAgAiEQIAORECAD8RAgBjEQIAbBECAHkRAgCCEQIAmREC
ALARAgDKEQIA5hECAPkRAgAWEgIAKhICAEsSAgBcEgIAkhICALkSAgDyEgIALhMCAHATAgCpEwIA
yhMCAOUTAgAYFAIAORQCAJAUAgC6FAIA0hQCAOQUAgALFQIAIBUCADgVAgBQFQIAhhUCAJUVAgC+
FQIA3xUCAPEVAgAVFgIALRYCAMkWAgDVFgIA6hYCAB0XAgAyFwIAbhcCAIYXAgC/FwIA+xcCACUY
AgBPGAIAfxgCAJQYAgCyGAIAvhgCAO4YAgAAGQIAPxkCAHIZAgDSGQIALxoCAFYaAgCDGgIAmBoC
AK0aAgD7GgIAWxsCAIIbAgCyGwIAzRsCAO4bAgAVHAIAMxwCAFccAgB4HAIArhwCAMYcAgDhHAIA
/BwCAEodAgBfHQIAgx0CAJIdAgC5HQIA7B0CABYeAgBjHgIAih4CAKgeAgDJHgIA5x4CAAUfAgAy
HwIAiR8CAOAfAgA3IAIAiCACAJQgAgC1IAIA3CACAO4gAgAJIQIAMCECADshAgBJIQIAUyECAGMh
AgCDIQIAmyECAKkhAgDCIQIAyCECANshAgDuIQIA9yECAAEiAgAuIgIAXSICAHwiAgCPIgIAmyIC
AKoiAgC3IgIAyyICAOAiAgAYIwIAKiMCAEIjAgBxIwIAjyMCAKEjAgCpIwIA1CMCAP8jAgAtJAIA
WiQCAGckAgCJJAIAkiQCAKYkAgCuJAIAtyQCAL4kAgDSJAIAJCUCAFAlAgBkJQIAdSUCAIolAgCe
JQIAsCUCALklAgDbJQIA7yUCAAomAgAXJgIANCYCAD8mAgBGJgIAUSYCAHYmAgCGJgIAkiYCAJ4m
AgC9JgIAyCYCAOQmAgD3JgIADCcCACMnAgA1JwIAVScCAG0nAgCAJwIAlScCALEnAgDMJwIA5ScC
AP4nAgAOKAIAJygCADgoAgBDKAIAUigCAGkoAgB0KAIAhSgCAKgoAgDGKAIA3ygCAO0oAgD5KAIA
CykCABMpAgAcKQIALCkCAD4pAgBNKQIAYikCAHQpAgCGKQIAwSkCANopAgAKKgIAFCoCACoqAgA+
KgIATyoCAGYqAgB7KgIAiCoCAJQqAgCaKgIAsioCAMcqAgD0KgIA/ioCAAgrAgA3KwIAYysCAIIr
AgCTKwIAnCsCAK0rAgC5KwIA0isCAP8rAgAuLAIAWSwCAIYsAgCLLAIAkywCAKMsAgC/LAIA1CwC
APAsAgD6LAIAEi0CAB0tAgArLQIASi0CAGYtAgBwLQIAfi0CAJUtAgCjLQIAty0CANQtAgDZLQIA
4S0CAPstAgAMLgIAJS4CAEsuAgBYLgIAbS4CAHYuAgDcLgIA/C4CAA4vAgAULwIALS8CAEMvAgBd
LwIAZi8CAHAvAgB8LwIAlS8CAKAvAgDALwIA2y8CAOovAgD6LwIAEzACACIwAgBAMAIATTACAFgw
AgBmMAIAcjACAIowAgC8MAIA2jACAPcwAgAmMQIARTECAGExAgBuMQIAmTECALMxAgDYMQIA+TEC
AAYyAgAmMgIARDICAGAyAgB6MgIAlDICAKEyAgCyMgIA3jICAAAzAgA1MwIAeTMCAKAzAgDQMwIA
ADQCAB80AgBCNAIAVDQCAGE0AgC2NAIACzUCAFo1AgCpNQIAsjUCAMQ1AgDQNQIA6jUCAAA2AgAe
NgIANjYCAEM2AgBQNgIAezYCAIg2AgCVNgIAnDYCANs2AgAGNwIADzcCACc3AgA0NwIAPTcCAEY3
AgBRNwIAVjcCAGY3AgB4NwIAkDcCAKQ3AgC4NwIAwzcCANc3AgDkNwIA+jcCABQ4AgAsOAIAQjgC
AFg4AgBsOAIAcTgCAH44AgCZOAIArzgCABQ5AgAoOQIAPzkCAE45AgBbOQIAcTkCAIs5AgClOQIA
tDkCAM45AgDoOQIAGDoCAFo6AgBvOgIAgjoCAKs6AgDjOgIAOzsCAG87AgCWOwIArTsCAP87AgAO
PAIAITwCAD08AgBVPAIAuTwCAM48AgDYPAIA6DwCACI9AgAwPQIARj0CAF09AgB7PQIAhj0CAJg9
AgCxPQIAzz0CANk9AgDmPQIAHD4CACI+AgAnPgIALT4CAEQ+AgBmPgIAhz4CAKM+AgDAPgIA2z4C
AO4+AgAIPwIAJD8CAEc/AgBgPwIAej8CAIY/AgCTPwIAzT8CAOo/AgAdQAIAK0ACAD9AAgBKQAIA
Y0ACAHVAAgCFQAIAnUACAKZAAgC+QAIA0EACAORAAgD0QAIAAkECAB5BAgAlQQIAOkECAINBAgCs
QQIA2EECAABCAgAsQgIATEICAGxCAgB7QgIAjEICAJZCAgCvQgIA0UICAPhCAgAUQwIAIUMCADFD
AgBPQwIAWUMCAHRDAgB9QwIAmEMCAKNDAgCxQwIA2EMCAPFDAgD+QwIAIUQCAEZEAgBZRAIAZEQC
AHNEAgB8RAIAlEQCAKVEAgC/RAIA1kQCABlFAgA8RQIAZEUCAIlFAgDRRQIA8EUCABJGAgA0RgIA
gEYCAK9GAgDORgIA50YCABlHAgBLRwIAbUcCAL9HAgDfRwIAAUgCACZIAgBVSAIAgUgCALxIAgDh
SAIA7UgCAD9JAgBeSQIAgEkCAKtJAgD6SQIARkoCAJtKAgDESgIA5koCAAhLAgBaSwIA2EsCAENM
AgBPTAIAa0wCAIZMAgDtTAIACU0CAB5NAgBATQIAa00CAJlNAgDbTQIAQk4CAH1OAgCcTgIACU8C
ADdPAgBNTwIAtE8CAO9PAgABUAIAJVACAEpQAgBaUAIAlVACALdQAgDiUAIAAFECADJRAgB1UQIA
VFICAJNSAgC+UgIA1lICAPVSAgAVUwIANFMCAENTAgBVUwIAg1MCAKVTAgDBUwIA0FMCAPxTAgAV
VAIATVQCAHlUAgCLVAIAmlQCAKdUAgC+VAIA1VQCAOJUAgAlVQIAWlUCAJJVAgC0VQIA1lUCAOJV
AgAEVgIAQ1YCAE9WAgBxVgIA71YCADdXAgBWVwIAflcCALxXAgAOWAIADVkCACJZAgBnWQIAhlkC
AORZAgAZWgIATloCAHBaAgClWgIAt1oCAOZaAgAFWwIAGlsCAD9bAgBYWwIAhlsCAJhbAgC6WwIA
yVsCAN5bAgAMXAIAZFwCAHZcAgCOXAIAtlwCAN5cAgDwXAIAH10CAHJdAgCzXQIA7V0CAHteAgCm
XgIA8V4CABpfAgCOXwIAAmACAGJgAgCdYAIAGmECAJdhAgAAYgIAPGICAIFiAgDJYgIA2GICAPFi
AgAiYwIAdGMCAKxjAgDdYwIAAmQCABRkAgAmZAIAVWQCAHRkAgCDZAIApWQCAMFkAgDjZAIAF2UC
AFFlAgBuZQIAimUCALVlAgDpZQIAC2YCADNmAgBbZgIAhmYCAK5mAgDdZgIA9WYCABpnAgAvZwIA
gGcCAI5nAgChZwIAq2cCAMFnAgDlZwIADGgCADBoAgA9aAIAXWgCAKpoAgDXaAIA82gCAE1pAgBz
aQIAj2kCAMNpAgDfaQIAE2oCADVqAgBKagIAgWoCAKZqAgDHagIA4WoCAAtrAgArawIATWsCAG9r
AgCtawIAyWsCAOdrAgD6awIAGmwCAC9sAgBAbAIAWGwCAH1sAgCKbAIApmwCAMJsAgDXbAIA/GwC
AA9tAgArbQIASW0CAJxtAgDtbQIAQG4CAI9uAgCtbgIAyW4CAGRvAgCQbwIAo28CAL1vAgDQbwIA
528CAAdwAgAhcAIAT3ACAINwAgC8cAIA/nACAC5xAgBScQIAanECAJ5xAgC4cQIA33ECAOhxAgD1
cQIAGHICADByAgBCcgIAUHICAGNyAgB2cgIAlHICAKxyAgDKcgIABXMCACZzAgA6cwIASnMCAFFz
AgBYcwIAeXMCAIRzAgCScwIAnHMCALNzAgC7cwIA9HMCACN0AgBAdAIAUXQCAGR0AgB7dAIAjHQC
AKt0AgC1dAIAxXQCANl0AgDidAIA8HQCABB1AgAodQIAPHUCAEt1AgBfdQIAbXUCAIR1AgCWdQIA
qXUCALx1AgDfdQIA73UCAAB2AgALdgIAGXYCACN2AgAxdgIARnYCAE52AgBedgIAZ3YCAHZ2AgCH
dgIAnXYCAKh2AgCwdgIAu3YCAMx2AgD6dgIAJ3cCAFV3AgCCdwIAlHcCAKZ3AgC4dwIA0XcCAN13
AgDsdwIA93cCAAV4AgAYeAIAKXgCAH54AgCZeAIAt3gCANl4AgAAeQIAHXkCADV5AgBEeQIAYXkC
AHF5AgCJeQIAj3kCAJd5AgCseQIAu3kCAMZ5AgDPeQIA3HkCAOl5AgD6eQIACHoCABx6AgAxegIA
VHoCAGx6AgCJegIAnHoCAKF6AgCmegIAuXoCAMV6AgDPegIA3XoCAPN6AgAEewIAGnsCADN7AgBI
ewIAUnsCAFh7AgBwewIAf3sCAIt7AgCTewIAo3sCALt7AgDEewIAynsCANN7AgDlewIA+3sCABF8
AgAhfAIAKXwCADJ8AgBFfAIATnwCAF98AgByfAIAgXwCAJZ8AgCyfAIAwHwCANt8AgDtfAIAAH0C
ABx9AgA0fQIAR30CAGx9AgB8fQIAkn0CAJp9AgCkfQIArH0CAAJ+AgAhfgIAKn4CAEV+AgBWfgIA
X34CAGt+AgB5fgIAin4CAJJ+AgCgfgIAsX4CALt+AgDMfgIA5X4CABB/AgBAfwIAUn8CAGR/AgB8
fwIAmH8CAKB/AgCtfwIA6X8CABaAAgA1gAIAR4ACAFqAAgBugAIAeYACAH+AAgCNgAIAnIACAL6A
AgDUgAIA3oACAOeAAgDugAIA9IACAPqAAgATgQIAPoECAG6BAgCVgQIAr4ECAMCBAgDUgQIA3YEC
APGBAgADggIALIICADOCAgA9ggIATIICAFeCAgBiggIAboICAHiCAgB/ggIAhoICAJKCAgCZggIA
pYICANCCAgD1ggIAFoMCADmDAgBSgwIAgYMCAK6DAgABhAIAJYQCAN2EAgAmhQIAPoUCAFeFAgCt
hQIAw4UCAN2FAgD+hQIAK4YCAEqGAgBehgIAdYYCAK+GAgDOhgIA8YYCAAOHAgAqhwIAPIcCAFmH
AgBwhwIAjYcCAKqHAgDchwIA9IcCAP+HAgATiAIAIogCADuIAgBPiAIAYogCAH+IAgDIiAIA44gC
AP+IAgAViQIAK4kCAEyJAgBliQIAbokCAIOJAgCiiQIAwIkCAO6JAgAgigIASYoCAHaKAgCDigIA
kYoCAK6KAgC3igIA9IoCAAuLAgBgiwIAtYsCAM2LAgDjiwIA8osCABGMAgAljAIAZIwCAJOMAgDA
jAIA4YwCAO6MAgAPjQIAKI0CADaNAgBJjQIAk40CAMeNAgDtjQIAHo4CAGyOAgCUjgIAqI4CAMCO
AgDajgIA9I4CAAmPAgAejwIAX48CAGiPAgBwjwIAlY8CALePAgDAjwIA3Y8CACGQAgBJkAIAUpAC
AGWQAgCKkAIA1ZACACCRAgB7kQIAh5ECALKRAgD9kQIAH5ICADWSAgChkgIAf5MCAJ6TAgDlkwIA
C5QCAGCUAgCTlAIAxZQCANeUAgADlQIAJZUCAEKVAgBRlQIAZpUCAJSVAgCglQIAuJUCAOOVAgAL
lgIAUJYCAJWWAgDXlgIAFpcCACiXAgBKlwIAdpcCAPeXAgBtmAIAj5gCALeYAgDlmAIAKpkCAE2Z
AgCrmQIA7pkCAP2ZAgBYmgIAxZoCAA2bAgBYmwIAiZsCALibAgDNmwIA+JsCACecAgBSnAIAtpwC
APWcAgArnQIAb50CAJudAgDEnQIA950CACOeAgBUngIAkZ4CAKaeAgC4ngIA5J4CAAafAgAvnwIA
Tp8CAHefAgCTnwIAsp8CANSfAgAGoAIAQqACAG2gAgCPoAIAnKACAKWgAgDAoAIA86ACACqhAgA9
oQIAWqECAGahAgB+oQIAnKECALahAgDBoQIA7KECABeiAgBAogIAaKICAHeiAgCAogIAoaICALGi
AgDAogIA16ICAOmiAgD8ogIAD6MCADejAgBIowIAWKMCAGmjAgB0owIAfaMCAIujAgCmowIAwKMC
ANGjAgDgowIA86MCAAOkAgAepAIATKQCAHekAgCDpAIAlKQCAKWkAgC2pAIAAaUCABylAgA0pQIA
QKUCAGClAgCApQIAjaUCAKqlAgDEpQIA06UCAOSlAgDrpQIABaYCAA+mAgAnpgIAOaYCAFGmAgBg
pgIAgqYCAKOmAgC3pgIAxqYCAM6mAgDXpgIA4KYCAPCmAgD+pgIADKcCACenAgA7pwIAbqcCAJ6n
AgCxpwIAxKcCANanAgDdpwIA+KcCAP6nAgAYqAIAIagCACqoAgAzqAIATKgCAFSoAgBkqAIAe6gC
AI+oAgChqAIAu6gCAMioAgDbqAIA66gCAPioAgACqQIAKqkCAFOpAgB/qQIAqKkCAL+pAgDLqQIA
8qkCAD2qAgBbqgIAcKoCAJKqAgCpqgIAu6oCAMeqAgD4qgIAIKsCADyrAgBIqwIAXKsCAGirAgCD
qwIAm6sCAKWrAgCuqwIAx6sCANOrAgDtqwIA/KsCAAisAgAOrAIAI6wCADKsAgBDrAIAVKwCAGas
AgB1rAIAhawCAJCsAgCerAIAqKwCALysAgDCrAIA0qwCAOisAgD3rAIAAa0CAAytAgAXrQIANK0C
AEatAgBhrQIAda0CAIitAgCYrQIApK0CALGtAgC+rQIA2K0CAPOtAgD+rQIAD64CABquAgAlrgIA
RK4CAHWuAgCYrgIAoa4CAL+uAgDZrgIA8a4CAAyvAgAhrwIAL68CAEavAgBUrwIAba8CAMGvAgDc
rwIA6a8CAAawAgAusAIAWrACAIGwAgCLsAIAxrACANqwAgD0sAIACLECABaxAgAtsQIANbECAEmx
AgBXsQIAabECAICxAgCMsQIAl7ECAKGxAgDCsQIAzLECAN6xAgDosQIA/rECAByyAgAvsgIAOrIC
AEWyAgBSsgIAY7ICAHSyAgCIsgIAorICAL2yAgDKsgIA7rICACGzAgBXswIAZLMCAHSzAgB/swIA
iLMCAJazAgCiswIArbMCALyzAgDPswIA6bMCAA20AgAttAIAUrQCAHW0AgB9tAIAhrQCAI60AgCq
tAIAv7QCAMe0AgDctAIA7rQCAPe0AgACtQIAELUCABm1AgAltQIALLUCAD+1AgBKtQIAV7UCAGW1
AgB8tQIAiLUCAJG1AgCatQIAsLUCALu1AgDJtQIA1LUCAOu1AgD2tQIAALYCABO2AgAftgIAKLYC
AFq2AgB6tgIAl7YCAKy2AgDHtgIA4rYCAOy2AgD8tgIAULcCAGe3AgBztwIAe7cCAJW3AgCltwIA
uLcCAMu3AgDptwIA+bcCAAi4AgAbuAIAJLgCAC+4AgBEuAIAU7gCAGe4AgB+uAIAjLgCAJ64AgCw
uAIAurgCAL+4AgDHuAIAzLgCAOC4AgDyuAIA/rgCAA25AgAWuQIAI7kCADq5AgBWuQIAY7kCAIe5
AgCnuQIAyLkCANy5AgDjuQIA7LkCAPu5AgAFugIAFboCACS6AgAyugIAPLoCAES6AgBMugIAa7oC
AH26AgCYugIApLoCAL66AgDOugIA4boCAPi6AgASuwIAIbsCAHW7AgB8uwIAjrsCAJW7AgCkuwIA
rLsCAL+7AgDYuwIA77sCAPW7AgD6uwIAC7wCACW8AgA4vAIASLwCAFq8AgBuvAIAhrwCAJK8AgCg
vAIAr7wCAMa8AgDSvAIA67wCAP68AgATvQIAHL0CAFa9AgBnvQIAdb0CAIS9AgC/vQIA2L0CAPe9
AgAcvgIAR74CAHK+AgCbvgIAxb4CANi+AgDgvgIA674CAPO+AgATvwIAM78CAEi/AgBYvwIAYL8C
AG+/AgCAvwIAj78CAKG/AgCuvwIAuL8CANK/AgDfvwIA678CAPu/AgADwAIAHcACADjAAgBVwAIA
XsACAH7AAgCTwAIAusACAMnAAgDWwAIA3sACAPjAAgAawQIAI8ECADHBAgA8wQIAaMECAKbBAgDE
wQIA18ECAOTBAgD4wQIABcICAB/CAgAxwgIAP8ICAFDCAgBYwgIAaMICAHjCAgCCwgIAncICAMLC
AgDlwgIA8cICAPrCAgAEwwIAGMMCAC7DAgBEwwIAUcMCAFrDAgBrwwIAcsMCAIHDAgCLwwIAosMC
AKvDAgDAwwIA2MMCACvEAgA5xAIAS8QCAFLEAgBZxAIAcMQCAJbEAgCsxAIAyMQCANvEAgD9xAIA
D8UCACfFAgAzxQIATsUCAFbFAgBnxQIAcMUCAHjFAgCIxQIAk8UCAKTFAgC1xQIAwcUCANrFAgD1
xQIACcYCABvGAgAvxgIAQcYCAEvGAgBexgIAZ8YCAI7GAgCWxgIAoMYCAKrGAgC0xgIAxcYCANXG
AgDlxgIA7sYCAPzGAgAHxwIAGMcCACDHAgAwxwIAW8cCAGLHAgBrxwIAfMcCAJHHAgClxwIArscC
AMHHAgDhxwIAAMgCAAvIAgAsyAIAPMgCAFPIAgBpyAIAfcgCAIzIAgCdyAIArcgCAMPIAgDfyAIA
8sgCAAjJAgAsyQIAQ8kCAGPJAgBwyQIAd8kCAInJAgCfyQIAsMkCALjJAgDDyQIA18kCAOjJAgAR
ygIAH8oCAFPKAgCWygIAocoCAKrKAgCzygIAxMoCANrKAgD3ygIABssCABjLAgAiywIANssCAD3L
AgBHywIAYcsCAGfLAgCCywIAncsCAM3LAgD4ywIAGswCACvMAgBEzAIAV8wCAGTMAgB1zAIAf8wC
AIrMAgCTzAIAm8wCAK7MAgC3zAIACM0CADbNAgBkzQIAkc0CAL7NAgDdzQIA8c0CAALOAgATzgIA
KM4CADjOAgBSzgIAZ84CAHjOAgCMzgIAoM4CAK3OAgC3zgIAw84CAM3OAgDXzgIA4c4CAOzOAgD5
zgIAFM8CACLPAgBLzwIAWs8CAHrPAgCkzwIAvs8CAPrPAgAQ0AIAIdACAC3QAgBB0AIAVtACAGjQ
AgCH0AIAntACAMDQAgDL0AIA2dACAOXQAgD90AIACdECACTRAgAy0QIAT9ECAGbRAgB+0QIAitEC
AJTRAgCl0QIAudECAMjRAgDq0QIA/9ECAAfSAgAX0gIAItICADPSAgBJ0gIAa9ICAIjSAgCc0gIA
sNICAMbSAgDe0gIA9dICACbTAgAz0wIARdMCAGPTAgBv0wIAhdMCAPHTAgAg1AIAQtQCAGvUAgB8
1AIAj9QCAKvUAgC+1AIA7NQCABXVAgBA1QIAatUCAHbVAgCC1QIAndUCALXVAgDH1QIA4tUCAPTV
AgD+1QIAFNYCAB3WAgA01gIAP9YCAEjWAgBV1gIAYNYCAGvWAgB21gIAhdYCAJrWAgCq1gIAttYC
AMTWAgDS1gIA4dYCAPTWAgAD1wIAEtcCACLXAgAw1wIAP9cCAE3XAgBb1wIAYtcCAHDXAgB71wIA
g9cCAI3XAgCf1wIArNcCALXXAgDR1wIA+NcCABXYAgA12AIARNgCAFLYAgBw2AIAgdgCAJrYAgCw
2AIAxtgCANPYAgDe2AIAFNkCACfZAgAw2QIAO9kCAFDZAgBZ2QIAZdkCAHPZAgCk2QIAtNkCAMTZ
AgD02QIAJtoCAFfaAgCG2gIAj9oCAJ/aAgCy2gIAvdoCAM7aAgAF2wIAIdsCACnbAgA22wIAStsC
AFHbAgBn2wIAdtsCAIrbAgCd2wIArdsCALzbAgDP2wIA39sCAOvbAgD+2wIADdwCAB/cAgBF3AIA
XdwCAG3cAgCJ3AIAoNwCAK3cAgDM3AIA3NwCAO/cAgD73AIAEN0CACrdAgAz3QIASN0CAFHdAgBb
3QIAZd0CAHDdAgCC3QIAnN0CAKXdAgDE3QIA2N0CADjeAgBP3gIAWd4CAGPeAgCY3gIApN4CAMXe
AgD63gIABt8CABDfAgAg3wIAK98CADPfAgA+3wIAVd8CAGffAgB+3wIAmN8CAMTfAgDq3wIAT+AC
AMXgAgDq4AIAKeECAHjhAgDX4QIA4+ECABDiAgAy4gIAjeICALniAgDu4gIACuMCAFTjAgBj4wIA
ieMCAKXjAgD74wIAKuQCAFPkAgCC5AIAkeQCAKrkAgDA5AIA1uQCAOXkAgD65AIAH+UCACvlAgB+
5QIAqeUCALvlAgAt5gIAVuYCAK3mAgDZ5gIABecCABvnAgBK5wIAf+cCAJHnAgCw5wIA2OcCABTo
AgB26AIApegCAMToAgDt6AIAT+kCAHXpAgCj6QIAy+kCANfpAgDq6QIAM+oCAH/qAgCV6gIAwuoC
APLqAgAi6wIANOsCAF3rAgB86wIAm+sCAMDrAgDr6wIADewCAC/sAgBq7AIAQ+0CAKbtAgD47QIA
De4CACbuAgBG7gIAZe4CAHTuAgCG7gIAqO4CAMruAgDp7gIAEe8CADfvAgBJ7wIAdO8CAIDvAgCT
7wIAn+8CAODvAgAU8AIALfACAEfwAgBl8AIAgPACAIXwAgCK8AIAl/ACAKzwAgC/8AIA3PACAEzx
AgBV8QIAbfECAILxAgCR8QIAsPECAL/xAgDK8QIA3PECAOLxAgDt8QIA+fECAAfyAgA58gIAbPIC
AKLyAgDV8gIA6/ICAAHzAgAX8wIAK/MCAEnzAgBO8wIAWvMCAGXzAgB+8wIAjPMCAJzzAgCh8wIA
rPMCALnzAgDQ8wIA2PMCAN7zAgDz8wIADPQCACX0AgBC9AIAR/QCAFn0AgBx9AIAn/QCAL70AgDU
9AIA6fQCAAn1AgAy9QIAVPUCAFz1AgBv9QIAdvUCAIz1AgCf9QIAu/UCAMb1AgDb9QIA7vUCAAf2
AgAd9gIAJvYCAEv2AgB69gIAlPYCAMH2AgDj9gIAAvcCACT3AgBG9wIATPcCAFL3AgBb9wIAffcC
AJL3AgCZ9wIAr/cCAL73AgDO9wIA2PcCAOf3AgDy9wIA+/cCAAb4AgAk+AIASPgCAGL4AgCA+AIA
i/gCAJz4AgCv+AIA0fgCAO/4AgAL+QIAJ/kCAE/5AgBl+QIAg/kCAJT5AgDk+QIAAvoCABr6AgAz
+gIAU/oCAGv6AgC++gIAFfsCADP7AgBb+wIAe/sCAIT7AgCZ+wIAqvsCAMT7AgDx+wIAGvwCADr8
AgBg/AIAfvwCAI38AgCv/AIAxfwCAO/8AgAT/QIAHP0CAC/9AgBE/QIAWf0CAH39AgCs/QIAzv0C
AAX+AgA6/gIAVv4CAID+AgC4/gIA7v4CAB7/AgA7/wIAXf8CAIb/AgCy/wIA4f8CAO7/AgAQAAMA
KgADAFAAAwBfAAMA9wADADQBAwBvAQMArwEDAO0BAwAJAgMAIAIDAE8CAwB3AgMAigIDAJ0CAwDI
AgMA2QIDAPUCAwAXAwMAMwMDAFEDAwCSAwMAyQMDANQDAwDjAwMA7gMDAAIEAwAWBAMAJAQDADoE
AwBHBAMAUAQDAGoEAwB9BAMAjQQDAKEEAwCoBAMAwAQDANIEAwDdBAMA5QQDAPcEAwALBQMAHwUD
ADUFAwA/BQMAUwUDAHQFAwB+BQMAjQUDAJcFAwCtBQMAxQUDANQFAwDlBQMA9QUDAAcGAwAfBgMA
LgYDADgGAwBDBgMAVgYDAGQGAwByBgMAfQYDAIUGAwCPBgMAqAYDANUGAwDwBgMA/gYDAAkHAwAR
BwMAIAcDACsHAwA2BwMAVgcDAHMHAwCUBwMAvQcDAOQHAwANCAMAPQgDAGMIAwCNCAMAnAgDAOkI
AwD6CAMAFQkDACkJAwA7CQMAVQkDAGsJAwB0CQMAfAkDAKoJAwDECQMA1gkDAOcJAwAoCgMAOgoD
AFIKAwBZCgMAYAoDAG4KAwCJCgMAlwoDAKAKAwCpCgMAugoDAMgKAwDSCgMA5goDAPsKAwAFCwMA
EQsDAB4LAwAqCwMAQQsDAGILAwCBCwMAjQsDAKALAwCyCwMAxgsDANgLAwAcDAMAMQwDAEsMAwBX
DAMAZgwDAG4MAwB+DAMAhwwDAKMMAwDiDAMAEw0DACkNAwA7DQMATg0DAGINAwB8DQMAhQ0DAJAN
AwCbDQMAsA0DANENAwDdDQMA8w0DAAYOAwAbDgMANg4DAF4OAwBqDgMAgg4DAKcOAwCzDgMA1g4D
AOUOAwAUDwMAQg8DAGsPAwCTDwMAtg8DANMPAwDjDwMA7Q8DAAAQAwAOEAMAKBADAD0QAwBIEAMA
WRADAF8QAwBvEAMAhxADAJoQAwCxEAMAvRADAOMQAwD2EAMADREDACQRAwBBEQMAVBEDAGcRAwCA
EQMAmREDAMgRAwDzEQMAExIDACASAwA6EgMAXRIDAHkSAwCQEgMAnxIDAKoSAwDPEgMA2xIDAPMS
AwACEwMADRMDABcTAwAoEwMARxMDAFwTAwB4EwMA0xMDAOYTAwD9EwMAFRQDADAUAwA6FAMASRQD
AFcUAwBsFAMAdxQDAIQUAwCRFAMAoRQDALcUAwDAFAMAzhQDAOgUAwAQFQMANBUDAEAVAwCHFQMA
vhUDAOEVAwDsFQMA+hUDAAwWAwAZFgMAHhYDAEAWAwBqFgMAbxYDAIEWAwCIFgMAmBYDAKIWAwCq
FgMAvhYDAM8WAwDbFgMA8hYDAAYXAwAPFwMAFhcDACUXAwAyFwMAYRcDAG8XAwB7FwMAhxcDAJMX
AwCiFwMAtxcDAMkXAwDbFwMA7RcDAP4XAwASGAMAHBgDAC4YAwA+GAMAahgDAJMYAwC5GAMA3BgD
APAYAwAAGQMADRkDABkZAwAiGQMATRkDAGIZAwB8GQMA0BkDAN4ZAwDlGQMA8BkDAP0ZAwAPGgMA
FxoDAEIaAwBMGgMAUxoDAGAaAwBsGgMAfxoDAI0aAwCcGgMAtRoDAMUaAwDRGgMA4BoDAO4aAwD2
GgMAGBsDADQbAwBOGwMAYxsDAG4bAwCLGwMAqRsDAL8bAwDTGwMA6xsDAAccAwAUHAMAIxwDADAc
AwA7HAMAVRwDAHscAwCGHAMAmBwDAKwcAwDHHAMA7BwDAAUdAwAuHQMASB0DAGIdAwBvHQMAfB0D
AJIdAwCiHQMAth0DABweAwAnHgMANB4DAF0eAwBtHgMAdh4DAIMeAwCQHgMAnR4DALkeAwDGHgMA
4B4DAP0eAwAeHwMASR8DAHQfAwB/HwMAiB8DAJMfAwCwHwMAyB8DANUfAwD6HwMAByADACMgAwBM
IAMAcSADAIUgAwCQIAMAsSADAMsgAwDWIAMAFSEDAFghAwChIQMA6CEDABciAwAiIgMAPCIDAFIi
AwBoIgMAeiIDAI8iAwCpIgMAtCIDAMEiAwDZIgMA7yIDAAcjAwAeIwMAOCMDAE4jAwBcIwMAbyMD
AIIjAwCpIwMA+SMDAEokAwBtJAMAfSQDAJskAwDFJAMA6yQDAP4kAwANJQMAHiUDACglAwBkJQMA
lyUDALIlAwDCJQMA1CUDAOElAwDxJQMAACYDAAkmAwAXJgMAKSYDADYmAwBQJgMAXCYDAGQmAwB4
JgMAhSYDAJEmAwCcJgMAuCYDANcmAwDjJgMA8SYDAP0mAwAIJwMAJCcDADEnAwA+JwMARScDAFEn
AwBZJwMAYycDAHwnAwCdJwMAuCcDAMAnAwDWJwMA7ScDAPMnAwATKAMAICgDACkoAwA5KAMATSgD
AGAoAwBzKAMAjSgDAKwoAwDUKAMA4ygDAPAoAwD4KAMADikDAC8pAwBFKQMAZikDAGwpAwB3KQMA
iSkDAJYpAwCsKQMAwCkDANMpAwD6KQMAIioDAEQqAwBqKgMAdyoDAIAqAwCJKgMAlSoDAJ4qAwDP
KgMA4yoDAP0qAwAaKwMAWCsDAG0rAwCAKwMAkysDANkrAwDwKwMA/CsDAA0sAwAbLAMAKCwDADcs
AwBFLAMAWSwDAGksAwB6LAMAiywDAMEsAwAiLQMAki0DALAtAwC9LQMA0y0DAPQtAwAXLgMAQC4D
AGkuAwCBLgMAsi4DAPQuAwA4LwMAci8DAIMvAwChLwMAvy8DAOsvAwAPMAMAMTADAEswAwB8MAMA
lDADALAwAwDIMAMA6DADAAIxAwAiMQMAQjEDAGIxAwB2MQMAjDEDALMxAwC8MQMA0jEDAN8xAwAG
MgMAGDIDAEMyAwBZMgMAjTIDAJ8yAwCuMgMA0DIDAOEyAwD9MgMADDMDACAzAwA5MwMAYzMDAIsz
AwC6MwMACzQDACk0AwBUNAMAgDQDAI80AwDaNAMAJTUDAHY1AwDHNQMA1zUDAOY1AwAGNgMAFzYD
ACs2AwBPNgMAZjYDAHo2AwCYNgMAMDcDAEw3AwBoNwMAmzcDALs3AwDONwMA6jcDAPU3AwAZOAMA
JjgDAD44AwB3OAMAnjgDALU4AwDCOAMAzzgDAOA4AwDyOAMAAjkDAB05AwBAOQMAWDkDAHE5AwCJ
OQMAozkDAL85AwDoOQMABDoDABE6AwAeOgMAKzoDAE06AwCWOgMApToDAMc6AwDpOgMA9joDABw7
AwBPOwMAWDsDAG47AwCFOwMAoDsDAM07AwBgPAMArDwDAMo8AwDXPAMA5zwDAAU9AwAuPQMAbD0D
AJc9AwDYPQMAIT4DAEE+AwBnPgMAoj4DAL4+AwDpPgMACT8DABw/AwApPwMANj8DAKc/AwDBPwMA
GEADAGRAAwCIQAMAqEADALNAAwDkQAMAD0EDAFBBAwCZQQMAwkEDAM9BAwDzQQMA/kEDABZCAwBN
QgMAa0IDAIlCAwClQgMAwUIDANRCAwAWQwMAX0MDAHlDAwDUQwMA/0MDAD1EAwBiRAMAgEQDAKBE
AwDNRAMA7UQDAAVFAwAwRQMAbEUDAKFFAwCwRQMAwUUDANBFAwDoRQMAAkYDAA1GAwAaRgMAJUYD
ADlGAwBQRgMAgkYDAL5GAwDsRgMAGUcDAOFHAwBFSAMAaUgDAIpIAwCuSAMAxkgDAPpIAwBJSQMA
c0kDAJRJAwDjSQMA70kDACNKAwBdSgMAo0oDAMdKAwA1SwMAREsDAGlLAwCBSwMAvksDACNMAwBj
TAMAjkwDAONMAwD4TAMAB00DAB9NAwBWTQMA3U0DAAFOAwAZTgMAOk4DAF5OAwCITgMAqU4DALtO
AwDWTgMA7k4DAP1OAwAPTwMAN08DAFJPAwCVTwMA5U8DAClQAwBmUAMAdVADAIpQAwDZUAMADFED
AD9RAwBpUQMAH1IDALZSAwDtUgMADlMDAC9TAwCRUwMAr1MDAPVTAwATVAMASlQDAGtUAwCAVAMA
vVQDAPBUAwAeVQMAYlUDAKxVAwDQVQMAEFYDAGlWAwDRVgMAL1cDAF1XAwCUVwMAzVcDAARYAwAx
WAMAiVgDALdYAwDoWAMAX1kDANNZAwBEWgMAUVoDAGFaAwBuWgMAeloDAI9aAwCYWgMAnVoDAKVa
AwC0WgMAv1oDAMtaAwDgWgMA71oDAAlbAwAyWwMAVlsDAINbAwCVWwMApVsDALRbAwC+WwMA1VsD
AOlbAwD3WwMAAlwDAA9cAwAjXAMAOlwDAFdcAwBhXAMAalwDAH5cAwCJXAMAm1wDAK1cAwDBXAMA
0FwDANxcAwDwXAMAEF0DACBdAwA9XQMAUV0DAF5dAwBqXQMAc10DAJddAwCsXQMAzl0DAOhdAwAe
XgMAI14DADBeAwBFXgMAUF4DAGReAwBrXgMAeF4DAIheAwCTXgMApl4DALVeAwDtXgMAA18DABRf
AwAvXwMAQF8DAFhfAwBrXwMAcV8DAHlfAwC5XwMA7F8DAPtfAwATYAMAJ2ADAEdgAwBkYAMAimAD
AJtgAwCxYAMA2mADAOtgAwAEYQMAGmEDACdhAwA1YQMAQGEDAEhhAwBjYQMAe2EDANNhAwDiYQMA
9mEDABFiAwArYgMAYWIDAJpiAwCoYgMAtWIDAMFiAwDWYgMA62IDAPpiAwAXYwMAMGMDAE1jAwBc
YwMAb2MDAINjAwCLYwMAlGMDAKdjAwCxYwMAvWMDAM9jAwDeYwMA72MDAARkAwAhZAMAOmQDAFdk
AwBxZAMAjmQDAKBkAwC4ZAMAzGQDAOxkAwD+ZAMAHmUDAD9lAwBQZQMAZmUDAIVlAwCUZQMAo2UD
ALRlAwC+ZQMA2GUDAOFlAwD5ZQMAB2YDABFmAwAlZgMAOWYDAFFmAwBnZgMAfWYDAIlmAwCQZgMA
xGYDAO5mAwAAZwMAFWcDAClnAwA6ZwMAQWcDAFJnAwBmZwMAf2cDAJBnAwCVZwMAmmcDAK1nAwC5
ZwMAymcDAORnAwDyZwMAFWgDACVoAwAwaAMAWWgDAGRoAwBsaAMAfWgDAJBoAwCYaAMApWgDAKxo
AwC5aAMAxWgDANtoAwAkaQMALGkDADVpAwBAaQMASGkDAFVpAwBgaQMAcGkDAJ5pAwCnaQMAt2kD
AMFpAwDQaQMA5GkDAPRpAwAGagMAGGoDAChqAwAyagMAPGoDAFVqAwBmagMAdmoDAH9qAwCNagMA
nmoDAA1rAwAYawMAKWsDADdrAwBGawMAXWsDAHtrAwDEawMA2msDAOhrAwD6awMACGwDAEFsAwBP
bAMAZWwDAHNsAwCGbAMAp2wDALxsAwDSbAMABm0DADZtAwBwbQMApm0DAL5tAwDHbQMA220DAA9u
AwAubgMASW4DAFhuAwBkbgMAbG4DAHhuAwCubgMAw24DANVuAwDebgMAAW8DABVvAwAebwMALm8D
AEFvAwBbbwMAgm8DAKZvAwDDbwMA3G8DAANwAwAecAMAK3ADADdwAwBKcAMAV3ADAGdwAwBxcAMA
iXADAJ9wAwC2cAMAwXADAPdwAwABcQMADXEDACZxAwBEcQMAYnEDAHtxAwCTcQMArXEDAMlxAwDp
cQMAAnIDABJyAwAdcgMALXIDADZyAwBAcgMASXIDAFhyAwBrcgMAd3IDAIRyAwCncwMA6HQDACZ2
AwCRdwMAx3gDAAl6AwBFewMAgXwDAL19AwDzfgMAJoADAFyBAwCOggMAyYMDAAOFAwBChgMAjocD
AMmIAwD/iQMAP4sDAIqMAwDRjQMAEY8DAEmQAwB+kQMAvZIDAP6TAwA6lQMAd5YDALmXAwD8mAMA
PZoDAH+bAwDQnAMADZ4DAF6fAwCaoAMA3KEDAB2jAwBfpAMAnKUDANimAwAYqAMAU6kDAIyqAwDV
qwMALa0DAH2uAwC6rwMA+bADADqyAwB4swMAs7QDAAG2AwA+twMAorgDAOO5AwAluwMAY7wDAKG9
AwDevgMAG8ADAF7BAwCgwgMAFMQDAFXFAwCbxgMA38cDACXJAwB0ygMAs8sDAAHNAwA+zgMAfc8D
ALrQAwAA0gMAP9MDAITUAwDI1QMADdcDAFHYAwCb2QMA3doDABrcAwBi3QMApt4DAPffAwA74QMA
heIDAMPjAwAJ5QMAVeYDAJXnAwDi6AMAJuoDAIvrAwDS7AMAHe4DAGLvAwCd8AMA2/EDABjzAwBb
9AMAsfUDAAj3AwBJ+AMAvfkDAAH7AwAP+wMAGvsDACb7AwA4+wMAVPsDAGv7AwB0+wMAg/sDAIz7
AwCV+wMArfsDAMv7AwDp+wMA8vsDAAT8AwAQ/AMAH/wDADr8AwBG/AMAVfwDAF78AwBq/AMAgvwD
AJf8AwCz/AMAwvwDANT8AwDj/AMA8vwDAAH9AwAK/QMAE/0DABz9AwAr/QMANP0DAED9AwBP/QMA
Vf0DAF79AwB2/QMAkv0DAMT9AwDT/QMA3P0DAPH9AwAA/gMAOf4DAEj+AwBO/gMAZP4DAH/+AwCa
/gMAuP4DANb+AwDi/gMA8f4DAAD/AwAP/wMAGP8DACf/AwA8/wMAUf8DAGn/AwB4/wMAlv8DAKL/
AwC6/wMAyf8DANj/AwDn/wMA/P8DAAsABAARAAQAIwAEAC8ABAA1AAQAPgAEAE0ABABWAAQAbgAE
AIYABACVAAQAowAEALEABAC8AAQAyQAEANUABADeAAQA5wAEAPYABAASAQQAIAEEACkBBABBAQQA
SgEEAF8BBABxAQQAiQEEAJgBBACwAQQAyQEEAO0BBAALAgQAGgIEACMCBAAvAgQAPgIEAFYCBABi
AgQAbgIEAHoCBACGAgQAkgIEAKoCBACzAgQAvAIEAMsCBADdAgQA9gIEAP8CBAAOAwQAFwMEACAD
BAAvAwQAOAMEAEEDBABNAwQAXAMEAGUDBAB9AwQAgwMEAIwDBACxAwQA3gMEAOQDBADzAwQAAgQE
AA4EBAAXBAQAJgQEADIEBABHBAQAVgQEAGUEBACeBAQAtgQEAM4EBADsBAQACgUEAB4FBAAqBQQA
OQUEAEgFBABXBQQAZgUEAHUFBACEBQQAkwUEAKgFBAC6BQQAzAUEANsFBADqBQQA+QUEAA8GBAAt
BgQAOQYEAEsGBABjBgQAcgYEAIEGBACQBgQAnwYEAK4GBAC3BgQAvwYEAP0GBAArBwQANQcEAD4H
BABXBwQAgwcEAK4HBADCBwQAzAcEANYHBADqBwQAAQgEABQIBAAcCAQALwgEAEUIBABSCAQAaQgE
AHYIBACICAQAmwgEALcIBADKCAQA3ggEAOsIBAD2CAQAQAkEAEcJBABTCQQAcAkEAH8JBACTCQQA
nQkEALoJBADMCQQA5gkEAAkKBAAcCgQAIwoEACoKBAA7CgQAUgoEAGIKBAB0CgQAhAoEAJoKBACq
CgQAuQoEANYKBADzCgQAFAsEACgLBABFCwQATwsEAGILBAB9CwQAkgsEAJ0LBACwCwQAvAsEAMsL
BADWCwQA4AsEAAsMBAA3DAQAYgwEAI4MBACcDAQArgwEAMEMBADVDAQA6gwEAP0MBAAUDQQALg0E
AEYNBABaDQQAew0EAIYNBACQDQQAoA0EAK0NBAC8DQQAzw0EANkNBADrDQQA9A0EAAAOBAAMDgQA
IA4EACoOBABKDgQAZA4EAH8OBACqDgQA0A4EAPEOBAD/DgQACA8EABgPBAArDwQANg8EAFIPBABf
DwQAeQ8EAIYPBACSDwQArw8EAAIQBAApEAQAUBAEAHoQBACkEAQArxAEAMAQBADLEAQA2RAEAO4Q
BAAAEQQADBEEACgRBAAwEQQASREEAFsRBABtEQQAhREEAKARBAC1EQQA1hEEAOsRBAD3EQQA/REE
AAwSBAAeEgQANBIEAHQSBACpEgQAsRIEAMQSBADXEgQA5RIEAPwSBAAFEwQAHBMEACwTBAAzEwQA
VBMEAGsTBACCEwQAjBMEAJETBACcEwQApxMEALMTBADZEwQA8hMEAAEUBAAVFAQAKhQEAD0UBABX
FAQAcRQEAIwUBACeFAQAvBQEAMIUBADWFAQA4hQEAPwUBAADFQQADBUEABYVBAAeFQQAJRUEADAV
BAA+FQQAchUEAJYVBACpFQQAtxUEAPAVBAADFgQAHBYEAH8WBACxFgQA5BYEABYXBABIFwQAUxcE
AH0XBACQFwQArhcEAL0XBADKFwQA1BcEAPEXBAALGAQAIBgEADAYBABEGAQATBgEAIIYBACyGAQA
zxgEAO4YBAACGQQAHBkEACwZBABFGQQAYhkEAG0ZBAB3GQQAlhkEAKsZBAC3GQQAwxkEAM8ZBADe
GQQA6xkEAPoZBAAJGgQAGhoEACMaBAA6GgQAVRoEAGUaBABzGgQAixoEAJkaBACkGgQAvBoEAMga
BADiGgQA6RoEABYbBAAvGwQAXxsEAGkbBAB0GwQAfhsEAJUbBACcGwQAqhsEALsbBADGGwQA1BsE
AOMbBAD4GwQADhwEABkcBAAjHAQAKhwEADgcBABDHAQAUxwEAG4cBAB+HAQAjRwEAJ0cBAC1HAQA
wxwEANUcBADcHAQA6xwEAPEcBAD2HAQA/BwEAAEdBAARHQQAJB0EADQdBABAHQQATh0EAGsdBACK
HQQApx0EAMcdBADrHQQA+h0EAAYeBAAQHgQAJh4EADQeBABDHgQAUR4EAGIeBABtHgQAfR4EAIoe
BACaHgQAqR4EALYeBADFHgQA2R4EABwfBAAlHwQARR8EAGIfBAB+HwQAhh8EAJAfBACfHwQAtR8E
AMAfBADOHwQA2x8EAOUfBADxHwQAACAEAA8gBAAbIAQAJyAEADMgBAA/IAQASyAEAGwgBACNIAQA
sSAEANUgBADnIAQA+SAEAA4hBAAaIQQAUyEEAGIhBABuIQQAfSEEAIwhBACgIQQArCEEALUhBADK
IQQA3CEEAPUhBAAEIgQAFiIEACsiBABAIgQADAxCb3R0b20gU2hlZXQADg5NeSBBcHBsaWNhdGlv
bgAQEGFuZHJvaWR4LnN0YXJ0dXAAMDByZXMvYW5pbS12MjEvZnJhZ21lbnRfZmFzdF9vdXRfZXh0
cmFfc2xvd19pbi54bWwAGBhyZXMvYW5pbS9hYmNfZmFkZV9pbi54bWwAGRlyZXMvYW5pbS9hYmNf
ZmFkZV9vdXQueG1sACkpcmVzL2FuaW0vYWJjX2dyb3dfZmFkZV9pbl9mcm9tX2JvdHRvbS54bWwA
HBxyZXMvYW5pbS9hYmNfcG9wdXBfZW50ZXIueG1sABsbcmVzL2FuaW0vYWJjX3BvcHVwX2V4aXQu
eG1sACwscmVzL2FuaW0vYWJjX3Nocmlua19mYWRlX291dF9mcm9tX2JvdHRvbS54bWwAICByZXMv
YW5pbS9hYmNfc2xpZGVfaW5fYm90dG9tLnhtbAAdHXJlcy9hbmltL2FiY19zbGlkZV9pbl90b3Au
eG1sACEhcmVzL2FuaW0vYWJjX3NsaWRlX291dF9ib3R0b20ueG1sAB4ecmVzL2FuaW0vYWJjX3Ns
aWRlX291dF90b3AueG1sAB4ecmVzL2FuaW0vYWJjX3Rvb2x0aXBfZW50ZXIueG1sAB0dcmVzL2Fu
aW0vYWJjX3Rvb2x0aXBfZXhpdC54bWwAPz9yZXMvYW5pbS9idG5fY2hlY2tib3hfdG9fY2hlY2tl
ZF9ib3hfaW5uZXJfbWVyZ2VkX2FuaW1hdGlvbi54bWwAPz9yZXMvYW5pbS9idG5fY2hlY2tib3hf
dG9fY2hlY2tlZF9ib3hfb3V0ZXJfbWVyZ2VkX2FuaW1hdGlvbi54bWwAODhyZXMvYW5pbS9idG5f
Y2hlY2tib3hfdG9fY2hlY2tlZF9pY29uX251bGxfYW5pbWF0aW9uLnhtbABBQXJlcy9hbmltL2J0
bl9jaGVja2JveF90b191bmNoZWNrZWRfYm94X2lubmVyX21lcmdlZF9hbmltYXRpb24ueG1sAEJC
cmVzL2FuaW0vYnRuX2NoZWNrYm94X3RvX3VuY2hlY2tlZF9jaGVja19wYXRoX21lcmdlZF9hbmlt
YXRpb24ueG1sADo6cmVzL2FuaW0vYnRuX2NoZWNrYm94X3RvX3VuY2hlY2tlZF9pY29uX251bGxf
YW5pbWF0aW9uLnhtbAA2NnJlcy9hbmltL2J0bl9yYWRpb190b19vZmZfbXRybF9kb3RfZ3JvdXBf
YW5pbWF0aW9uLnhtbAA3N3Jlcy9hbmltL2J0bl9yYWRpb190b19vZmZfbXRybF9yaW5nX291dGVy
X2FuaW1hdGlvbi54bWwAPDxyZXMvYW5pbS9idG5fcmFkaW9fdG9fb2ZmX210cmxfcmluZ19vdXRl
cl9wYXRoX2FuaW1hdGlvbi54bWwANTVyZXMvYW5pbS9idG5fcmFkaW9fdG9fb25fbXRybF9kb3Rf
Z3JvdXBfYW5pbWF0aW9uLnhtbAA2NnJlcy9hbmltL2J0bl9yYWRpb190b19vbl9tdHJsX3Jpbmdf
b3V0ZXJfYW5pbWF0aW9uLnhtbAA7O3Jlcy9hbmltL2J0bl9yYWRpb190b19vbl9tdHJsX3Jpbmdf
b3V0ZXJfcGF0aF9hbmltYXRpb24ueG1sACUlcmVzL2FuaW1hdG9yL2ZyYWdtZW50X2Nsb3NlX2Vu
dGVyLnhtbAAkJHJlcy9hbmltYXRvci9mcmFnbWVudF9jbG9zZV9leGl0LnhtbAAkJHJlcy9hbmlt
YXRvci9mcmFnbWVudF9mYWRlX2VudGVyLnhtbAAjI3Jlcy9hbmltYXRvci9mcmFnbWVudF9mYWRl
X2V4aXQueG1sACQkcmVzL2FuaW1hdG9yL2ZyYWdtZW50X29wZW5fZW50ZXIueG1sACMjcmVzL2Fu
aW1hdG9yL2ZyYWdtZW50X29wZW5fZXhpdC54bWwAOjpyZXMvY29sb3ItdjIzL2FiY19idG5fY29s
b3JlZF9ib3JkZXJsZXNzX3RleHRfbWF0ZXJpYWwueG1sAC8vcmVzL2NvbG9yLXYyMy9hYmNfYnRu
X2NvbG9yZWRfdGV4dF9tYXRlcmlhbC54bWwALi5yZXMvY29sb3ItdjIzL2FiY19jb2xvcl9oaWdo
bGlnaHRfbWF0ZXJpYWwueG1sACgocmVzL2NvbG9yLXYyMy9hYmNfdGludF9idG5fY2hlY2thYmxl
LnhtbAAiInJlcy9jb2xvci12MjMvYWJjX3RpbnRfZGVmYXVsdC54bWwAIyNyZXMvY29sb3ItdjIz
L2FiY190aW50X2VkaXR0ZXh0LnhtbAAlJXJlcy9jb2xvci12MjMvYWJjX3RpbnRfc2Vla190aHVt
Yi54bWwAIiJyZXMvY29sb3ItdjIzL2FiY190aW50X3NwaW5uZXIueG1sACcncmVzL2NvbG9yLXYy
My9hYmNfdGludF9zd2l0Y2hfdHJhY2sueG1sAD4+cmVzL2NvbG9yL2FiY19iYWNrZ3JvdW5kX2Nh
Y2hlX2hpbnRfc2VsZWN0b3JfbWF0ZXJpYWxfZGFyay54bWwAPz9yZXMvY29sb3IvYWJjX2JhY2tn
cm91bmRfY2FjaGVfaGludF9zZWxlY3Rvcl9tYXRlcmlhbF9saWdodC54bWwALy9yZXMvY29sb3Iv
YWJjX2hpbnRfZm9yZWdyb3VuZF9tYXRlcmlhbF9kYXJrLnhtbAAwMHJlcy9jb2xvci9hYmNfaGlu
dF9mb3JlZ3JvdW5kX21hdGVyaWFsX2xpZ2h0LnhtbAA5OXJlcy9jb2xvci9hYmNfcHJpbWFyeV90
ZXh0X2Rpc2FibGVfb25seV9tYXRlcmlhbF9kYXJrLnhtbAA6OnJlcy9jb2xvci9hYmNfcHJpbWFy
eV90ZXh0X2Rpc2FibGVfb25seV9tYXRlcmlhbF9saWdodC54bWwALCxyZXMvY29sb3IvYWJjX3By
aW1hcnlfdGV4dF9tYXRlcmlhbF9kYXJrLnhtbAAtLXJlcy9jb2xvci9hYmNfcHJpbWFyeV90ZXh0
X21hdGVyaWFsX2xpZ2h0LnhtbAAhIXJlcy9jb2xvci9hYmNfc2VhcmNoX3VybF90ZXh0LnhtbAAu
LnJlcy9jb2xvci9hYmNfc2Vjb25kYXJ5X3RleHRfbWF0ZXJpYWxfZGFyay54bWwALy9yZXMvY29s
b3IvYWJjX3NlY29uZGFyeV90ZXh0X21hdGVyaWFsX2xpZ2h0LnhtbAAoKHJlcy9jb2xvci9zd2l0
Y2hfdGh1bWJfbWF0ZXJpYWxfZGFyay54bWwAKSlyZXMvY29sb3Ivc3dpdGNoX3RodW1iX21hdGVy
aWFsX2xpZ2h0LnhtbAAfH3Jlcy9jb2xvci92ZWN0b3JfdGludF9jb2xvci54bWwAJSVyZXMvY29s
b3IvdmVjdG9yX3RpbnRfdGhlbWVfY29sb3IueG1sACoqcmVzL2RyYXdhYmxlLWFueWRwaS12MjEv
aWNfY2FsbF9hbnN3ZXIueG1sAC4ucmVzL2RyYXdhYmxlLWFueWRwaS12MjEvaWNfY2FsbF9hbnN3
ZXJfbG93LnhtbAAwMHJlcy9kcmF3YWJsZS1hbnlkcGktdjIxL2ljX2NhbGxfYW5zd2VyX3ZpZGVv
LnhtbAA0NHJlcy9kcmF3YWJsZS1hbnlkcGktdjIxL2ljX2NhbGxfYW5zd2VyX3ZpZGVvX2xvdy54
bWwAKytyZXMvZHJhd2FibGUtYW55ZHBpLXYyMS9pY19jYWxsX2RlY2xpbmUueG1sAC8vcmVzL2Ry
YXdhYmxlLWFueWRwaS12MjEvaWNfY2FsbF9kZWNsaW5lX2xvdy54bWwANzdyZXMvZHJhd2FibGUt
aGRwaS12NC9hYmNfYWJfc2hhcmVfcGFja19tdHJsX2FscGhhLjkucG5nADU1cmVzL2RyYXdhYmxl
LWhkcGktdjQvYWJjX2J0bl9jaGVja190b19vbl9tdHJsXzAwMC5wbmcANTVyZXMvZHJhd2FibGUt
aGRwaS12NC9hYmNfYnRuX2NoZWNrX3RvX29uX210cmxfMDE1LnBuZwA1NXJlcy9kcmF3YWJsZS1o
ZHBpLXY0L2FiY19idG5fcmFkaW9fdG9fb25fbXRybF8wMDAucG5nADU1cmVzL2RyYXdhYmxlLWhk
cGktdjQvYWJjX2J0bl9yYWRpb190b19vbl9tdHJsXzAxNS5wbmcAOjpyZXMvZHJhd2FibGUtaGRw
aS12NC9hYmNfYnRuX3N3aXRjaF90b19vbl9tdHJsXzAwMDAxLjkucG5nADo6cmVzL2RyYXdhYmxl
LWhkcGktdjQvYWJjX2J0bl9zd2l0Y2hfdG9fb25fbXRybF8wMDAxMi45LnBuZwA8PHJlcy9kcmF3
YWJsZS1oZHBpLXY0L2FiY19jYWJfYmFja2dyb3VuZF90b3BfbXRybF9hbHBoYS45LnBuZwA8PHJl
cy9kcmF3YWJsZS1oZHBpLXY0L2FiY19pY19jb21taXRfc2VhcmNoX2FwaV9tdHJsX2FscGhhLnBu
ZwA2NnJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19saXN0X2RpdmlkZXJfbXRybF9hbHBoYS45LnBu
ZwAwMHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19saXN0X2ZvY3VzZWRfaG9sby45LnBuZwA0NHJl
cy9kcmF3YWJsZS1oZHBpLXY0L2FiY19saXN0X2xvbmdwcmVzc2VkX2hvbG8uOS5wbmcANTVyZXMv
ZHJhd2FibGUtaGRwaS12NC9hYmNfbGlzdF9wcmVzc2VkX2hvbG9fZGFyay45LnBuZwA2NnJlcy9k
cmF3YWJsZS1oZHBpLXY0L2FiY19saXN0X3ByZXNzZWRfaG9sb19saWdodC45LnBuZwA/P3Jlcy9k
cmF3YWJsZS1oZHBpLXY0L2FiY19saXN0X3NlbGVjdG9yX2Rpc2FibGVkX2hvbG9fZGFyay45LnBu
ZwBAQHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19saXN0X3NlbGVjdG9yX2Rpc2FibGVkX2hvbG9f
bGlnaHQuOS5wbmcAOztyZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfbWVudV9oYXJka2V5X3BhbmVs
X210cmxfbXVsdC45LnBuZwA5OXJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19wb3B1cF9iYWNrZ3Jv
dW5kX210cmxfbXVsdC45LnBuZwA8PHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19zY3J1YmJlcl9j
b250cm9sX29mZl9tdHJsX2FscGhhLnBuZwBBQXJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY19zY3J1
YmJlcl9jb250cm9sX3RvX3ByZXNzZWRfbXRybF8wMDAucG5nAEFBcmVzL2RyYXdhYmxlLWhkcGkt
djQvYWJjX3NjcnViYmVyX2NvbnRyb2xfdG9fcHJlc3NlZF9tdHJsXzAwNS5wbmcAOjpyZXMvZHJh
d2FibGUtaGRwaS12NC9hYmNfc2NydWJiZXJfcHJpbWFyeV9tdHJsX2FscGhhLjkucG5nADg4cmVz
L2RyYXdhYmxlLWhkcGktdjQvYWJjX3NjcnViYmVyX3RyYWNrX210cmxfYWxwaGEuOS5wbmcANDRy
ZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfc3Bpbm5lcl9tdHJsX2FtX2FscGhhLjkucG5nADY2cmVz
L2RyYXdhYmxlLWhkcGktdjQvYWJjX3N3aXRjaF90cmFja19tdHJsX2FscGhhLjkucG5nADc3cmVz
L2RyYXdhYmxlLWhkcGktdjQvYWJjX3RhYl9pbmRpY2F0b3JfbXRybF9hbHBoYS45LnBuZwA5OXJl
cy9kcmF3YWJsZS1oZHBpLXY0L2FiY190ZXh0X3NlbGVjdF9oYW5kbGVfbGVmdF9tdHJsLnBuZwA7
O3Jlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY190ZXh0X3NlbGVjdF9oYW5kbGVfbWlkZGxlX210cmwu
cG5nADo6cmVzL2RyYXdhYmxlLWhkcGktdjQvYWJjX3RleHRfc2VsZWN0X2hhbmRsZV9yaWdodF9t
dHJsLnBuZwA9PXJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY190ZXh0ZmllbGRfYWN0aXZhdGVkX210
cmxfYWxwaGEuOS5wbmcAOztyZXMvZHJhd2FibGUtaGRwaS12NC9hYmNfdGV4dGZpZWxkX2RlZmF1
bHRfbXRybF9hbHBoYS45LnBuZwBERHJlcy9kcmF3YWJsZS1oZHBpLXY0L2FiY190ZXh0ZmllbGRf
c2VhcmNoX2FjdGl2YXRlZF9tdHJsX2FscGhhLjkucG5nAEJCcmVzL2RyYXdhYmxlLWhkcGktdjQv
YWJjX3RleHRmaWVsZF9zZWFyY2hfZGVmYXVsdF9tdHJsX2FscGhhLjkucG5nACcncmVzL2RyYXdh
YmxlLWhkcGktdjQvaWNfY2FsbF9hbnN3ZXIucG5nACsrcmVzL2RyYXdhYmxlLWhkcGktdjQvaWNf
Y2FsbF9hbnN3ZXJfbG93LnBuZwAtLXJlcy9kcmF3YWJsZS1oZHBpLXY0L2ljX2NhbGxfYW5zd2Vy
X3ZpZGVvLnBuZwAxMXJlcy9kcmF3YWJsZS1oZHBpLXY0L2ljX2NhbGxfYW5zd2VyX3ZpZGVvX2xv
dy5wbmcAKChyZXMvZHJhd2FibGUtaGRwaS12NC9pY19jYWxsX2RlY2xpbmUucG5nACwscmVzL2Ry
YXdhYmxlLWhkcGktdjQvaWNfY2FsbF9kZWNsaW5lX2xvdy5wbmcANTVyZXMvZHJhd2FibGUtaGRw
aS12NC9ub3RpZmljYXRpb25fYmdfbG93X25vcm1hbC45LnBuZwA2NnJlcy9kcmF3YWJsZS1oZHBp
LXY0L25vdGlmaWNhdGlvbl9iZ19sb3dfcHJlc3NlZC45LnBuZwAxMXJlcy9kcmF3YWJsZS1oZHBp
LXY0L25vdGlmaWNhdGlvbl9iZ19ub3JtYWwuOS5wbmcAOTlyZXMvZHJhd2FibGUtaGRwaS12NC9u
b3RpZmljYXRpb25fYmdfbm9ybWFsX3ByZXNzZWQuOS5wbmcAOjpyZXMvZHJhd2FibGUtaGRwaS12
NC9ub3RpZnlfcGFuZWxfbm90aWZpY2F0aW9uX2ljb25fYmcucG5nACcncmVzL2RyYXdhYmxlLWxk
cGktdjQvaWNfY2FsbF9hbnN3ZXIucG5nACsrcmVzL2RyYXdhYmxlLWxkcGktdjQvaWNfY2FsbF9h
bnN3ZXJfbG93LnBuZwAtLXJlcy9kcmF3YWJsZS1sZHBpLXY0L2ljX2NhbGxfYW5zd2VyX3ZpZGVv
LnBuZwAxMXJlcy9kcmF3YWJsZS1sZHBpLXY0L2ljX2NhbGxfYW5zd2VyX3ZpZGVvX2xvdy5wbmcA
KChyZXMvZHJhd2FibGUtbGRwaS12NC9pY19jYWxsX2RlY2xpbmUucG5nACwscmVzL2RyYXdhYmxl
LWxkcGktdjQvaWNfY2FsbF9kZWNsaW5lX2xvdy5wbmcAOztyZXMvZHJhd2FibGUtbGRydGwtaGRw
aS12MTcvYWJjX3NwaW5uZXJfbXRybF9hbV9hbHBoYS45LnBuZwA7O3Jlcy9kcmF3YWJsZS1sZHJ0
bC1tZHBpLXYxNy9hYmNfc3Bpbm5lcl9tdHJsX2FtX2FscGhhLjkucG5nADw8cmVzL2RyYXdhYmxl
LWxkcnRsLXhoZHBpLXYxNy9hYmNfc3Bpbm5lcl9tdHJsX2FtX2FscGhhLjkucG5nAD09cmVzL2Ry
YXdhYmxlLWxkcnRsLXh4aGRwaS12MTcvYWJjX3NwaW5uZXJfbXRybF9hbV9hbHBoYS45LnBuZwA+
PnJlcy9kcmF3YWJsZS1sZHJ0bC14eHhoZHBpLXYxNy9hYmNfc3Bpbm5lcl9tdHJsX2FtX2FscGhh
LjkucG5nADc3cmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX2FiX3NoYXJlX3BhY2tfbXRybF9hbHBo
YS45LnBuZwA1NXJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19idG5fY2hlY2tfdG9fb25fbXRybF8w
MDAucG5nADU1cmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX2J0bl9jaGVja190b19vbl9tdHJsXzAx
NS5wbmcANTVyZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfYnRuX3JhZGlvX3RvX29uX210cmxfMDAw
LnBuZwA1NXJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19idG5fcmFkaW9fdG9fb25fbXRybF8wMTUu
cG5nADo6cmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX2J0bl9zd2l0Y2hfdG9fb25fbXRybF8wMDAw
MS45LnBuZwA6OnJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19idG5fc3dpdGNoX3RvX29uX210cmxf
MDAwMTIuOS5wbmcAPDxyZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfY2FiX2JhY2tncm91bmRfdG9w
X210cmxfYWxwaGEuOS5wbmcAPDxyZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfaWNfY29tbWl0X3Nl
YXJjaF9hcGlfbXRybF9hbHBoYS5wbmcANjZyZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfbGlzdF9k
aXZpZGVyX210cmxfYWxwaGEuOS5wbmcAMDByZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfbGlzdF9m
b2N1c2VkX2hvbG8uOS5wbmcANDRyZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfbGlzdF9sb25ncHJl
c3NlZF9ob2xvLjkucG5nADU1cmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX2xpc3RfcHJlc3NlZF9o
b2xvX2RhcmsuOS5wbmcANjZyZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfbGlzdF9wcmVzc2VkX2hv
bG9fbGlnaHQuOS5wbmcAPz9yZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfbGlzdF9zZWxlY3Rvcl9k
aXNhYmxlZF9ob2xvX2RhcmsuOS5wbmcAQEByZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfbGlzdF9z
ZWxlY3Rvcl9kaXNhYmxlZF9ob2xvX2xpZ2h0LjkucG5nADs7cmVzL2RyYXdhYmxlLW1kcGktdjQv
YWJjX21lbnVfaGFyZGtleV9wYW5lbF9tdHJsX211bHQuOS5wbmcAOTlyZXMvZHJhd2FibGUtbWRw
aS12NC9hYmNfcG9wdXBfYmFja2dyb3VuZF9tdHJsX211bHQuOS5wbmcAPDxyZXMvZHJhd2FibGUt
bWRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF9vZmZfbXRybF9hbHBoYS5wbmcAQUFyZXMvZHJh
d2FibGUtbWRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF90b19wcmVzc2VkX210cmxfMDAwLnBu
ZwBBQXJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19zY3J1YmJlcl9jb250cm9sX3RvX3ByZXNzZWRf
bXRybF8wMDUucG5nADo6cmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX3NjcnViYmVyX3ByaW1hcnlf
bXRybF9hbHBoYS45LnBuZwA4OHJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19zY3J1YmJlcl90cmFj
a19tdHJsX2FscGhhLjkucG5nADQ0cmVzL2RyYXdhYmxlLW1kcGktdjQvYWJjX3NwaW5uZXJfbXRy
bF9hbV9hbHBoYS45LnBuZwA2NnJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY19zd2l0Y2hfdHJhY2tf
bXRybF9hbHBoYS45LnBuZwA3N3Jlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY190YWJfaW5kaWNhdG9y
X210cmxfYWxwaGEuOS5wbmcAOTlyZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfdGV4dF9zZWxlY3Rf
aGFuZGxlX2xlZnRfbXRybC5wbmcAOztyZXMvZHJhd2FibGUtbWRwaS12NC9hYmNfdGV4dF9zZWxl
Y3RfaGFuZGxlX21pZGRsZV9tdHJsLnBuZwA6OnJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY190ZXh0
X3NlbGVjdF9oYW5kbGVfcmlnaHRfbXRybC5wbmcAPT1yZXMvZHJhd2FibGUtbWRwaS12NC9hYmNf
dGV4dGZpZWxkX2FjdGl2YXRlZF9tdHJsX2FscGhhLjkucG5nADs7cmVzL2RyYXdhYmxlLW1kcGkt
djQvYWJjX3RleHRmaWVsZF9kZWZhdWx0X210cmxfYWxwaGEuOS5wbmcARERyZXMvZHJhd2FibGUt
bWRwaS12NC9hYmNfdGV4dGZpZWxkX3NlYXJjaF9hY3RpdmF0ZWRfbXRybF9hbHBoYS45LnBuZwBC
QnJlcy9kcmF3YWJsZS1tZHBpLXY0L2FiY190ZXh0ZmllbGRfc2VhcmNoX2RlZmF1bHRfbXRybF9h
bHBoYS45LnBuZwAnJ3Jlcy9kcmF3YWJsZS1tZHBpLXY0L2ljX2NhbGxfYW5zd2VyLnBuZwArK3Jl
cy9kcmF3YWJsZS1tZHBpLXY0L2ljX2NhbGxfYW5zd2VyX2xvdy5wbmcALS1yZXMvZHJhd2FibGUt
bWRwaS12NC9pY19jYWxsX2Fuc3dlcl92aWRlby5wbmcAMTFyZXMvZHJhd2FibGUtbWRwaS12NC9p
Y19jYWxsX2Fuc3dlcl92aWRlb19sb3cucG5nACgocmVzL2RyYXdhYmxlLW1kcGktdjQvaWNfY2Fs
bF9kZWNsaW5lLnBuZwAsLHJlcy9kcmF3YWJsZS1tZHBpLXY0L2ljX2NhbGxfZGVjbGluZV9sb3cu
cG5nADU1cmVzL2RyYXdhYmxlLW1kcGktdjQvbm90aWZpY2F0aW9uX2JnX2xvd19ub3JtYWwuOS5w
bmcANjZyZXMvZHJhd2FibGUtbWRwaS12NC9ub3RpZmljYXRpb25fYmdfbG93X3ByZXNzZWQuOS5w
bmcAMTFyZXMvZHJhd2FibGUtbWRwaS12NC9ub3RpZmljYXRpb25fYmdfbm9ybWFsLjkucG5nADk5
cmVzL2RyYXdhYmxlLW1kcGktdjQvbm90aWZpY2F0aW9uX2JnX25vcm1hbF9wcmVzc2VkLjkucG5n
ADo6cmVzL2RyYXdhYmxlLW1kcGktdjQvbm90aWZ5X3BhbmVsX25vdGlmaWNhdGlvbl9pY29uX2Jn
LnBuZwA8PHJlcy9kcmF3YWJsZS12MjEvYWJjX2FjdGlvbl9iYXJfaXRlbV9iYWNrZ3JvdW5kX21h
dGVyaWFsLnhtbAAtLXJlcy9kcmF3YWJsZS12MjEvYWJjX2J0bl9jb2xvcmVkX21hdGVyaWFsLnht
bAAzM3Jlcy9kcmF3YWJsZS12MjEvYWJjX2RpYWxvZ19tYXRlcmlhbF9iYWNrZ3JvdW5kLnhtbAAr
K3Jlcy9kcmF3YWJsZS12MjEvYWJjX2VkaXRfdGV4dF9tYXRlcmlhbC54bWwALi5yZXMvZHJhd2Fi
bGUtdjIxL2FiY19saXN0X2RpdmlkZXJfbWF0ZXJpYWwueG1sADMzcmVzL2RyYXdhYmxlLXYyMS9u
b3RpZmljYXRpb25fYWN0aW9uX2JhY2tncm91bmQueG1sADQ0cmVzL2RyYXdhYmxlLXYyMy9hYmNf
Y29udHJvbF9iYWNrZ3JvdW5kX21hdGVyaWFsLnhtbAA5OXJlcy9kcmF3YWJsZS13YXRjaC12MjAv
YWJjX2RpYWxvZ19tYXRlcmlhbF9iYWNrZ3JvdW5kLnhtbAA4OHJlcy9kcmF3YWJsZS14aGRwaS12
NC9hYmNfYWJfc2hhcmVfcGFja19tdHJsX2FscGhhLjkucG5nADY2cmVzL2RyYXdhYmxlLXhoZHBp
LXY0L2FiY19idG5fY2hlY2tfdG9fb25fbXRybF8wMDAucG5nADY2cmVzL2RyYXdhYmxlLXhoZHBp
LXY0L2FiY19idG5fY2hlY2tfdG9fb25fbXRybF8wMTUucG5nADY2cmVzL2RyYXdhYmxlLXhoZHBp
LXY0L2FiY19idG5fcmFkaW9fdG9fb25fbXRybF8wMDAucG5nADY2cmVzL2RyYXdhYmxlLXhoZHBp
LXY0L2FiY19idG5fcmFkaW9fdG9fb25fbXRybF8wMTUucG5nADs7cmVzL2RyYXdhYmxlLXhoZHBp
LXY0L2FiY19idG5fc3dpdGNoX3RvX29uX210cmxfMDAwMDEuOS5wbmcAOztyZXMvZHJhd2FibGUt
eGhkcGktdjQvYWJjX2J0bl9zd2l0Y2hfdG9fb25fbXRybF8wMDAxMi45LnBuZwA9PXJlcy9kcmF3
YWJsZS14aGRwaS12NC9hYmNfY2FiX2JhY2tncm91bmRfdG9wX210cmxfYWxwaGEuOS5wbmcAPT1y
ZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX2ljX2NvbW1pdF9zZWFyY2hfYXBpX210cmxfYWxwaGEu
cG5nADc3cmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY19saXN0X2RpdmlkZXJfbXRybF9hbHBoYS45
LnBuZwAxMXJlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfbGlzdF9mb2N1c2VkX2hvbG8uOS5wbmcA
NTVyZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX2xpc3RfbG9uZ3ByZXNzZWRfaG9sby45LnBuZwA2
NnJlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfbGlzdF9wcmVzc2VkX2hvbG9fZGFyay45LnBuZwA3
N3Jlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfbGlzdF9wcmVzc2VkX2hvbG9fbGlnaHQuOS5wbmcA
QEByZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX2xpc3Rfc2VsZWN0b3JfZGlzYWJsZWRfaG9sb19k
YXJrLjkucG5nAEFBcmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY19saXN0X3NlbGVjdG9yX2Rpc2Fi
bGVkX2hvbG9fbGlnaHQuOS5wbmcAPDxyZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX21lbnVfaGFy
ZGtleV9wYW5lbF9tdHJsX211bHQuOS5wbmcAOjpyZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX3Bv
cHVwX2JhY2tncm91bmRfbXRybF9tdWx0LjkucG5nAD09cmVzL2RyYXdhYmxlLXhoZHBpLXY0L2Fi
Y19zY3J1YmJlcl9jb250cm9sX29mZl9tdHJsX2FscGhhLnBuZwBCQnJlcy9kcmF3YWJsZS14aGRw
aS12NC9hYmNfc2NydWJiZXJfY29udHJvbF90b19wcmVzc2VkX210cmxfMDAwLnBuZwBCQnJlcy9k
cmF3YWJsZS14aGRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF90b19wcmVzc2VkX210cmxfMDA1
LnBuZwA7O3Jlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfc2NydWJiZXJfcHJpbWFyeV9tdHJsX2Fs
cGhhLjkucG5nADk5cmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY19zY3J1YmJlcl90cmFja19tdHJs
X2FscGhhLjkucG5nADU1cmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY19zcGlubmVyX210cmxfYW1f
YWxwaGEuOS5wbmcANzdyZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX3N3aXRjaF90cmFja19tdHJs
X2FscGhhLjkucG5nADg4cmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY190YWJfaW5kaWNhdG9yX210
cmxfYWxwaGEuOS5wbmcAOjpyZXMvZHJhd2FibGUteGhkcGktdjQvYWJjX3RleHRfc2VsZWN0X2hh
bmRsZV9sZWZ0X210cmwucG5nADw8cmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY190ZXh0X3NlbGVj
dF9oYW5kbGVfbWlkZGxlX210cmwucG5nADs7cmVzL2RyYXdhYmxlLXhoZHBpLXY0L2FiY190ZXh0
X3NlbGVjdF9oYW5kbGVfcmlnaHRfbXRybC5wbmcAPj5yZXMvZHJhd2FibGUteGhkcGktdjQvYWJj
X3RleHRmaWVsZF9hY3RpdmF0ZWRfbXRybF9hbHBoYS45LnBuZwA8PHJlcy9kcmF3YWJsZS14aGRw
aS12NC9hYmNfdGV4dGZpZWxkX2RlZmF1bHRfbXRybF9hbHBoYS45LnBuZwBFRXJlcy9kcmF3YWJs
ZS14aGRwaS12NC9hYmNfdGV4dGZpZWxkX3NlYXJjaF9hY3RpdmF0ZWRfbXRybF9hbHBoYS45LnBu
ZwBDQ3Jlcy9kcmF3YWJsZS14aGRwaS12NC9hYmNfdGV4dGZpZWxkX3NlYXJjaF9kZWZhdWx0X210
cmxfYWxwaGEuOS5wbmcAKChyZXMvZHJhd2FibGUteGhkcGktdjQvaWNfY2FsbF9hbnN3ZXIucG5n
ACwscmVzL2RyYXdhYmxlLXhoZHBpLXY0L2ljX2NhbGxfYW5zd2VyX2xvdy5wbmcALi5yZXMvZHJh
d2FibGUteGhkcGktdjQvaWNfY2FsbF9hbnN3ZXJfdmlkZW8ucG5nADIycmVzL2RyYXdhYmxlLXho
ZHBpLXY0L2ljX2NhbGxfYW5zd2VyX3ZpZGVvX2xvdy5wbmcAKSlyZXMvZHJhd2FibGUteGhkcGkt
djQvaWNfY2FsbF9kZWNsaW5lLnBuZwAtLXJlcy9kcmF3YWJsZS14aGRwaS12NC9pY19jYWxsX2Rl
Y2xpbmVfbG93LnBuZwA2NnJlcy9kcmF3YWJsZS14aGRwaS12NC9ub3RpZmljYXRpb25fYmdfbG93
X25vcm1hbC45LnBuZwA3N3Jlcy9kcmF3YWJsZS14aGRwaS12NC9ub3RpZmljYXRpb25fYmdfbG93
X3ByZXNzZWQuOS5wbmcAMjJyZXMvZHJhd2FibGUteGhkcGktdjQvbm90aWZpY2F0aW9uX2JnX25v
cm1hbC45LnBuZwA6OnJlcy9kcmF3YWJsZS14aGRwaS12NC9ub3RpZmljYXRpb25fYmdfbm9ybWFs
X3ByZXNzZWQuOS5wbmcAOztyZXMvZHJhd2FibGUteGhkcGktdjQvbm90aWZ5X3BhbmVsX25vdGlm
aWNhdGlvbl9pY29uX2JnLnBuZwA5OXJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX2FiX3NoYXJl
X3BhY2tfbXRybF9hbHBoYS45LnBuZwA3N3Jlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX2J0bl9j
aGVja190b19vbl9tdHJsXzAwMC5wbmcANzdyZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19idG5f
Y2hlY2tfdG9fb25fbXRybF8wMTUucG5nADc3cmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfYnRu
X3JhZGlvX3RvX29uX210cmxfMDAwLnBuZwA3N3Jlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX2J0
bl9yYWRpb190b19vbl9tdHJsXzAxNS5wbmcAPDxyZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19i
dG5fc3dpdGNoX3RvX29uX210cmxfMDAwMDEuOS5wbmcAPDxyZXMvZHJhd2FibGUteHhoZHBpLXY0
L2FiY19idG5fc3dpdGNoX3RvX29uX210cmxfMDAwMTIuOS5wbmcAPj5yZXMvZHJhd2FibGUteHho
ZHBpLXY0L2FiY19jYWJfYmFja2dyb3VuZF90b3BfbXRybF9hbHBoYS45LnBuZwA+PnJlcy9kcmF3
YWJsZS14eGhkcGktdjQvYWJjX2ljX2NvbW1pdF9zZWFyY2hfYXBpX210cmxfYWxwaGEucG5nADg4
cmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfbGlzdF9kaXZpZGVyX210cmxfYWxwaGEuOS5wbmcA
MjJyZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19saXN0X2ZvY3VzZWRfaG9sby45LnBuZwA2NnJl
cy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX2xpc3RfbG9uZ3ByZXNzZWRfaG9sby45LnBuZwA3N3Jl
cy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX2xpc3RfcHJlc3NlZF9ob2xvX2RhcmsuOS5wbmcAODhy
ZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19saXN0X3ByZXNzZWRfaG9sb19saWdodC45LnBuZwBB
QXJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX2xpc3Rfc2VsZWN0b3JfZGlzYWJsZWRfaG9sb19k
YXJrLjkucG5nAEJCcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfbGlzdF9zZWxlY3Rvcl9kaXNh
YmxlZF9ob2xvX2xpZ2h0LjkucG5nAD09cmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfbWVudV9o
YXJka2V5X3BhbmVsX210cmxfbXVsdC45LnBuZwA7O3Jlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJj
X3BvcHVwX2JhY2tncm91bmRfbXRybF9tdWx0LjkucG5nAD4+cmVzL2RyYXdhYmxlLXh4aGRwaS12
NC9hYmNfc2NydWJiZXJfY29udHJvbF9vZmZfbXRybF9hbHBoYS5wbmcAQ0NyZXMvZHJhd2FibGUt
eHhoZHBpLXY0L2FiY19zY3J1YmJlcl9jb250cm9sX3RvX3ByZXNzZWRfbXRybF8wMDAucG5nAEND
cmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF90b19wcmVzc2VkX210
cmxfMDA1LnBuZwA8PHJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX3NjcnViYmVyX3ByaW1hcnlf
bXRybF9hbHBoYS45LnBuZwA6OnJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX3NjcnViYmVyX3Ry
YWNrX210cmxfYWxwaGEuOS5wbmcANjZyZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19zcGlubmVy
X210cmxfYW1fYWxwaGEuOS5wbmcAODhyZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY19zd2l0Y2hf
dHJhY2tfbXRybF9hbHBoYS45LnBuZwA5OXJlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX3RhYl9p
bmRpY2F0b3JfbXRybF9hbHBoYS45LnBuZwA7O3Jlcy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX3Rl
eHRfc2VsZWN0X2hhbmRsZV9sZWZ0X210cmwucG5nAD09cmVzL2RyYXdhYmxlLXh4aGRwaS12NC9h
YmNfdGV4dF9zZWxlY3RfaGFuZGxlX21pZGRsZV9tdHJsLnBuZwA8PHJlcy9kcmF3YWJsZS14eGhk
cGktdjQvYWJjX3RleHRfc2VsZWN0X2hhbmRsZV9yaWdodF9tdHJsLnBuZwA/P3Jlcy9kcmF3YWJs
ZS14eGhkcGktdjQvYWJjX3RleHRmaWVsZF9hY3RpdmF0ZWRfbXRybF9hbHBoYS45LnBuZwA9PXJl
cy9kcmF3YWJsZS14eGhkcGktdjQvYWJjX3RleHRmaWVsZF9kZWZhdWx0X210cmxfYWxwaGEuOS5w
bmcARkZyZXMvZHJhd2FibGUteHhoZHBpLXY0L2FiY190ZXh0ZmllbGRfc2VhcmNoX2FjdGl2YXRl
ZF9tdHJsX2FscGhhLjkucG5nAEREcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9hYmNfdGV4dGZpZWxk
X3NlYXJjaF9kZWZhdWx0X210cmxfYWxwaGEuOS5wbmcAKSlyZXMvZHJhd2FibGUteHhoZHBpLXY0
L2ljX2NhbGxfYW5zd2VyLnBuZwAtLXJlcy9kcmF3YWJsZS14eGhkcGktdjQvaWNfY2FsbF9hbnN3
ZXJfbG93LnBuZwAvL3Jlcy9kcmF3YWJsZS14eGhkcGktdjQvaWNfY2FsbF9hbnN3ZXJfdmlkZW8u
cG5nADMzcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9pY19jYWxsX2Fuc3dlcl92aWRlb19sb3cucG5n
ACoqcmVzL2RyYXdhYmxlLXh4aGRwaS12NC9pY19jYWxsX2RlY2xpbmUucG5nAC4ucmVzL2RyYXdh
YmxlLXh4aGRwaS12NC9pY19jYWxsX2RlY2xpbmVfbG93LnBuZwA4OHJlcy9kcmF3YWJsZS14eHho
ZHBpLXY0L2FiY19idG5fY2hlY2tfdG9fb25fbXRybF8wMDAucG5nADg4cmVzL2RyYXdhYmxlLXh4
eGhkcGktdjQvYWJjX2J0bl9jaGVja190b19vbl9tdHJsXzAxNS5wbmcAODhyZXMvZHJhd2FibGUt
eHh4aGRwaS12NC9hYmNfYnRuX3JhZGlvX3RvX29uX210cmxfMDAwLnBuZwA4OHJlcy9kcmF3YWJs
ZS14eHhoZHBpLXY0L2FiY19idG5fcmFkaW9fdG9fb25fbXRybF8wMTUucG5nAD09cmVzL2RyYXdh
YmxlLXh4eGhkcGktdjQvYWJjX2J0bl9zd2l0Y2hfdG9fb25fbXRybF8wMDAwMS45LnBuZwA9PXJl
cy9kcmF3YWJsZS14eHhoZHBpLXY0L2FiY19idG5fc3dpdGNoX3RvX29uX210cmxfMDAwMTIuOS5w
bmcARERyZXMvZHJhd2FibGUteHh4aGRwaS12NC9hYmNfc2NydWJiZXJfY29udHJvbF90b19wcmVz
c2VkX210cmxfMDAwLnBuZwBERHJlcy9kcmF3YWJsZS14eHhoZHBpLXY0L2FiY19zY3J1YmJlcl9j
b250cm9sX3RvX3ByZXNzZWRfbXRybF8wMDUucG5nADc3cmVzL2RyYXdhYmxlLXh4eGhkcGktdjQv
YWJjX3NwaW5uZXJfbXRybF9hbV9hbHBoYS45LnBuZwA5OXJlcy9kcmF3YWJsZS14eHhoZHBpLXY0
L2FiY19zd2l0Y2hfdHJhY2tfbXRybF9hbHBoYS45LnBuZwA6OnJlcy9kcmF3YWJsZS14eHhoZHBp
LXY0L2FiY190YWJfaW5kaWNhdG9yX210cmxfYWxwaGEuOS5wbmcAPDxyZXMvZHJhd2FibGUteHh4
aGRwaS12NC9hYmNfdGV4dF9zZWxlY3RfaGFuZGxlX2xlZnRfbXRybC5wbmcAPT1yZXMvZHJhd2Fi
bGUteHh4aGRwaS12NC9hYmNfdGV4dF9zZWxlY3RfaGFuZGxlX3JpZ2h0X210cmwucG5nACoqcmVz
L2RyYXdhYmxlLXh4eGhkcGktdjQvaWNfY2FsbF9hbnN3ZXIucG5nAC4ucmVzL2RyYXdhYmxlLXh4
eGhkcGktdjQvaWNfY2FsbF9hbnN3ZXJfbG93LnBuZwAwMHJlcy9kcmF3YWJsZS14eHhoZHBpLXY0
L2ljX2NhbGxfYW5zd2VyX3ZpZGVvLnBuZwA0NHJlcy9kcmF3YWJsZS14eHhoZHBpLXY0L2ljX2Nh
bGxfYW5zd2VyX3ZpZGVvX2xvdy5wbmcAKytyZXMvZHJhd2FibGUteHh4aGRwaS12NC9pY19jYWxs
X2RlY2xpbmUucG5nAC8vcmVzL2RyYXdhYmxlLXh4eGhkcGktdjQvaWNfY2FsbF9kZWNsaW5lX2xv
dy5wbmcAKytyZXMvZHJhd2FibGUvJGljX2xhdW5jaGVyX2ZvcmVncm91bmRfXzAueG1sACwscmVz
L2RyYXdhYmxlL2FiY19idG5fYm9yZGVybGVzc19tYXRlcmlhbC54bWwAJydyZXMvZHJhd2FibGUv
YWJjX2J0bl9jaGVja19tYXRlcmlhbC54bWwALCxyZXMvZHJhd2FibGUvYWJjX2J0bl9jaGVja19t
YXRlcmlhbF9hbmltLnhtbAArK3Jlcy9kcmF3YWJsZS9hYmNfYnRuX2RlZmF1bHRfbXRybF9zaGFw
ZS54bWwAJydyZXMvZHJhd2FibGUvYWJjX2J0bl9yYWRpb19tYXRlcmlhbC54bWwALCxyZXMvZHJh
d2FibGUvYWJjX2J0bl9yYWRpb19tYXRlcmlhbF9hbmltLnhtbAAvL3Jlcy9kcmF3YWJsZS9hYmNf
Y2FiX2JhY2tncm91bmRfaW50ZXJuYWxfYmcueG1sADAwcmVzL2RyYXdhYmxlL2FiY19jYWJfYmFj
a2dyb3VuZF90b3BfbWF0ZXJpYWwueG1sACgocmVzL2RyYXdhYmxlL2FiY19pY19hYl9iYWNrX21h
dGVyaWFsLnhtbAAzM3Jlcy9kcmF3YWJsZS9hYmNfaWNfYXJyb3dfZHJvcF9yaWdodF9ibGFja18y
NGRwLnhtbAAmJnJlcy9kcmF3YWJsZS9hYmNfaWNfY2xlYXJfbWF0ZXJpYWwueG1sAC4ucmVzL2Ry
YXdhYmxlL2FiY19pY19nb19zZWFyY2hfYXBpX21hdGVyaWFsLnhtbAAvL3Jlcy9kcmF3YWJsZS9h
YmNfaWNfbWVudV9jb3B5X210cmxfYW1fYWxwaGEueG1sACsrcmVzL2RyYXdhYmxlL2FiY19pY19t
ZW51X2N1dF9tdHJsX2FscGhhLnhtbAAuLnJlcy9kcmF3YWJsZS9hYmNfaWNfbWVudV9vdmVyZmxv
d19tYXRlcmlhbC54bWwAMDByZXMvZHJhd2FibGUvYWJjX2ljX21lbnVfcGFzdGVfbXRybF9hbV9h
bHBoYS54bWwAMTFyZXMvZHJhd2FibGUvYWJjX2ljX21lbnVfc2VsZWN0YWxsX210cmxfYWxwaGEu
eG1sAC0tcmVzL2RyYXdhYmxlL2FiY19pY19tZW51X3NoYXJlX210cmxfYWxwaGEueG1sACsrcmVz
L2RyYXdhYmxlL2FiY19pY19zZWFyY2hfYXBpX21hdGVyaWFsLnhtbAAxMXJlcy9kcmF3YWJsZS9h
YmNfaWNfdm9pY2Vfc2VhcmNoX2FwaV9tYXRlcmlhbC54bWwALi5yZXMvZHJhd2FibGUvYWJjX2l0
ZW1fYmFja2dyb3VuZF9ob2xvX2RhcmsueG1sAC8vcmVzL2RyYXdhYmxlL2FiY19pdGVtX2JhY2tn
cm91bmRfaG9sb19saWdodC54bWwAQkJyZXMvZHJhd2FibGUvYWJjX2xpc3Rfc2VsZWN0b3JfYmFj
a2dyb3VuZF90cmFuc2l0aW9uX2hvbG9fZGFyay54bWwAQ0NyZXMvZHJhd2FibGUvYWJjX2xpc3Rf
c2VsZWN0b3JfYmFja2dyb3VuZF90cmFuc2l0aW9uX2hvbG9fbGlnaHQueG1sACwscmVzL2RyYXdh
YmxlL2FiY19saXN0X3NlbGVjdG9yX2hvbG9fZGFyay54bWwALS1yZXMvZHJhd2FibGUvYWJjX2xp
c3Rfc2VsZWN0b3JfaG9sb19saWdodC54bWwAMTFyZXMvZHJhd2FibGUvYWJjX3JhdGluZ2Jhcl9p
bmRpY2F0b3JfbWF0ZXJpYWwueG1sACcncmVzL2RyYXdhYmxlL2FiY19yYXRpbmdiYXJfbWF0ZXJp
YWwueG1sAC0tcmVzL2RyYXdhYmxlL2FiY19yYXRpbmdiYXJfc21hbGxfbWF0ZXJpYWwueG1sACsr
cmVzL2RyYXdhYmxlL2FiY19zZWVrYmFyX3RodW1iX21hdGVyaWFsLnhtbAAvL3Jlcy9kcmF3YWJs
ZS9hYmNfc2Vla2Jhcl90aWNrX21hcmtfbWF0ZXJpYWwueG1sACsrcmVzL2RyYXdhYmxlL2FiY19z
ZWVrYmFyX3RyYWNrX21hdGVyaWFsLnhtbAA6OnJlcy9kcmF3YWJsZS9hYmNfc3Bpbm5lcl90ZXh0
ZmllbGRfYmFja2dyb3VuZF9tYXRlcmlhbC54bWwAJCRyZXMvZHJhd2FibGUvYWJjX3N0YXJfYmxh
Y2tfNDhkcC54bWwAKSlyZXMvZHJhd2FibGUvYWJjX3N0YXJfaGFsZl9ibGFja180OGRwLnhtbAAq
KnJlcy9kcmF3YWJsZS9hYmNfc3dpdGNoX3RodW1iX21hdGVyaWFsLnhtbAArK3Jlcy9kcmF3YWJs
ZS9hYmNfdGFiX2luZGljYXRvcl9tYXRlcmlhbC54bWwAKSlyZXMvZHJhd2FibGUvYWJjX3RleHRf
Y3Vyc29yX21hdGVyaWFsLnhtbAAuLnJlcy9kcmF3YWJsZS9hYmNfdGV4dGZpZWxkX3NlYXJjaF9t
YXRlcmlhbC54bWwAICByZXMvZHJhd2FibGUvYWJjX3ZlY3Rvcl90ZXN0LnhtbAAqKnJlcy9kcmF3
YWJsZS9idG5fY2hlY2tib3hfY2hlY2tlZF9tdHJsLnhtbABBQXJlcy9kcmF3YWJsZS9idG5fY2hl
Y2tib3hfY2hlY2tlZF90b191bmNoZWNrZWRfbXRybF9hbmltYXRpb24ueG1sACwscmVzL2RyYXdh
YmxlL2J0bl9jaGVja2JveF91bmNoZWNrZWRfbXRybC54bWwAQUFyZXMvZHJhd2FibGUvYnRuX2No
ZWNrYm94X3VuY2hlY2tlZF90b19jaGVja2VkX210cmxfYW5pbWF0aW9uLnhtbAAjI3Jlcy9kcmF3
YWJsZS9idG5fcmFkaW9fb2ZmX210cmwueG1sADMzcmVzL2RyYXdhYmxlL2J0bl9yYWRpb19vZmZf
dG9fb25fbXRybF9hbmltYXRpb24ueG1sACIicmVzL2RyYXdhYmxlL2J0bl9yYWRpb19vbl9tdHJs
LnhtbAAzM3Jlcy9kcmF3YWJsZS9idG5fcmFkaW9fb25fdG9fb2ZmX210cmxfYW5pbWF0aW9uLnht
bAAnJ3Jlcy9kcmF3YWJsZS9pY19sYXVuY2hlcl9iYWNrZ3JvdW5kLnhtbAAnJ3Jlcy9kcmF3YWJs
ZS9pY19sYXVuY2hlcl9mb3JlZ3JvdW5kLnhtbAAgIHJlcy9kcmF3YWJsZS9ub3RpZmljYXRpb25f
YmcueG1sACQkcmVzL2RyYXdhYmxlL25vdGlmaWNhdGlvbl9iZ19sb3cueG1sAC0tcmVzL2RyYXdh
YmxlL25vdGlmaWNhdGlvbl9pY29uX2JhY2tncm91bmQueG1sACUlcmVzL2RyYXdhYmxlL25vdGlm
aWNhdGlvbl90aWxlX2JnLnhtbAAjI3Jlcy9kcmF3YWJsZS90b29sdGlwX2ZyYW1lX2RhcmsueG1s
ACQkcmVzL2RyYXdhYmxlL3Rvb2x0aXBfZnJhbWVfbGlnaHQueG1sAEdHcmVzL2ludGVycG9sYXRv
ci9idG5fY2hlY2tib3hfY2hlY2tlZF9tdHJsX2FuaW1hdGlvbl9pbnRlcnBvbGF0b3JfMC54bWwA
R0dyZXMvaW50ZXJwb2xhdG9yL2J0bl9jaGVja2JveF9jaGVja2VkX210cmxfYW5pbWF0aW9uX2lu
dGVycG9sYXRvcl8xLnhtbABJSXJlcy9pbnRlcnBvbGF0b3IvYnRuX2NoZWNrYm94X3VuY2hlY2tl
ZF9tdHJsX2FuaW1hdGlvbl9pbnRlcnBvbGF0b3JfMC54bWwASUlyZXMvaW50ZXJwb2xhdG9yL2J0
bl9jaGVja2JveF91bmNoZWNrZWRfbXRybF9hbmltYXRpb25faW50ZXJwb2xhdG9yXzEueG1sAEND
cmVzL2ludGVycG9sYXRvci9idG5fcmFkaW9fdG9fb2ZmX210cmxfYW5pbWF0aW9uX2ludGVycG9s
YXRvcl8wLnhtbABCQnJlcy9pbnRlcnBvbGF0b3IvYnRuX3JhZGlvX3RvX29uX210cmxfYW5pbWF0
aW9uX2ludGVycG9sYXRvcl8wLnhtbAAlJXJlcy9pbnRlcnBvbGF0b3IvZmFzdF9vdXRfc2xvd19p
bi54bWwAJiZyZXMvbGF5b3V0LXYyMS9ub3RpZmljYXRpb25fYWN0aW9uLnhtbAAwMHJlcy9sYXlv
dXQtdjIxL25vdGlmaWNhdGlvbl9hY3Rpb25fdG9tYnN0b25lLnhtbAAzM3Jlcy9sYXlvdXQtdjIx
L25vdGlmaWNhdGlvbl90ZW1wbGF0ZV9jdXN0b21fYmlnLnhtbAAzM3Jlcy9sYXlvdXQtdjIxL25v
dGlmaWNhdGlvbl90ZW1wbGF0ZV9pY29uX2dyb3VwLnhtbAAlJXJlcy9sYXlvdXQtdjI2L2FiY19z
Y3JlZW5fdG9vbGJhci54bWwAPT1yZXMvbGF5b3V0LXdhdGNoLXYyMC9hYmNfYWxlcnRfZGlhbG9n
X2J1dHRvbl9iYXJfbWF0ZXJpYWwueG1sADg4cmVzL2xheW91dC13YXRjaC12MjAvYWJjX2FsZXJ0
X2RpYWxvZ190aXRsZV9tYXRlcmlhbC54bWwAKChyZXMvbGF5b3V0L2FiY19hY3Rpb25fYmFyX3Rp
dGxlX2l0ZW0ueG1sACoqcmVzL2xheW91dC9hYmNfYWN0aW9uX2Jhcl91cF9jb250YWluZXIueG1s
ACoqcmVzL2xheW91dC9hYmNfYWN0aW9uX21lbnVfaXRlbV9sYXlvdXQueG1sACUlcmVzL2xheW91
dC9hYmNfYWN0aW9uX21lbnVfbGF5b3V0LnhtbAAiInJlcy9sYXlvdXQvYWJjX2FjdGlvbl9tb2Rl
X2Jhci54bWwAMjJyZXMvbGF5b3V0L2FiY19hY3Rpb25fbW9kZV9jbG9zZV9pdGVtX21hdGVyaWFs
LnhtbAAoKHJlcy9sYXlvdXQvYWJjX2FjdGl2aXR5X2Nob29zZXJfdmlldy54bWwAMjJyZXMvbGF5
b3V0L2FiY19hY3Rpdml0eV9jaG9vc2VyX3ZpZXdfbGlzdF9pdGVtLnhtbAAzM3Jlcy9sYXlvdXQv
YWJjX2FsZXJ0X2RpYWxvZ19idXR0b25fYmFyX21hdGVyaWFsLnhtbAAoKHJlcy9sYXlvdXQvYWJj
X2FsZXJ0X2RpYWxvZ19tYXRlcmlhbC54bWwALi5yZXMvbGF5b3V0L2FiY19hbGVydF9kaWFsb2df
dGl0bGVfbWF0ZXJpYWwueG1sAC0tcmVzL2xheW91dC9hYmNfY2FzY2FkaW5nX21lbnVfaXRlbV9s
YXlvdXQueG1sACgocmVzL2xheW91dC9hYmNfZGlhbG9nX3RpdGxlX21hdGVyaWFsLnhtbAAnJ3Jl
cy9sYXlvdXQvYWJjX2V4cGFuZGVkX21lbnVfbGF5b3V0LnhtbAAqKnJlcy9sYXlvdXQvYWJjX2xp
c3RfbWVudV9pdGVtX2NoZWNrYm94LnhtbAAmJnJlcy9sYXlvdXQvYWJjX2xpc3RfbWVudV9pdGVt
X2ljb24ueG1sACgocmVzL2xheW91dC9hYmNfbGlzdF9tZW51X2l0ZW1fbGF5b3V0LnhtbAAnJ3Jl
cy9sYXlvdXQvYWJjX2xpc3RfbWVudV9pdGVtX3JhZGlvLnhtbAAwMHJlcy9sYXlvdXQvYWJjX3Bv
cHVwX21lbnVfaGVhZGVyX2l0ZW1fbGF5b3V0LnhtbAApKXJlcy9sYXlvdXQvYWJjX3BvcHVwX21l
bnVfaXRlbV9sYXlvdXQueG1sACkpcmVzL2xheW91dC9hYmNfc2NyZWVuX2NvbnRlbnRfaW5jbHVk
ZS54bWwAICByZXMvbGF5b3V0L2FiY19zY3JlZW5fc2ltcGxlLnhtbAA0NHJlcy9sYXlvdXQvYWJj
X3NjcmVlbl9zaW1wbGVfb3ZlcmxheV9hY3Rpb25fbW9kZS54bWwAISFyZXMvbGF5b3V0L2FiY19z
Y3JlZW5fdG9vbGJhci54bWwAMzNyZXMvbGF5b3V0L2FiY19zZWFyY2hfZHJvcGRvd25faXRlbV9p
Y29uc18ybGluZS54bWwAHh5yZXMvbGF5b3V0L2FiY19zZWFyY2hfdmlldy54bWwAKSlyZXMvbGF5
b3V0L2FiY19zZWxlY3RfZGlhbG9nX21hdGVyaWFsLnhtbAAaGnJlcy9sYXlvdXQvYWJjX3Rvb2x0
aXAueG1sABwccmVzL2xheW91dC9hY3Rpdml0eV9tYWluLnhtbAAcHHJlcy9sYXlvdXQvY3VzdG9t
X2RpYWxvZy54bWwANTVyZXMvbGF5b3V0L25vdGlmaWNhdGlvbl90ZW1wbGF0ZV9wYXJ0X2Nocm9u
b21ldGVyLnhtbAAuLnJlcy9sYXlvdXQvbm90aWZpY2F0aW9uX3RlbXBsYXRlX3BhcnRfdGltZS54
bWwAKipyZXMvbGF5b3V0L3NlbGVjdF9kaWFsb2dfaXRlbV9tYXRlcmlhbC54bWwAMTFyZXMvbGF5
b3V0L3NlbGVjdF9kaWFsb2dfbXVsdGljaG9pY2VfbWF0ZXJpYWwueG1sADIycmVzL2xheW91dC9z
ZWxlY3RfZGlhbG9nX3NpbmdsZWNob2ljZV9tYXRlcmlhbC54bWwAMzNyZXMvbGF5b3V0L3N1cHBv
cnRfc2ltcGxlX3NwaW5uZXJfZHJvcGRvd25faXRlbS54bWwAJSVyZXMvbWlwbWFwLWFueWRwaS12
MjYvaWNfbGF1bmNoZXIueG1sACsrcmVzL21pcG1hcC1hbnlkcGktdjI2L2ljX2xhdW5jaGVyX3Jv
dW5kLnhtbAAjI3Jlcy9taXBtYXAtaGRwaS12NC9pY19sYXVuY2hlci53ZWJwACkpcmVzL21pcG1h
cC1oZHBpLXY0L2ljX2xhdW5jaGVyX3JvdW5kLndlYnAAIyNyZXMvbWlwbWFwLW1kcGktdjQvaWNf
bGF1bmNoZXIud2VicAApKXJlcy9taXBtYXAtbWRwaS12NC9pY19sYXVuY2hlcl9yb3VuZC53ZWJw
ACQkcmVzL21pcG1hcC14aGRwaS12NC9pY19sYXVuY2hlci53ZWJwACoqcmVzL21pcG1hcC14aGRw
aS12NC9pY19sYXVuY2hlcl9yb3VuZC53ZWJwACUlcmVzL21pcG1hcC14eGhkcGktdjQvaWNfbGF1
bmNoZXIud2VicAArK3Jlcy9taXBtYXAteHhoZHBpLXY0L2ljX2xhdW5jaGVyX3JvdW5kLndlYnAA
JiZyZXMvbWlwbWFwLXh4eGhkcGktdjQvaWNfbGF1bmNoZXIud2VicAAsLHJlcy9taXBtYXAteHh4
aGRwaS12NC9pY19sYXVuY2hlcl9yb3VuZC53ZWJwABgYcmVzL3htbC9iYWNrdXBfcnVsZXMueG1s
ACEhcmVzL3htbC9kYXRhX2V4dHJhY3Rpb25fcnVsZXMueG1sAAoKc2Fucy1zZXJpZgAREXNhbnMt
c2VyaWYtbWVkaXVtAAwMJTEkZCBlbiBwdW50AAoKJTEkZCBob3JlcwALCyUxJGQgbWludXRzAA0N
JTEkZCBwZXIgY2VudAAGBkFDVElWQQAHB0FjdGl2YXQAExNBbnNhIHBlciBhcnJvc3NlZ2FyAAQE
QXZ1aQAdHkNhbnZpYSBhIGxhIHNlbGVjY2nDsyBkZSBsJ2FueQAWFkNhbnZpYSBhbCBtZXMgYW50
ZXJpb3IAFRZDYW52aWEgYWwgbWVzIHNlZ8O8ZW50ADM0Q2FudmlhIGFsIG1vZGUgZCdpbnRyb2R1
Y2Npw7MgZGUgZGFkZXMgZGVsIGNhbGVuZGFyaQAkJUNhbnZpYSBhbCBtb2RlIGQnaW50cm9kdWNj
acOzIGRlIHRleHQAAwNDYXAABQVDZXJjYQANDUNlcmNhIHBlciB2ZXUABghDZXJjYeKApgAODkNv
bXBhcnRlaXggYW1iABERQ29tcGFydGVpeCBhbWIgJXMAERFDb25zdWx0YSBkZSBjZXJjYQAJCURF
U0FDVElWQQAEBERhdGEADAxEYXRhIGQnaW5pY2kAFBVEYXRhIGRlIGZpbmFsaXR6YWNpw7MADxBE
YXRhIGludHJvZHXDr2RhABUWRGF0YSBpbnRyb2R1w69kYTogJTEkcwAVFURhdGEgbm8gcGVybWVz
YTogJTEkcwAREURhdGEgc2VsZWNjaW9uYWRhAAoKRGVzYWN0aXZhdAATFERlc2NyaXBjacOzIGVt
ZXJnZW50ACYnRGVzcGxhw6dhJ3QgcGVyIG1vc3RyYXIgZWwgbWVzIGFudGVyaW9yACUnRGVzcGxh
w6dhJ3QgcGVyIG1vc3RyYXIgZWwgbWVzIHNlZ8O8ZW50ACkqRGVzcGxhw6dhJ3QgcGVyIG1vc3Ry
YXIgZWxzIGFueXMgYW50ZXJpb3JzACcoRGVzcGxhw6dhJ3QgcGVyIG1vc3RyYXIgZWxzIGRhcnJl
cnMgYW55cwAZGURlc3BsZWdhIGVsIGZ1bGwgaW5mZXJpb3IAEhJEaW5zIGRlIGwnaW50ZXJ2YWwA
BgdEacOgbGVnAAcHRW4gY3VycwAREUVudmlhIGxhIGNvbnN1bHRhABMTRXNib3JyYSBsYSBjb25z
dWx0YQAFBUVzcGFpAAMDRmV0ABAQRmkgZGUgbCdpbnRlcnZhbAAREUZpbmVzdHJhIGVtZXJnZW50
AAcIRnVuY2nDsysABARIb3JhAAYGSWdub3JhABcXSWdub3JhIGVsIGZ1bGwgaW5mZXJpb3IAExNJ
bmljaSBkZSBsJ2ludGVydmFsAAsLSW50ZXJydXB0b3IAFBRJbnRyb2R1ZWl4IGxlcyBkYXRlcwAW
GEwnZW50cmFkYSBubyDDqXMgdsOgbGlkYQAwMUxhIGRhdGEgbm8gY29pbmNpZGVpeCBhbWIgZWwg
cGF0csOzIGVzcGVyYXQ6ICUxJHMAQEBMYSBkYXRhIG5vIGVzIHRyb2JhIGRpbnMgZGUgbCdpbnRl
cnZhbCBkJ2FueXMgZXNwZXJhdDogJTEkcy0lMiRzAERETGxpc2NhIHBlciBzZWxlY2Npb25hciB1
biBhbnkgbyB0b2NhIHBlciB0b3JuYXIgYSBzZWxlY2Npb25hciB1biBkaWEABARNYWorABISTWFy
Y2F0IHBhcmNpYWxtZW50ABETTWVuw7ogZGUgbmF2ZWdhY2nDswAQEU1lbsO6IGRlc3BsZWdhYmxl
AAUGTWVuw7orAB0eTW9zdHJhIGxhIGRlc2NyaXBjacOzIGVtZXJnZW50AA0NTW9zdHJhLWhvIHRv
dAALDE3DqXMgb3BjaW9ucwAQEE5hdmVnYSBjYXAgYW11bnQAGBhOYXZlZ2EgZmlucyBhIGwnYW55
ICUxJHMAHyBOYXZlZ2EgZmlucyBhIGxhIHDDoGdpbmEgZCdpbmljaQAODk5vIHNlbGVjY2lvbmF0
AAUFUGVuamEACAhQZXN0YW55YQAHB1JlYnV0amEABwdSZXBsZWdhABgYUmVwbGVnYSBlbCBmdWxs
IGluZmVyaW9yAAYGUmVzcG9uAAYGUmV0b3JuACMkUydlc3TDoCBmaWx0cmFudCB1bmEgdHJ1Y2Fk
YSBlbnRyYW50AA4OUydoYSBkZXNwbGVnYXQALC5TJ2hhIGludHJvZHXDr3QgdW4gaW50ZXJ2YWwg
ZGUgZGFkZXMgbm8gdsOgbGlkAA0NUydoYSByZXBsZWdhdAASElNlbGVjY2lvbmEgQU0gbyBQTQAV
FVNlbGVjY2lvbmEgZWxzIG1pbnV0cwAREVNlbGVjY2lvbmEgbCdob3JhABISU2VsZWNjaW9uYSBs
YSBkYXRhABQUU2VsZWNjaW9uYSBsZXMgZGF0ZXMAGBlTZWxlY2Npb25hIHVuYSBhcGxpY2FjacOz
AAsLU2VsZWNjaW9uYXQAFRZTZWxlY2Npw7MgYWN0dWFsOiAlMSRzABYWU2VsZWN0b3IgZCdhbnkg
dmlzaWJsZQAaG1N1Z2dlcmltZW50cyBhIGNvbnRpbnVhY2nDswAEBFN1cHIADQ1UYW5jYSBlbCBm
dWxsABocVGFuY2EgZWwgbWVuw7ogZGUgbmF2ZWdhY2nDswAPD1RydWNhZGEgZW4gY3VycwAPD1Ry
dWNhZGEgZW50cmFudAAFBlbDrWRlbwAMDHBlciBhIGwnaG9yYQAODnBlciBhbHMgbWludXRzAA0N
JTEkZCBtaW51dHRlcgAKCiUxJGQgdGltZXIABQVBZnZpcwASEkFrdHVlbHQgdmFsZzogJTEkcwAM
DEFuZ2l2IGRhdG9lcgAMDEFuZ2l2ZXQgZGF0bwASEkFuZ2l2ZXQgZGF0bzogJTEkcwAGBkJlc3Zh
cgAEBERhdG8AHBxEYXRvZW4gZXIgaWtrZSB0aWxsYWR0OiAlMSRzADg5RGF0b2VuIGVyIHVkZW4g
Zm9yIGRldCBmb3J2ZW50ZWRlIMOlcnNpbnRlcnZhbDogJTEkcy0lMiRzADIyRGF0b2VuIHN2YXJl
ciBpa2tlIHRpbCBkZXQgZm9ydmVudGVkZSBmb3JtYXQ6ICUxJHMABwdEZWwgbWVkAAoKRGVsIG1l
ZCAlcwAQEERlbHZpc3QgbWFya2VyZXQACgpEaWFsb2dib2tzABwdRXQgaW5kZ8OlZW5kZSBvcGth
bGQgc2NyZWVuZXMAAwNGUkEABARGYW5lAAkJRmluZCBoamVtABQURmxlcmUgdmFsZ211bGlnaGVk
ZXIAEBBGb3JzbGFnIG5lZGVuZm9yAAMDRnJhAAUGR8OlIG9wAAcISMOlbmR0YWcABQVJIGRhZwAG
BkkgZ2FuZwATFElnYW5ndsOmcmVuZGUgb3BrYWxkAAoKSWtrZSB2YWxndAAYGEluZGVuIGZvciBk
ZSB2YWxndGUgZGFnZQAQEUluZGfDpWVuZGUgb3BrYWxkABQVSW5kc2VuZCBmb3Jlc3DDuHJnc2Vs
AAUFSW5nZW4ABwdLb250YWt0AAkJTHVrIGFya2V0ABERTHVrIGZlbHQgaSBidW5kZW4AFRVMdWsg
bmF2aWdhdGlvbnNtZW51ZW4ABghMw6ZnIHDDpQAPD05hdmlnYXRpb25zbWVudQATFE5hdmlnZXIg
dGlsIMOlciAlMSRzAA0NUG9wIG9wLXZpbmR1ZQAdHlJ1bCBmb3IgYXQgdmlzZSBmb3JyaWdlIG3D
pW5lZAAbHVJ1bCBmb3IgYXQgdmlzZSBuw6ZzdGUgbcOlbmVkABkaUnVsIGZvciBhdCB2aXNlIHNl
bmVyZSDDpXIAHB1SdWwgZm9yIGF0IHZpc2UgdGlkbGlnZXJlIMOlcgAJCVJ1bGxlbWVudQAQEVJ5
ZCBmb3Jlc3DDuHJnc2VsAAcHU2UgYWxsZQAOEFNlIHbDpnJrdMO4anN0aXAAFxhTa2lmdCB0aWwg
Zm9ycmlnZSBtw6VuZWQAJSVTa2lmdCB0aWwgaW5wdXQtdGlsc3RhbmQgZm9yIGthbGVuZGVyACIi
U2tpZnQgdGlsIGlucHV0LXRpbHN0YW5kIGZvciB0ZWtzdAAVF1NraWZ0IHRpbCBuw6ZzdGUgbcOl
bmVkABQVU2tpZnQgdGlsIHZhbGcgYWYgw6VyAAUFU2tqdWwAExNTa2p1bCBmZWx0IGkgYnVuZGVu
AAYGU2tqdWx0AAgIU2x1dGRhdG8ADAxTbHV0aW50ZXJ2YWwACQlTdGFydGRhdG8ADQ1TdGFydGlu
dGVydmFsAEtOU3RyeWcgZm9yIGF0IHbDpmxnZSBldCDDpXIsIGVsbGVyIHRyeWsgZm9yIGF0IHNr
aWZ0ZSB0aWxiYWdlIHRpbCBkYXRvdsOmbGdlcmVuAAMEU8O4ZwAQElPDuGdlZm9yZXNww7hyZ3Nl
bAAEB1PDuGfigKYAAwNUSUwACwxUYWxlc8O4Z25pbmcAAwNUaWwABARUaW1lAAUGVWRmw7hyABMT
VWR2aWQgZmVsdCBpIGJ1bmRlbgAHB1VkdmlkZXQAISFVZ3lsZGlnIGFuZ2l2ZWxzZSBhZiBkYXRh
aW50ZXJ2YWwADg5VZ3lsZGlndCBpbnB1dAAFBVZhbGd0AAoKVmFsZ3QgZGF0bwAQEVbDpmxnIEFN
IGVsbGVyIFBNAAkKVsOmbGcgZGF0bwALDFbDpmxnIGRhdG9lcgALDFbDpmxnIGVuIGFwcAANDlbD
pmxnIG1pbnV0dGVyAAkKVsOmbGcgdGltZQALDVbDpnJrdMO4anN0aXAADAxmb3IgbWludXR0ZXIA
CAhmb3IgdGltZQAICGtsLiAlMSRkAAkJbWVsbGVtcnVtAAQEc2xldAAVF8OFcnN2w6ZsZ2VyZW4g
ZXIgc3lubGlnAAoOJTEkZCDYr9ix2LXYry4ADRnYp9ix2LPYp9mEINm+2Y/Ysdiz2YXYp9mGABgs
2KfYstmH2YUg2KjYp9iyINqp2LHYr9mGINio2LHar9mHINiy24zYsduM2YYACxXYp9iy2YfZhSDY
qNin2LLYtNiv2YcABQrYp9mF2LHZiNiyAA0Z2KfZhtiq2K7Yp9ioINio2LHZhtin2YXZhwAMF9in
2YbYqtiu2KfYqCDYqtin2LHbjNiuAAwX2KfZhtiq2K7Yp9ioINiv2YLbjNmC2YcACxXYp9mG2KrY
rtin2Kgg2LPYp9i52KoACRHYp9mG2KrYrtin2Kgg2LTYrwATH9in2YbYqtiu2KfYqCDZgi7YuC4g
24zYpyDYqC7YuC4AFyvYp9mG2KrYrtin2Kjar9ixINiz2KfZhCDZhtmF2KfbjNin2YYg2KfYs9iq
AAsX2KfZhtiq2K7Yp9io4oCM2YbYtNiv2YcABAbYqC7YuC4AQ3rYqNix2KfbjCDYp9mG2KrYrtin
2Kgg2LPYp9mE2Iwg2KrZhtivINio2qnYtNuM2K8g24zYpyDYqNix2KfbjCDYqNix2q/YtNiq2YYg
2KjZhyDYp9mG2KrYrtin2Kgg2LHZiNiy2Iwg2LbYsdio2Ycg2KjYstmG24zYrwAKE9io2LHYp9uM
INiv2YLbjNmC2YcACRHYqNix2KfbjCDYs9in2LnYqgAiQNio2LHYp9uMINmG2YXYp9uM2LQg2LPY
p9mE4oCM2YfYp9uMINio2LnYryDZvtuM2YXYp9uM2LQg2qnZhtuM2K8AIkDYqNix2KfbjCDZhtmF
2KfbjNi0INiz2KfZhOKAjNmH2KfbjCDZgtio2YQg2b7bjNmF2KfbjNi0INqp2YbbjNivAB432KjY
sdin24wg2YbZhdin24zYtCDZhdin2Ycg2KjYudivINm+24zZhdin24zYtCDaqdmG24zYrwAeN9io
2LHYp9uMINmG2YXYp9uM2LQg2YXYp9mHINmC2KjZhCDZvtuM2YXYp9uM2LQg2qnZhtuM2K8AHjnY
qNix2K7bjCDZhdmI2KfYsdivINi52YTYp9mF2KrigIzar9iw2KfYsduMINi02K/ZhyDYp9iz2KoA
BAjYqNix2q/ZhwAECNio2LPYqtmGAAgP2KjYs9iq2YYg2KjYsdqvABAe2KjYs9iq2YYg2YXZhtmI
24wg2b7bjNmF2KfbjNi0AAUK2KrYp9ix24zYrgANGdiq2KfYsduM2K4g2KfZhtiq2K7Yp9io24wA
ChPYqtin2LHbjNiuINi02LHZiNi5AA0Z2KrYp9ix24zYriDZiNin2LHYr9i02K/ZhwALFdiq2KfY
sduM2K4g2b7Yp9uM2KfZhgAXLNiq2KfYsduM2K7igIzZh9inINix2Kcg2KfZhtiq2K7Yp9ioINqp
2YbbjNivABUo2KrYp9ix24zYruKAjNmH2Kcg2LHYpyDZiNin2LHYryDaqdmG24zYrwARH9iq2Lrb
jNuM2LEg2KjZhyDZhdin2Ycg2KjYudiv24wAER/Yqti624zbjNixINio2Ycg2YXYp9mHINmC2KjZ
hNuMABAe2KrZhdin2LMg2K/Ysdit2KfZhCDYp9mG2KzYp9mFAAoT2KrZhdin2LMg2YjYsdmI2K/b
jAAECNiq2YXYp9mFAAUK2KzYs9iq2KzZiAANGdis2LPYqtis2YjbjCDar9mB2KrYp9ix24wABxDY
rNiz2KrYrNmI4oCm4oCPABMj2KzZhdi5INqp2LHYr9mGINio2LHar9mHINiy24zYsduM2YYABw/Y
rNmF2LnigIzYtNiv2YcABQrYrtin2YXZiNi0AAkR2K/YsSDZhdit2K/ZiNiv2YcACxXYr9ix2K3Y
p9mEINin2YbYrNin2YUAGzLYr9ix2K3Yp9mEINi62LHYqNin2YQg2qnYsdiv2YYg2KrZhdin2LMg
2YjYsdmI2K/bjAANGdiv2LHYrtmI2KfYs9iqINis2LPYqtis2YgADhvYr9iz2Krar9uM2LHZhyDa
qdi02KfZhtiv2YYABQrYr9mC24zZgtmHAAgP2K/bjNiv2YYg2YfZhdmHAAcN2LHYryDaqdix2K/Z
hgASIdix2K8g2qnYsdiv2YYg2KjYsdqv2Ycg2LLbjNix24zZhgASIdix2YHYqtmGINio2Ycg2KfZ
htiq2K7Yp9ioINiz2KfZhAAMFtix2YHYqtmGINio2Ycg2KjYp9mE2KcAGjDYsdmB2KrZhiDYqNmH
INit2KfZhNiqINmI2LHZiNiv24wg2YbZiNi02KrYp9ix24wAFyrYsdmB2KrZhiDYqNmHINix2YjY
tCDZiNix2YjYr9uMINiq2YLZiNuM2YUABAjYsdmI2LTZhgAECNiz2KfYudiqAAsV2LTYsdmI2Lkg
2YXYrdiv2YjYr9mHAAUK2YHYp9i12YTZhwAEBtmCLti4LgAID9mC2LfYuSDYqtmF2KfYswAgPNmF
2K3Yr9mI2K/ZhyDYqtin2LHbjNiuINmI2KfYsdiv2LTYr9mHINmG2KfZhdi52KrYqNixINin2LPY
qgAEB9mF2YbZiCsACxXZhdmG2YjbjCDZvtuM2YXYp9uM2LQADRrZhdmG2YjbjCDaqdix2qnYsdmH
4oCM2KfbjAAQINmG2YXYp9uM2LQg2Ybaqdiq2YfigIzYp9io2LLYp9ixAAoV2Ybaqdiq2YfigIzY
p9io2LLYp9ixAAsW2YfZheKAjNix2LPYp9mG24wg2KjYpwAOGdmH2YXigIzYsdiz2KfZhtuMINio
2KcgJXMACBHZh9uM2obigIzaqdiv2KfZhQANGdmI2LHZiNiv24wg2YbYp9mF2LnYqtio2LEABQrZ
iNuM2K/bjNmIAAkR2b7Yp9iz2K4g2K/Yp9iv2YYAEB7Zvtin2qkg2qnYsdiv2YYg2b7Zj9ix2LPZ
hdin2YYADBfZvtin24zYp9mGINmF2K3Yr9mI2K/ZhwAMF9m+2YbYrNix2Ycg2KjYp9mE2KfZvtix
AA4b2b7bjNi02YbZh9in2K/Zh9in24wg2LLbjNixABMj2b7bjNmF2KfbjNi0INio2Ycg2LXZgdit
2Ycg2KfYtdmE24wAChPaqdin2K/YsSDar9mB2Krar9mIAAQI2qnZhNuM2K8ACRHaqdmI2obaqSDa
qdix2K/ZhgAPHtqv2LLbjNmG2YfigIzZh9in24wg2KjbjNi02KrYsQAGCuKAjkFsdCvigI4ABwvi
gI5DdHJsK+KAjgALD+KAjkZ1bmN0aW9uK+KAjgAHC+KAjk1ldGEr4oCOAAgM4oCOU2hpZnQr4oCO
AAYK4oCOU3ltK+KAjgALEuKAjyUxJGQg2K/ZgtuM2YLZhwAKEOKAjyUxJGQg2LPYp9i52KoAEh7i
gI/Yp9mG2KrYrtin2Kgg2YHYudmE24w6ICUxJHMALVDigI/Yqtin2LHbjNiuINio2Kcg2KfZhNqv
2YjbjCDZhdmI2LHYr9in2YbYqti42KfYsSDZhdi32KfYqNmC2Kog2YbYr9in2LHYrzogJTEkcwAq
ReKAj9iq2KfYsduM2K4g2K7Yp9ix2Kwg2KfYsiDYqNin2LLZhyDYstmF2KfZhtuMICUxJHMg2KrY
pyAlMiRzINin2LPYqgAWJeKAj9iq2KfYsduM2K4g2YXYrNin2LIg2YbbjNiz2Ko6ICUxJHMAFCLi
gI/Yqtin2LHbjNiuINmI2KfYsdiv2LTYr9mHOiAlMSRzAAoQ4oCP2LPYp9i52KogJTEkZAATIOKA
j9m+24zZhdin24zYtCDYqNmHINiz2KfZhCAlMSRzAAYIJTEkZCDliIYABgglMSRkIOaZggAHCyUx
JGQg5pmC6ZaTAAoWJTEkZOODkeODvOOCu+ODs+ODiOOAggAFCyVz44Go5YWx5pyJAAUFU3BhY2UA
GUvjgZPjgozjgojjgorliY3jga7lubTjgpLooajnpLrjgZnjgovjgavjga/jgrnjgq/jg63jg7zj
g6vjgZfjgabjgY/jgaDjgZXjgYQAGUvjgZPjgozjgojjgorlvozjga7lubTjgpLooajnpLrjgZnj
govjgavjga/jgrnjgq/jg63jg7zjg6vjgZfjgabjgY/jgaDjgZXjgYQABQ/jgZnjgbnjgabooajn
pLoACRvjgZ3jga7ku5bjga7jgqrjg5fjgrfjg6fjg7MAAgbjgarjgZcABhLjgqLjg5fjg6rjga7p
gbjmip4AAgbjgqrjg5UAAgbjgqrjg7MADy3jgqvjg6zjg7Pjg4Djg7zlhaXlipvjg6Ljg7zjg4nj
gavliIfjgormm7/jgYgABxXjgrfjg7zjg4jjgpLplonjgZjjgosAHVfjgrnjg6/jgqTjg5fjgZfj
gablubTjgpLpgbjmip7jgZnjgovjgYvjgIHjgr/jg4Pjg5fjgZfjgabml6Xku5jjga7pgbjmip7j
gavmiLvjgorjgb7jgZkAAgbjgr/jg5YABQ/jg4DjgqTjgqLjg63jgrAABhLjg4Tjg7zjg6vjg4Hj
g4Pjg5cADCTjg4Tjg7zjg6vjg4Hjg4Pjg5fjgpLooajnpLrjgZfjgb7jgZkADirjg4bjgq3jgrnj
g4jlhaXlipvjg6Ljg7zjg4njgavliIfjgormm7/jgYgACRnjg4njg6njg4PjgrAg44OP44Oz44OJ
44OrAAsh44OK44OT44Ky44O844K344On44Oz44Oh44OL44Ol44O8AA8t44OK44OT44Ky44O844K3
44On44Oz44Oh44OL44Ol44O844KS6ZaJ44GY44KLAAMJ44OT44OH44KqAAoc44OX44Or44OA44Km
44OzIOODoeODi+ODpeODvAAGEuODm+ODvOODoOOBq+aIu+OCiwAOKuODnOODiOODoOOCt+ODvOOD
iOOCkuaKmOOCiuOBn+OBn+OBv+OBvuOBmQALIeODnOODiOODoOOCt+ODvOODiOOCkumWieOBmOOB
vuOBmQALIeODnOODiOODoOOCt+ODvOODiOOCkumWi+OBjeOBvuOBmQALIeODneODg+ODl+OCouOD
g+ODl+OCpuOCo+ODs+ODieOCpgAFCeS4gOmDqCBPTgACBuS7iuaXpQAHFeWFpeWKm+OBleOCjOOB
n+aXpeS7mAANG+WFpeWKm+OBleOCjOOBn+aXpeS7mDogJTEkcwAMJOWFpeWKm+OBleOCjOOBn+ac
n+mWk+OBr+eEoeWKueOBp+OBmQAIGOWFpeWKm+WApOOBjOeEoeWKueOBp+OBmQACBuWFseaciQAH
FeWHpueQhuOBl+OBpuOBhOOBvuOBmQABA+WIhgAEDOWIhuOCkumBuOaKngAFD+WIh+OCiuabv+OB
iOOCiwAEDOWJjeOBq+aIu+OCiwAVP+WJjeOBruaciOOCkuihqOekuuOBmeOCi+OBq+OBr+OCueOC
r+ODreODvOODq+OBl+OBpuOBj+OBoOOBleOBhAAFD+WJjeaciOOBq+WkieabtAAKHuWNiOWJjeOB
vuOBn+OBr+WNiOW+jOOCkumBuOaKngACBuWujOS6hgAJEeW5tOOBq+enu+WLlSAlMSRzAAcV5bm0
44Gu6YG45oqe44Gr56e76KGMAAoe5bm044Gu6YG45oqe44OE44O844Or44Gu6KGo56S6AAIG5b+c
562UABk/5oOz5a6a44GV44KM44KL44OR44K/44O844Oz44Go5pel5LuY44GM5LiA6Ie044GX44G+
44Gb44KTOiAlMSRzAB9N5oOz5a6a44GV44KM44KL5bm044Gu56+E5Zuy77yIJTEkc++9niUyJHPv
vInjgYvjgonml6Xku5jjgYzlpJbjgozjgabjgYTjgb7jgZkABQ/mipjjgorjgZ/jgZ/jgoAAAgbm
i5LlkKYAAgbml6Xku5gABQ/ml6Xku5jjga7lhaXlipsABQ/ml6Xku5jjga7pgbjmip4ABQ/ml6Xk
u5jjgpLpgbjmip4ACBjml6Xku5jjgpLpgbjmip7jgZfjgb7jgZkABQ/mmYLliLvjgpLpgbjmip4A
AgbmmYLplpMAAwnmnKrpgbjmip4AAgbmpJzntKIAAwnmpJzntKLigKYABxXmpJzntKLjgq3jg7zj
g6/jg7zjg4kACh7mpJzntKLjgq3jg7zjg6/jg7zjg4njgpLliYrpmaQACh7mpJzntKLjgq3jg7zj
g6/jg7zjg4njgpLpgIHkv6EADCTmpJzntKLlgJnoo5zjga/mrKHjga7jgajjgYrjgorjgafjgZkA
FT/mrKHjga7mnIjjgpLooajnpLrjgZnjgovjgavjga/jgrnjgq/jg63jg7zjg6vjgZfjgabjgY/j
gaDjgZXjgYQACxXnj77lnKjjga7pgbjmip46ICUxJHMAAgbnnYDkv6EACyHnnYDkv6HjgpLjgrnj
gq/jg6rjg7zjg4vjg7PjgrDkuK0ABQ/nr4Tlm7Ljga7lhYjpoK0ABQ/nr4Tlm7Ljga7mnKvlsL4A
Awnnr4Tlm7LlhoUAAwnntYLkuobml6UABQ/nv4zmnIjjgavlpInmm7QAEiroqLHlj6/jgZXjgozj
gabjgYTjgarjgYTml6Xku5jjgafjgZk6ICUxJHMAAwnpgJroqbHkuK0ABAzpgJroqbHntYLkuoYA
BhLpgbjmip7jgZfjgZ/ml6Xku5gABAzpgbjmip7muIjjgb8ABhLplonjgZjjgabjgYTjgb7jgZkA
AwnplonjgZjjgosABhLplovjgYTjgabjgYTjgb7jgZkAAwnplovlp4vml6UABAzpn7Plo7DmpJzn
tKIABQ/vvIjliIbljZjkvY3vvIkABhLvvIjmmYLplpPljZjkvY3vvIkADh4lMSRkIOGDnuGDoOGD
neGDquGDlOGDnOGDouGDmC4AChQlMSRkIOGDoeGDkOGDkOGDl+GDmAAHCyUxJGQg4YOh4YOXAAcL
JTEkZCDhg6zhg5cAECQlMSRzLeGDluGDlCDhg5Lhg5Dhg5Phg5Dhg6Hhg5Xhg5rhg5AADyUlcy3h
g5jhg5cg4YOS4YOQ4YOW4YOY4YOQ4YOg4YOU4YOR4YOQABAi4YOQ4YOY4YOg4YOp4YOY4YOU4YOX
IEFNIOGDkOGDnCBQTQALH+GDkOGDmOGDoOGDqeGDmOGDlOGDlyDhg5Dhg57hg5gADijhg5Dhg5jh
g6Dhg6nhg5jhg5Thg5cg4YOX4YOQ4YOg4YOY4YOm4YOYAA0l4YOQ4YOY4YOg4YOp4YOY4YOU4YOX
IOGDoeGDkOGDkOGDl+GDmAAOKOGDkOGDmOGDoOGDqeGDmOGDlOGDlyDhg6zhg6Phg5fhg5Thg5Hh
g5gAETHhg5Dhg5vhg53hg5vhg67hg6Lhg5Dhg6Dhg5gg4YOk4YOQ4YOc4YOv4YOQ4YOg4YOQABpA
4YOQ4YOb4YOf4YOQ4YOb4YOY4YOc4YOT4YOU4YOa4YOYIOGDkOGDoOGDqeGDlOGDleGDkOGDnOGD
mDogJTEkcwAPKeGDkOGDoCDhg5Dhg6Dhg5jhg6Eg4YOQ4YOg4YOp4YOU4YOj4YOa4YOYAAgY4YOQ
4YOg4YOU4YOQ4YOa4YOo4YOY4YOQAAcV4YOQ4YOg4YOp4YOU4YOj4YOa4YOYAA4o4YOQ4YOg4YOp
4YOU4YOj4YOa4YOYIOGDl+GDkOGDoOGDmOGDpuGDmAAUOOGDkOGDoOGDqeGDlOGDo+GDmuGDmCDh
g6zhg5Thg5rhg5gg4YOu4YOY4YOa4YOj4YOa4YOY4YOQAAcV4YOQ4YOg4YOq4YOU4YOg4YOX4YOY
AChy4YOS4YOQ4YOT4YOQ4YOQ4YOQ4YOT4YOS4YOY4YOa4YOU4YOXIOGDqOGDlOGDm+GDk+GDkuGD
neGDm+GDmCDhg6zhg5rhg5Thg5Hhg5jhg6Eg4YOh4YOQ4YOp4YOV4YOU4YOc4YOU4YOR4YOa4YOQ
4YOTACVp4YOS4YOQ4YOT4YOQ4YOQ4YOQ4YOT4YOS4YOY4YOa4YOU4YOXIOGDqOGDlOGDm+GDk+GD
lOGDkuGDmCDhg5fhg5Xhg5jhg6Eg4YOh4YOQ4YOp4YOV4YOU4YOc4YOU4YOR4YOa4YOQ4YOTACJg
4YOS4YOQ4YOT4YOQ4YOQ4YOQ4YOT4YOS4YOY4YOa4YOU4YOXIOGDrOGDmOGDnOGDkCDhg5fhg5Xh
g5jhg6Eg4YOh4YOQ4YOp4YOV4YOU4YOc4YOU4YOR4YOa4YOQ4YOTACRm4YOS4YOQ4YOT4YOQ4YOQ
4YOQ4YOT4YOS4YOY4YOa4YOU4YOXIOGDrOGDmOGDnOGDkCDhg6zhg5rhg5Thg5Hhg5jhg6Eg4YOh
4YOQ4YOp4YOV4YOU4YOc4YOU4YOR4YOa4YOQ4YOTAAgY4YOS4YOQ4YOT4YOQ4YOg4YOX4YOV4YOQ
AEqAyuGDkuGDkOGDk+GDkOGDpOGDo+GDoOGDquGDmuGDlOGDlyDhg6zhg5rhg5jhg6Eg4YOQ4YOh
4YOQ4YOg4YOp4YOU4YOV4YOQ4YOTLCDhg5Dhg5wg4YOo4YOU4YOu4YOU4YOR4YOY4YOXIOGDkOGD
mOGDoOGDqeGDmOGDlOGDlyDhg5jhg6Hhg5Thg5Ug4YOT4YOm4YOY4YOhIOGDkOGDoOGDqeGDlOGD
leGDkOGDluGDlCDhg5Lhg5Dhg5Phg5Dhg6Dhg5fhg5Xhg5AAChzhg5Lhg5Dhg5bhg5jhg5Dhg6Dh
g5Thg5Hhg5A6AAcV4YOS4YOQ4YOX4YOY4YOo4YOV4YOQAAgY4YOS4YOQ4YOb4YOd4YOg4YOX4YOV
4YOQAAkb4YOS4YOQ4YOb4YOd4YOg4YOX4YOj4YOa4YOYAA0n4YOS4YOQ4YOk4YOQ4YOg4YOX4YOd
4YOU4YOR4YOj4YOa4YOY4YOQABEx4YOT4YOQ4YOh4YOg4YOj4YOa4YOU4YOR4YOY4YOhIOGDl+GD
kOGDoOGDmOGDpuGDmAAPK+GDk+GDkOGDrOGDp+GDlOGDkeGDmOGDoSDhg5fhg5Dhg6Dhg5jhg6bh
g5gABxXhg5Phg5Dhg67hg6Phg6Dhg5Xhg5AABxXhg5Phg5jhg5Dhg5rhg53hg5Lhg5gAFDrhg5Ph
g5jhg5Dhg57hg5Dhg5bhg53hg5zhg5jhg6Eg4YOT4YOQ4YOh4YOQ4YOh4YOg4YOj4YOa4YOYABQ6
4YOT4YOY4YOQ4YOe4YOQ4YOW4YOd4YOc4YOY4YOhIOGDk+GDkOGDoeGDkOGDrOGDp+GDmOGDoeGD
mAAEDOGDk+GDpuGDlOGDoQALH+GDlOGDoOGDl+GDmCDhg6Hhg5Dhg5Dhg5fhg5jhg5cABQ/hg5Xh
g5jhg5Phg5Thg50ADijhg5bhg5Thg5vhg53hg5cg4YOS4YOQ4YOT4YOQ4YOh4YOV4YOa4YOQABAu
4YOX4YOQ4YOg4YOY4YOm4YOU4YOR4YOY4YOhIOGDkOGDoOGDqeGDlOGDleGDkAARMeGDl+GDkOGD
oOGDmOGDpuGDlOGDkeGDmOGDoSDhg6jhg5Thg6fhg5Xhg5Dhg5zhg5AABhLhg5fhg5Dhg6Dhg5jh
g6bhg5gAN4CD4YOX4YOQ4YOg4YOY4YOm4YOYIOGDkOGDoCDhg5Dhg6Dhg5jhg6Eg4YOs4YOa4YOU
4YOR4YOY4YOhIOGDm+GDneGDoeGDkOGDmuGDneGDk+GDnOGDlOGDmiDhg5Phg5jhg5Dhg57hg5Dh
g5bhg53hg5zhg6jhg5ggJTEkcyAtICUyJHMAKmrhg5fhg5Dhg6Dhg5jhg6bhg5gg4YOQ4YOgIOGD
lOGDm+GDl+GDruGDleGDlOGDleGDkCDhg5vhg53hg6Hhg5Dhg5rhg53hg5Phg5zhg5Thg5og4YOc
4YOY4YOb4YOj4YOo4YOhOiAlMSRzABg64YOX4YOQ4YOg4YOY4YOm4YOYIOGDk+GDkOGDo+GDqOGD
leGDlOGDkeGDlOGDmuGDmOGDkDogJTEkcwAkZuGDmeGDkOGDmuGDlOGDnOGDk+GDkOGDoOGDqOGD
mCDhg6jhg5Thg6fhg5Xhg5Dhg5zhg5jhg6Eg4YOg4YOU4YOf4YOY4YOb4YOW4YOUIOGDkuGDkOGD
k+GDkOGDoOGDl+GDleGDkAAGEuGDm+GDluGDkOGDk+GDkOGDkAARMeGDm+GDl+GDkOGDleGDkOGD
oOGDluGDlCDhg5Lhg5Dhg5Phg5Dhg6Hhg5Xhg5rhg5AADijhg5vhg5jhg5vhg5Phg5jhg5zhg5Dh
g6Dhg5Qg4YOW4YOQ4YOg4YOYAAkb4YOb4YOY4YOc4YOY4YOo4YOc4YOU4YOR4YOQABI04YOb4YOY
4YOc4YOY4YOo4YOc4YOU4YOR4YOY4YOhIOGDqeGDleGDlOGDnOGDlOGDkeGDkAAUOuGDm+GDneGD
l+GDruGDneGDleGDnOGDmOGDoSDhg5Lhg5Dhg5Phg5Dhg5Lhg5bhg5Dhg5Xhg5zhg5AAFT3hg5vh
g53hg5fhg67hg53hg5Xhg5zhg5jhg6Eg4YOS4YOQ4YOh4YOj4YOk4YOX4YOQ4YOV4YOU4YOR4YOQ
AA8r4YOb4YOd4YOX4YOu4YOd4YOV4YOc4YOY4YOhIOGDq+GDmOGDlOGDkeGDkAAJG+GDm+GDo+GD
qOGDkOGDleGDk+GDlOGDkeGDkAAQLuGDnOGDkOGDleGDmOGDkuGDkOGDquGDmOGDmOGDoSDhg5vh
g5Thg5zhg5jhg6MAGUfhg5zhg5Dhg5Xhg5jhg5Lhg5Dhg6rhg5jhg5jhg6Eg4YOb4YOU4YOc4YOY
4YOj4YOhIOGDk+GDkOGDruGDo+GDoOGDleGDkAAXQ+GDnOGDkOGDrOGDmOGDmuGDneGDkeGDoOGD
mOGDlSDhg6jhg5Thg5vhg53hg6zhg5vhg5Thg5Hhg6Phg5rhg5jhg5AABhLhg57hg5Dhg6Hhg6Ph
g67hg5gADyvhg6Dhg5Dhg5vhg5Phg5Thg5zhg5jhg5vhg5Qg4YOs4YOj4YOX4YOY4YOXAAUP4YOh
4YOQ4YOQ4YOX4YOYABU94YOh4YOQ4YOu4YOU4YOa4YOj4YOg4YOYIOGDqeGDkOGDleGDmuGDlOGD
keGDmOGDoeGDl+GDleGDmOGDoQAPK+GDoeGDruGDleGDkCDhg5Xhg5Dhg6Dhg5jhg5Dhg5zhg6Lh
g5Thg5Hhg5gAIV3hg6Lhg5Thg6Xhg6Hhg6Lhg5jhg6Eg4YOo4YOU4YOn4YOV4YOQ4YOc4YOY4YOh
IOGDoOGDlOGDn+GDmOGDm+GDluGDlCDhg5Lhg5Dhg5Phg5Dhg6Dhg5fhg5Xhg5AABxXhg6Phg5Dh
g6Dhg6fhg53hg6Thg5AADyvhg6Thg6Phg6Dhg6rhg5rhg5jhg6Eg4YOT4YOQ4YOu4YOj4YOg4YOV
4YOQABM14YOl4YOV4YOU4YOT4YOQIOGDpOGDo+GDoOGDquGDmuGDmOGDoSDhg5Lhg5Dhg6jhg5rh
g5AAFTvhg6Xhg5Xhg5Thg5Phg5Ag4YOk4YOj4YOg4YOq4YOa4YOY4YOhIOGDo+GDkOGDoOGDp+GD
neGDpOGDkAAVO+GDpeGDleGDlOGDk+GDkCDhg6Thg6Phg6Dhg6rhg5rhg5jhg6Eg4YOp4YOQ4YOZ
4YOU4YOq4YOV4YOQAAwi4YOn4YOV4YOU4YOa4YOQ4YOhIOGDnOGDkOGDruGDleGDkAAVO+GDqOGD
lOGDm+GDk+GDlOGDkiDhg5fhg5Xhg5Thg5bhg5Qg4YOS4YOQ4YOT4YOQ4YOh4YOV4YOa4YOQABxQ
4YOo4YOU4YOb4YOd4YOX4YOQ4YOV4YOQ4YOW4YOU4YOR4YOU4YOR4YOYIOGDmOGDruGDmOGDmuGD
lOGDlyDhg6Xhg5Xhg5Thg5vhg53hg5cAHFDhg6jhg5Thg5vhg53hg5vhg5Dhg5Xhg5Dhg5rhg5gg
4YOW4YOQ4YOg4YOU4YOR4YOY4YOhIOGDkuGDkOGDquGDruGDoOGDmOGDmuGDleGDkAAPK+GDqOGD
lOGDm+GDneGDm+GDkOGDleGDkOGDmuGDmCDhg5bhg5Dhg6Dhg5gAEjThg6jhg5Thg5zhg5Dhg6Lh
g5Dhg5zhg5gg4YOQ4YOg4YOQ4YOh4YOs4YOd4YOg4YOY4YOQABY04YOo4YOU4YOn4YOV4YOQ4YOc
4YOY4YOa4YOYIOGDl+GDkOGDoOGDmOGDpuGDmDogJTEkcwAQLuGDqOGDlOGDp+GDleGDkOGDnOGD
mOGDmuGDmCDhg6Hhg5Dhg67hg5Thg5rhg5gAJ2/hg6jhg5Thg6fhg5Xhg5Dhg5zhg5jhg5rhg5jh
g5Ag4YOX4YOQ4YOg4YOY4YOm4YOU4YOR4YOY4YOhIOGDkOGDoOGDkOGDoeGDrOGDneGDoOGDmCDh
g5Phg5jhg5Dhg57hg5Dhg5bhg53hg5zhg5gABhLhg6jhg53hg6Dhg5jhg6Hhg5gABxXhg6nhg5Dh
g5nhg5Thg6rhg5Xhg5AACBjhg6nhg5Dhg5nhg5Thg6rhg5jhg5rhg5gAETHhg6nhg5Dhg5vhg53h
g6Hhg5Dhg6jhg5rhg5Thg5rhg5gg4YOb4YOU4YOc4YOY4YOjAAcV4YOp4YOQ4YOc4YOQ4YOg4YOX
4YOYAAYS4YOp4YOQ4YOg4YOX4YOV4YOQAAcV4YOp4YOQ4YOg4YOX4YOj4YOa4YOYAAUP4YOr4YOY
4YOU4YOR4YOQAAYS4YOr4YOY4YOU4YOR4YOQ4oCmABM14YOs4YOY4YOc4YOQIOGDl+GDleGDlOGD
luGDlCDhg5Lhg5Dhg5Phg5Dhg6Hhg5Xhg5rhg5AAFj7hg6zhg5rhg5jhg6Eg4YOQ4YOg4YOp4YOU
4YOV4YOQ4YOW4YOUIOGDkuGDkOGDk+GDkOGDoeGDleGDmuGDkAAEDOGDrOGDo+GDl+GDmAANJeGD
ruGDm+GDneGDleGDkOGDnOGDmCDhg6vhg5jhg5Thg5Hhg5AACRElMSRkIOComOCpsOCon+CphwAL
FyUxJGQg4Kir4Ki84KmA4Ki44Kim4KWkAAkRJTEkZCDgqK7gqL/gqbDgqJ8ACA4lMSRkIOCoteCo
nOCphwAQJiVzIOCoqOCovuCosiDgqLjgqL7gqILgqJ3gqL4g4KiV4Kiw4KmLAA4cQU0g4Kic4Ki+
4KiCIFBNIOComuCpgeCoo+CpiwAfU+CoheCol+CosuCoviDgqK7gqLngqYDgqKjgqL4g4Kim4Ki/
4KiW4Ki+4KiJ4KijIOCosuCoiCDgqLjgqJXgqY3gqLDgqYvgqLIg4KiV4Kiw4KmLABIu4KiF4KiX
4Kiy4KmHIOCoruCoueCpgOCoqOCphyAn4Kik4KmHIOConOCovuCokwAKHOCoheCoteCovuConOCo
vOCpgCDgqJbgqYvgqJwACx/gqIXgqLXgqYjgqKcg4KiH4Kio4Kiq4KmB4Kmx4KifAAsf4KiF4Ki4
4Ki14KmA4KiV4Ki+4KiwIOColeCosOCpiwAZQeCoheCpsOCouOCovOColSDgqKTgqYzgqLAg4Kik
4KmHIOConOCovuCoguComiDgqJXgqYDgqKTgqYAg4KiX4KiIAAMJ4KiF4Kmx4KicAAsf4KiH4Kio
4KiV4Kiu4Ki/4Kmw4KiXIOColeCovuCosgAnZ+Coh+CoqOColeCoruCov+CpsOColyDgqJXgqL7g
qLIg4Kim4KmAIOCouOColeCpjeCosOCpgOCoqOCov+CpsOColyDgqJXgqYDgqKTgqYAg4Kic4Ki+
IOCosOCoueCpgCDgqLngqYgAJF7gqIfgqKjgqKrgqYHgqbHgqJ8g4KiV4KmA4Kik4KmAIOCol+Co
iCDgqKTgqL7gqLDgqYDgqJYg4Kim4KmAIOCosOCph+CoguConCDgqIXgqLXgqYjgqKcg4Ki54KmI
AB5E4KiH4Ki4IOCopOCovuCosOCpgOColiDgqKbgqYAg4KiG4KiX4Ki/4KiGIOCoqOCoueCpgOCo
giDgqLngqYg6ICUxJHMAECrgqIfgqLgg4Kio4Ki+4KiyIOCouOCovuCoguConeCoviDgqJXgqLDg
qYsACx3gqIfgqbHgqJUg4KiQ4KiqIOComuCpgeCoo+CpiwAIFuCoieCpseCoquCosCDgqJzgqL7g
qJMAH1HgqJXgqYjgqLLgqbDgqKHgqLAg4KiH4Kio4Kiq4KmB4Kmx4KifIOCoruCpi+CooSAn4Kik
4KmHIOCouOCoteCov+CpseComiDgqJXgqLDgqYsACBbgqJXgqYvgqIgg4Kio4Ki54KmA4KiCAESA
ruColeCpi+CoiCDgqLjgqL7gqLIg4Kia4KmB4Kij4KioIOCosuCoiCDgqLjgqLXgqL7gqIjgqKog
4KiV4Kiw4KmLIOConOCovuCogiDgqJXgqYvgqIgg4Kim4Ki/4KioIOComuCpgeCoo+CoqCDgqLLg
qIgg4Ki14Ki+4Kiq4Ki4IOConOCovuCooyDgqLXgqL7gqLjgqKTgqYcg4Kif4KmI4KiqIOColeCo
sOCpiwAIFuColuCovuCosOConCDgqJXgqLDgqYsAAwngqJbgqYvgqJwADCLgqJbgqYvgqJwg4Kiq
4KmB4Kmx4Kib4KiX4Ki/4Kmx4KibAAQM4KiW4KmL4Kic4KmLAAQM4KiW4KmL4Kic4oCmABAs4KiY
4Ki44KmA4Kif4KijIOCoteCovuCosuCoviDgqLngqYjgqILgqKHgqLIACRngqJjgqbDgqJ/gqL4g
4Kia4KmB4Kij4KmLAAQM4KiY4Kmw4Kif4KmHAAcT4KiY4Kmw4Kif4KmHIOCosuCoiAAEDOComuCo
vuCosuCpggAHE+ComuCovuCosuCpgiDgqLngqYgABxPgqJrgqYHgqKPgqYAg4KiX4KiIAA0j4Kia
4KmB4Kij4KmAIOCol+CoiCDgqKTgqL7gqLDgqYDgqJYADCDgqJrgqYHgqKPgqYAg4Kio4Ki54KmA
4KiCIOCol+CoiAAIFuConOCoteCovuCorCDgqKbgqL/gqJMACBbgqJzgqL7gqLDgqYAg4KiV4Ki+
4KiyAAcT4Kic4Ki+4Kiw4KmAIOCoueCpiAAIFuCon+CpguCosi3gqJ/gqL/gqbHgqKoADibgqJ/g
qYLgqLIt4Kif4Ki/4Kmx4KiqIOCopuCov+ColuCovuCokwADCeCon+CpiOCorAAPKeCooeCpjeCo
sOCpjOCoqi3gqKHgqL7gqIrgqKgg4Kiu4KmA4Kio4KmCAAUP4Kik4Ki+4Kiw4KmA4KiWAAoc4Kik
4Ki+4Kiw4KmA4KiWIOComuCpgeCoo+CpiwAsbOCopOCovuCosOCpgOColiDgqLjgqbDgqK3gqL7g
qLXgqL/gqKQg4Kiq4KmI4Kif4Kiw4KioIOCoqOCovuCosiDgqK7gqYfgqLIg4Kio4Ki54KmA4KiC
IOColuCovuCoguCopuCpgDogJTEkcwAxbeCopOCovuCosOCpgOColiDgqLjgqbDgqK3gqL7gqLXg
qL/gqKQg4Ki44Ki+4KiyIOCopuCpgCDgqLDgqYfgqILgqJwg4Kik4KmL4KiCIOCorOCovuCoueCo
sCDgqLngqYggJTEkcyAtICUyJHMADCLgqKTgqL7gqLDgqYDgqJbgqL7gqIIg4Kia4KmB4Kij4KmL
ABAs4Kik4Ki+4Kiw4KmA4KiW4Ki+4KiCIOCopuCovuColuCosiDgqJXgqLDgqYsAEjDgqKbgqL7g
qJbgqLIg4KiV4KmA4Kik4KmAIOCol+CoiCDgqKTgqL7gqLDgqYDgqJYAGDbgqKbgqL7gqJbgqLIg
4KiV4KmA4Kik4KmAIOCol+CoiCDgqKTgqL7gqLDgqYDgqJY6ICUxJHMADijgqKjgqYjgqLXgqYDg
qJfgqYfgqLjgqLzgqKgg4Kiu4KmA4Kio4KmCABY84Kio4KmI4Ki14KmA4KiX4KmH4Ki44Ki84Kio
IOCoruCpgOCoqOCpgiDgqKzgqbDgqKYg4KiV4Kiw4KmLACpw4Kiq4Ki54Ki/4Kiy4Ki+4KiCIOCo
teCovuCosuCphyDgqLjgqL7gqLLgqL7gqIIg4Kio4KmC4KmwIOCopuCov+ColuCovuCoieCooyDg
qLLgqIgg4Ki44KiV4KmN4Kiw4KmL4KiyIOColeCosOCpiwAgVuCoquCov+Com+CosuCoviDgqK7g
qLngqYDgqKjgqL4g4Kim4Ki/4KiW4Ki+4KiJ4KijIOCosuCoiCDgqLjgqJXgqY3gqLDgqYvgqLIg
4KiV4Kiw4KmLABMx4Kiq4Ki/4Kib4Kiy4KmHIOCoruCoueCpgOCoqOCphyAn4Kik4KmHIOConOCo
vuCokwASMuCoquCpgeCpseCom+Col+Cov+CpseComyDgqJXgqLLgqYDgqIXgqLAg4KiV4Kiw4KmL
ABIy4Kiq4KmB4Kmx4Kib4KiX4Ki/4Kmx4KibIOCouOCoquCpgeCosOCopiDgqJXgqLDgqYsADSPg
qKrgqYzgqKot4KiF4Kmx4KiqIOCoteCov+CpsOCooeCpiwAoauCorOCovuCoheCopiDgqLXgqL7g
qLLgqYcg4Ki44Ki+4Kiy4Ki+4KiCIOCoqOCpguCpsCDgqKbgqL/gqJbgqL7gqIngqKMg4Kiy4KiI
IOCouOColeCpjeCosOCpi+CosiDgqJXgqLDgqYsAAwngqKzgqbDgqKYABhDgqKzgqbDgqKYg4Ki5
4KmIAAUP4Kiu4Ki/4Kif4Ki+4KiTAAQM4Kiu4Ki/4Kmw4KifAAkZ4Kiu4Ki/4Kmw4KifIOComuCp
geCoo+CpiwAJGeCoruCov+CpsOCon+CovuCogiDgqLLgqIgAECLgqK7gqYzgqJzgqYLgqKbgqL4g
4Kia4KmL4KijOiAlMSRzAAkZ4Kiw4KmH4KiC4KicIOCoteCov+CpseComgAKHOCosOCph+CoguCo
nCDgqLjgqK7gqL7gqKrgqKQAChzgqLDgqYfgqILgqJwg4Ki44Ki84KmB4Kiw4KmCAB1L4Kiy4Ki/
4KiW4KikIOCoh+CoqOCoquCpgeCpseConyDgqK7gqYvgqKEgJ+CopOCphyDgqLjgqLXgqL/gqbHg
qJog4KiV4Kiw4KmLAA8p4Ki14Ki/4Ki44Kik4Ki+4KiwIOColeCpgOCopOCoviDgqJfgqL/gqIYA
BQ/gqLXgqL/gqbDgqKHgqYsABQ/gqLXgqYDgqKHgqYDgqJMABxPgqLjgqK0g4Kim4KmH4KiW4KmL
AAkZ4Ki44Kiu4Ki+4Kiq4KikIOColeCosOCpiwAMIuCouOCoruCovuCoquCopOCpgCDgqKTgqL7g
qLDgqYDgqJYAChzgqLjgqK7gqYfgqJ/gqL/gqIYg4KiX4Ki/4KiGAAUP4Ki44Kiu4KmH4Kif4KmL
AAkZ4Ki44Ki14Ki/4Kmx4KiaIOColeCosOCpiwAMIOCouOCovOCpgOConyDgqKzgqbDgqKYg4KiV
4Kiw4KmLAA8r4Ki44Ki84KmB4KmB4Kiw4KmC4KiG4Kik4KmAIOCopOCovuCosOCpgOColgAQIOCo
uOCovuCosiAlMSRzICfgqKTgqYcg4Kic4Ki+4KiTABU34Ki44Ki+4KiyIOComuCpgeCoo+CoqCDg
qLLgqIgg4Ki44Ki14Ki/4Kmx4KiaIOColeCosOCpiwAVOeCouOCovuCosiDgqJrgqYvgqKPgqJXg
qL7gqLAg4Kim4Ki/4KiW4Kij4Kiv4KmL4KiXIOCoueCpiAAOJuCouOCpgeConeCovuCohSDgqLng
qYfgqKDgqL7gqIIg4Ki54KioABhA4Ki54KmH4Kig4Kiy4KmAIOCouOCovOCpgOConyDgqKbgqL4g
4Ki14Ki/4Ki44Kik4Ki+4KiwIOColeCosOCpiwAXPeCoueCph+CooOCosuCpgCDgqLjgqLzgqYDg
qJ8g4Kio4KmC4KmwIOColuCovuCosOConCDgqJXgqLDgqYsAFDbgqLngqYfgqKDgqLLgqYAg4Ki4
4Ki84KmA4KifIOCoqOCpguCpsCDgqLjgqK7gqYfgqJ/gqYsABhDgqLngqYsg4KiX4Ki/4KiGAAsb
4Ki54KmL4KiuICfgqKTgqYcg4Kic4Ki+4KiTAAkZ4Ki54KmL4KiwIOCoteCov+ColeCosuCoqgAN
GyUxJGQg4K6a4K6k4K614K+A4K6k4K6u4K+NLgAPIyUxJGQg4K6o4K6/4K6u4K6/4K6f4K6Z4K+N
4K6V4K6z4K+NAAgOJTEkZCDgrq7grqPgrr8ADR0lMSRkIOCuruCuo+Cuv+CuqOCvh+CusOCuruCv
jQATLyUxJHPgrpXgr43grpXgr4Hgrprgr40g4K6a4K+G4K6y4K+N4K6y4K+B4K6u4K+NAA4iJXMg
4K6u4K+C4K6y4K6u4K+NIOCuquCuleCuv+CusOCvjQAgUkFNL1BNIOCujuCuqeCvjeCuquCupOCv
iOCupOCvjSDgrqTgr4fgrrDgr43grqjgr43grqTgr4bgrp/gr4HgrpXgr43grpXgrrLgrr7grq7g
r40ACxlBbHQg4K6u4K6x4K+N4K6x4K+B4K6u4K+NAAwaQ3RybCDgrq7grrHgr43grrHgr4Hgrq7g
r40AEB5GdW5jdGlvbiDgrq7grrHgr43grrHgr4Hgrq7gr40ADBpNZW51IOCuruCuseCvjeCuseCv
geCuruCvjQAMGk1ldGEg4K6u4K6x4K+N4K6x4K+B4K6u4K+NAA0bU2hpZnQg4K6u4K6x4K+N4K6x
4K+B4K6u4K+NAAsZU3ltIOCuruCuseCvjeCuseCvgeCuruCvjQAZR+CuheCun+CvgeCupOCvjeCu
pCDgrq7grr7grqTgrqTgr43grqTgrr/grrHgr43grpXgr4Eg4K6u4K6+4K6x4K+N4K6x4K+BAC1/
4K6F4K6f4K+B4K6k4K+N4K6kIOCuruCuvuCupOCupOCvjeCupOCviOCuquCvjSDgrqrgrr7grrDg
r43grpXgr43grpUg4K644K+N4K6V4K+N4K6w4K+L4K6y4K+NIOCumuCvhuCur+CvjeCur+CvgeCu
meCvjeCuleCus+CvjQASNOCuheCuqeCviOCupOCvjeCupOCviOCur+CvgeCuruCvjSDgrpXgrr7g
rp/gr43grp/gr4EABAzgrobgroPgrqrgr40AL4CH4K6G4K6j4K+N4K6f4K+I4K6k4K+NIOCupOCv
h+CusOCvjeCuqOCvjeCupOCvhuCun+CvgeCuleCvjeCuleCvgeCuruCvjSDgrrXgrr/grrDgr4Hg
rqrgr43grqrgrqTgr43grqTgrr/grrHgr43grpXgr4Eg4K6u4K6+4K6x4K+N4K6x4K+BAGyBMOCu
huCuo+CvjeCun+CviOCupOCvjSDgrqTgr4fgrrDgr43grrXgr4Hgrprgr4bgrq/gr43grq8g4K64
4K+N4K614K+I4K6q4K+NIOCumuCvhuCur+CvjeCur+CvgeCumeCvjeCuleCus+CvjSDgroXgrrLg
r43grrLgrqTgr4Eg4K6k4K+H4K6k4K6/4K6v4K+I4K6k4K+NIOCupOCvh+CusOCvjeCuteCvgeCu
muCvhuCur+CvjeCur+CvgeCuruCvjSDgrqrgrpXgr43grpXgrqTgr43grqTgrr/grrHgr43grpXg
r4Eg4K6u4K+A4K6j4K+N4K6f4K+B4K6u4K+NIOCumuCvhuCusuCvjeCusiDgrqTgrp/gr43grp/g
r4Hgrpngr43grpXgrrPgr40ALYCB4K6G4K6j4K+N4K6f4K+I4K6k4K+NIOCupOCvh+CusOCvjeCu
teCvgeCumuCvhuCur+CvjeCur+CvgeCuruCvjSDgrqrgrpXgr43grpXgrq7gr40g4K6V4K6+4K6f
4K+N4K6f4K6q4K+N4K6q4K6f4K+B4K6V4K6/4K6x4K6k4K+BAAMJ4K6G4K6p4K+NABM34K6G4K6q
4K+N4K644K+I4K6k4K+NIOCupOCvh+CusOCvjeCuteCvgeCumuCvhuCur+CvjeCulQALH+Cuh+Cu
pOCuv+CusuCvjSDgrqrgrpXgrr/grrDgr40AMHDgrofgrqjgr43grqTgrqTgr40g4K6k4K+H4K6k
4K6/ICUxJHMgLSAlMiRzIOCuhuCuo+CvjeCun+CvgSDgrrXgrrDgrq7gr43grqrgrr/grrHgr43g
rpXgr4HgrrPgr40g4K6H4K6y4K+N4K6y4K+IACVf4K6H4K6o4K+N4K6k4K6k4K+NIOCupOCvh+Cu
pOCuvyDgroXgrqngr4Hgrq7grqTgrr/grpXgr43grpXgrqrgr43grqrgrp/grrXgrr/grrLgr43g
rrLgr4g6ICUxJHMABQ/grofgrqngr43grrHgr4EAETPgrofgrq/grpXgr43grpXgrqrgr43grqrg
rp/gr43grp/gr4HgrrPgr43grrPgrqTgr4EAFT3grofgrrTgr4Hgrqrgr43grqrgrqTgrrHgr43g
rpXgrr7grqkg4K654K+H4K6j4K+N4K6f4K6/4K6y4K+NAA4q4K6J4K6k4K614K6/4K6V4K+N4K6V
4K+B4K6x4K6/4K6q4K+N4K6q4K+BABdD4K6J4K6k4K614K6/4K6V4K+N4K6V4K+B4K6x4K6/4K6q
4K+N4K6q4K+I4K6V4K+NIOCuleCuvuCun+CvjeCun+CvgQAIGOCuieCusOCviOCur+CuvuCun+Cu
suCvjQANJeCuieCus+CvjeCus+Cuv+Cun+CvjeCunyDgrqTgr4fgrqTgrr8AEyvgrongrrPgr43g
rrPgrr/grp/gr43grp8g4K6k4K+H4K6k4K6/OiAlMSRzABAu4K6J4K6z4K+N4K614K6w4K+B4K6u
4K+NIOCuheCutOCviOCuquCvjeCuquCvgQAmbOCuieCus+CvjeCuteCusOCvgeCuruCvjSDgroXg
rrTgr4jgrqrgr43grqrgr4gg4K6u4K6k4K6/4K6q4K+N4K6q4K6+4K6v4K+N4K614K+BIOCumuCv
huCur+CvjeCuleCuv+CuseCupOCvgQA5gJngro7grqTgrr/grrDgr43grqrgrr7grrDgr43grpXg
r43grpXgrqrgr43grqrgrp/gr4Hgrq7gr40g4K6q4K+H4K6f4K+N4K6f4K6w4K+N4K6p4K+B4K6f
4K6p4K+NIOCupOCvh+CupOCuvyDgrqrgr4rgrrDgr4Hgrqjgr43grqTgrrXgrr/grrLgr43grrLg
r4g6ICUxJHMAIV3gro7grrTgr4HgrqTgr43grqTgr4Eg4K6J4K6z4K+N4K6z4K+A4K6f4K+N4K6f
4K+BIOCuruCvgeCuseCviOCuleCvjeCuleCvgSDgrq7grr7grrHgr43grrHgr4EACRvgro/grqTg
r4Hgrq7grr/grrLgr43grrLgr4gAEjTgrpXgr4DgrrTgr43grqTgr43grqTgr4vgrqngr43grrHg
rrLgr40g4K6u4K+G4K6p4K+BACBc4K6V4K+A4K604K+N4K6q4K+N4K6q4K+B4K6x4K6a4K+NIOCu
muCvgOCun+CvjeCun+CviCDgrqjgrr/grrDgrr7grpXgrrDgrr/grpXgr43grpXgr4Hgrq7gr40A
H1ngrpXgr4DgrrTgr43grqrgr43grqrgr4HgrrHgrprgr40g4K6a4K+A4K6f4K+N4K6f4K+IIOCu
teCuv+CusOCuv+CuteCuvuCuleCvjeCuleCvgeCuruCvjQAfWeCuleCvgOCutOCvjeCuquCvjeCu
quCvgeCuseCumuCvjSDgrprgr4Dgrp/gr43grp/gr4jgrprgr40g4K6a4K+B4K6w4K+B4K6V4K+N
4K6V4K+B4K6u4K+NAAsf4K6V4K+B4K6w4K6y4K+NIOCupOCvh+Cun+CusuCvjQAjY+CuleCvh+Cu
suCvhuCuo+CvjeCun+CusOCvjSDgrongrrPgr43grrPgr4Dgrp/gr43grp/gr4Eg4K6u4K+B4K6x
4K+I4K6V4K+N4K6V4K+BIOCuruCuvuCuseCvjeCuseCvgQAkaOCumuCuv+CusiDgrq7grp/gr43g
rp/gr4Hgrq7gr4cg4K6k4K+H4K6w4K+N4K6o4K+N4K6k4K+G4K6f4K+B4K6V4K+N4K6V4K6q4K+N
4K6q4K6f4K+N4K6f4K+B4K6z4K+N4K6z4K6pAA8t4K6a4K+B4K6w4K+B4K6V4K+N4K6V4K6q4K+N
4K6q4K6f4K+N4K6f4K6k4K+BAAoe4K6a4K+B4K6w4K+B4K6V4K+N4K6V4K+B4K6u4K+NAAwk4K6a
4K+G4K6v4K6y4K6/4K6y4K+B4K6z4K+N4K6z4K6k4K+BABlH4K6a4K+G4K6v4K6y4K6/4K6y4K+N
IOCuh+CusOCvgeCuleCvjeCuleCvgeCuruCvjSDgroXgrrTgr4jgrqrgr43grqrgr4EAJGDgrqTg
rrHgr43grqrgr4vgrqTgr4EgJTEkcyDgrqTgr4fgrrDgr43grrXgr4Hgrprgr4bgrq/gr43grq/g
rqrgr43grqrgrp/gr43grp/gr4HgrrPgr43grrPgrqTgr4EADSXgrqTgrrXgrrHgrr7grqkg4K6J
4K6z4K+N4K6z4K+A4K6f4K+BACRm4K6k4K614K6x4K6+4K6pIOCupOCvh+CupOCuvyDgrrXgrrDg
rq7gr43grqrgr4gg4K6J4K6z4K+N4K6z4K6/4K6f4K+N4K6f4K+B4K6z4K+N4K6z4K+A4K6w4K+N
4K6V4K6z4K+NAAYS4K6k4K+B4K6j4K+N4K6f4K6/AAcV4K6k4K+H4K6f4K6y4K6+4K6u4K+NAAUP
4K6k4K+H4K6f4K6y4K+NAAwi4K6k4K+H4K6f4K6y4K+NIOCuteCuv+CuqeCuteCusuCvjQAGEuCu
pOCvh+Cun+CvgeCuleKApgAGEuCupOCvh+Cun+CvgeCuruCvjQAEDOCupOCvh+CupOCuvwAUOuCu
pOCvh+CupOCuv+CuleCus+CviCDgrongrrPgr43grrPgrr/grp/gr4Hgrpngr43grpXgrrPgr40A
GUngrqTgr4fgrqTgrr/grpXgrrPgr4jgrqTgr40g4K6k4K+H4K6w4K+N4K6o4K+N4K6k4K+G4K6f
4K+B4K6Z4K+N4K6V4K6z4K+NABpM4K6k4K+H4K6k4K6/4K6v4K+I4K6k4K+NIOCupOCvh+CusOCv
jeCuqOCvjeCupOCvhuCun+CvgeCuleCvjeCuleCuteCvgeCuruCvjQAaTOCupOCvh+CupOCuv+Cu
r+CviOCupOCvjSDgrqTgr4fgrrDgr43grrXgr4Hgrprgr4bgrq/gr43grq/gr4Hgrpngr43grpXg
rrPgr40AF0XgrqTgr4fgrrDgr43grqjgr43grqTgr4bgrp/gr4HgrpXgr43grpXgrqrgr43grqrg
rp/grrXgrr/grrLgr43grrLgr4gAGEbgrqTgr4fgrrDgr43grqjgr43grqTgr4bgrp/gr4HgrpXg
r43grpXgrqrgr43grqrgrp/gr43grp8g4K6k4K+H4K6k4K6/ABlL4K6k4K+H4K6w4K+N4K6o4K+N
4K6k4K+G4K6f4K+B4K6V4K+N4K6V4K6q4K+N4K6q4K6f4K+N4K6f4K+B4K6z4K+N4K6z4K6k4K+B
AA0l4K6k4K+K4K6f4K6V4K+N4K6V4K6k4K+NIOCupOCvh+CupOCuvwAOKuCuqOCuv+CuruCuv+Cu
n+CumeCvjeCuleCus+CvgeCuleCvjeCuleCvgQAeWOCuqOCuv+CuruCuv+Cun+CumeCvjeCuleCu
s+CviOCupOCvjSDgrqTgr4fgrrDgr43grqjgr43grqTgr4bgrp/gr4HgrpXgr43grpXgrrLgrr7g
rq7gr40ABxXgrqjgrr/grq7grr/grp/grq7gr40ABxXgrqjgrr/grrDgrr7grpXgrrDgrr8ABhLg
rqrgrqTgrr/grrLgrrPgrr8AHFDgrqrgrrDgrr/grqjgr43grqTgr4HgrrDgr4jgrpXgrrPgr40g
4K6V4K+A4K604K+HIOCuleCuv+Cun+CviOCuleCvjeCuleCvgeCuruCvjQAPKeCuquCuvuCuquCv
jS3groXgrqrgr40g4K6a4K6+4K6z4K6w4K6u4K+NAC+AheCuquCuv+CuqOCvjeCupOCviOCuryDg
robgrqPgr43grp/gr4HgrpXgrrPgr4jgrqrgr40g4K6q4K6+4K6w4K+N4K6V4K+N4K6VIOCuuOCv
jeCuleCvjeCusOCvi+CusuCvjSDgrprgr4bgrq/gr43grq/gr4Hgrpngr43grpXgrrPgr40ABhLg
rqrgrr/grrDgrr/grrXgr4EADirgrq7grqPgrr/grqjgr4fgrrDgrqTgr43grqTgrr/grrHgr43g
rpXgr4EAHljgrq7grqPgrr/grqjgr4fgrrDgrqTgr43grqTgr4jgrqTgr40g4K6k4K+H4K6w4K+N
4K6o4K+N4K6k4K+G4K6f4K+B4K6V4K+N4K6V4K6y4K6+4K6u4K+NAAgY4K6u4K6j4K6/4K6o4K+H
4K6w4K6u4K+NAAkb4K6u4K6+4K6x4K+N4K6x4K+B4K6k4K6y4K+NABZA4K6u4K+B4K6V4K6q4K+N
4K6q4K6/4K6x4K+N4K6V4K+B4K6a4K+NIOCumuCvhuCusuCvjeCusuCvgeCuruCvjQASNuCuruCv
geCun+CuleCvjeCuleCuquCvjeCuquCun+CvjeCun+CvgeCus+CvjeCus+CupOCvgQAJG+CuruCv
geCun+Cuv+CuqOCvjeCupOCupOCvgQANJeCuruCvgeCun+Cuv+CuteCvgeCupOCvjSDgrqTgr4fg
rqTgrr8AL4CF4K6u4K+B4K6o4K+N4K6k4K+I4K6vIOCuhuCuo+CvjeCun+CvgeCuleCus+CviOCu
quCvjSDgrqrgrr7grrDgr43grpXgr43grpUg4K644K+N4K6V4K+N4K6w4K+L4K6y4K+NIOCumuCv
huCur+CvjeCur+CvgeCumeCvjeCuleCus+CvjQAaSuCuruCvgeCuqOCvjeCupOCviOCuryDgrq7g
rr7grqTgrqTgr43grqTgrr/grrHgr43grpXgr4Eg4K6u4K6+4K6x4K+N4K6x4K+BAC6AguCuruCv
geCuqOCvjeCupOCviOCuryDgrq7grr7grqTgrqTgr43grqTgr4jgrqrgr40g4K6q4K6+4K6w4K+N
4K6V4K+N4K6VIOCuuOCvjeCuleCvjeCusOCvi+CusuCvjSDgrprgr4bgrq/gr43grq/gr4Hgrpng
r43grpXgrrPgr40ABhLgrq7gr4Lgrp/gr4Hgrq7gr40AEzfgrq7gr4fgrrLgr4Hgrq7gr40g4K61
4K6/4K6w4K+B4K6q4K+N4K6q4K6Z4K+N4K6V4K6z4K+NAA0l4K6u4K+H4K6y4K+HIOCumuCvhuCu
suCvjeCusuCvgeCuruCvjQATN+CuteCusOCuruCvjeCuquCuv+CuseCvjeCuleCvgeCus+CvjSDg
rongrrPgr43grrPgrqTgr4EADyvgrrXgrrDgrq7gr43grqrgr4Eg4K6k4K+K4K6f4K6V4K+N4K6V
4K6u4K+NAA0l4K614K6w4K6u4K+N4K6q4K+BIOCuruCvgeCun+Cuv+CuteCvgQARMeCuteCutOCu
v+CumuCvhuCusuCvgeCupOCvjeCupOCusuCvjSDgrq7gr4bgrqngr4EAGkrgrrXgrrTgrr/grprg
r4bgrrLgr4HgrqTgr43grqTgrrLgr40g4K6u4K+G4K6p4K+B4K614K+IIOCuruCvguCun+CvgeCu
ruCvjQAQLuCuteCuv+CuqeCuteCusuCviCDgroXgrrTgrr/grpXgr43grpXgr4Hgrq7gr40AF0Pg
rrXgrr/grqngrrXgrrLgr4jgrprgr40g4K6a4K6u4K6w4K+N4K6q4K+N4K6q4K6/4K6V4K+N4K6V
4K+B4K6u4K+NAA8t4K614K6/4K6w4K6/4K6V4K+N4K6V4K6q4K+N4K6q4K6f4K+N4K6f4K6k4K+B
AAYS4K614K+A4K6f4K6/4K6v4K+LAA0l4K634K+A4K6f4K+N4K6f4K+IIOCuruCvguCun+CvgeCu
ruCvjQANDSUxJGQgcHJvc2VudC4AAgJBVgALC0FuZ2l0dCBkYXRvABERQW5naXR0IGRhdG86ICUx
JHMAAgJBdgAFBUF2dmlzAAYGQnJ5dGVyACIiQnl0dCB0aWwga2FsZW5kZXJtb2R1cyBmb3IgaW5u
ZGF0YQAfH0J5dHQgdGlsIHRla3N0bW9kdXMgZm9yIGlubmRhdGEAFhhCeXR0IHRpbCDDpSB2ZWxn
ZSBldCDDpXIAHBxEYXRvZW4gZXIgaWtrZSB0aWxsYXR0OiAlMSRzADk8RGF0b2VuIGVyIHV0ZW5m
b3IgZGV0IGZvcnZlbnRlZGUgw6Vyc2ludGVydmFsbGV0ICUxJHPigJMlMiRzADIzRGF0b2VuIG1h
dGNoZXIgaWtrZSBkZXQgZm9ydmVudGVkZSBtw7huc3RlcmV0OiAlMSRzAA8PRGVsdmlzIGF2bWVy
a2V0ABoaRHUgZmlubmVyIGZvcnNsYWcgbmVkZW5mb3IAJSVFbiB1Z3lsZGlnIGRhdGFwZXJpb2Rl
IGVyIHNrcmV2ZXQgaW5uABcYRW5kcmUgdGlsIGZvcnJpZ2UgbcOlbmVkABUWRW5kcmUgdGlsIG5l
c3RlIG3DpW5lZAAGBkZlcmRpZwAeHkZpbHRyZXJlciBldCBpbm5rb21tZW5kZSBhbnJvcAASEkZs
ZXJlIGFsdGVybmF0aXZlcgAODkZvcmdydW5uc3ZpbmR1AAkJRnVua3Nqb24rAAYHR8OlIG9wcAAO
EEfDpSB0aWwgw6VyICUxJHMABwhIw6VuZHRhawAQEElubmVuIHJla2tldmlkZGUAERFJbm5rb21t
ZW5kZSBhbnJvcAAPD0xlZ2cgaW5uIGRhdG9lcgAHCExlZ2cgcMOlAAQETHVrawAKCkx1a2sgYXJr
ZXQAExNMdWtrIGZlbHRldCBuZWRlcnN0ABYWTHVrayBuYXZpZ2Fzam9uc21lbnllbgAFBU1lbnkr
AAYGTWludXR0AA8PTmF2aWdhc2pvbnNtZW55AAwMTmF2aWdlciBoamVtAAsMT21yw6VkZXNsdXR0
AAsMT21yw6VkZXN0YXJ0AAIDUMOFAAIDUMOlABASUMOlZ8OlZW5kZSBzYW10YWxlAAUHUMOlZ8Ol
cgAjJVJ1bGwgZm9yIMOlIHZpc2UgZGVuIGZvcnJpZ2UgbcOlbmVkZW4AISNSdWxsIGZvciDDpSB2
aXNlIGRlbiBuZXN0ZSBtw6VuZWRlbgAZG1J1bGwgZm9yIMOlIHZpc2Ugc2VuZXJlIMOlcgAcHlJ1
bGwgZm9yIMOlIHZpc2UgdGlkbGlnZXJlIMOlcgAPD1J1bGxlZ2FyZGlubWVueQAUFFNranVsIGZl
bHRldCBuZWRlcnN0AAsMU2xldHQgc8O4a2V0AAkJU2x1dHRkYXRvAAQEU3ZhcgBFSFN2ZWlwIGZv
ciDDpSB2ZWxnZSDDpXIsIGVsbGVyIHRyeWtrIGZvciDDpSBieXR0ZSB0aWxiYWtlIHRpbCB2YWxn
IGF2IGRhZwADBFPDuGsABwhTw7hrZW9yZAAHCFRhbGVzw7hrABAQVWd5bGRpZ2UgaW5uZGF0YQAL
DVV0ZsO4ciBzw7hrZXQACwtWYWxndDogJTEkcwAQEFZlbGcgQU0gZWxsZXIgUE0ACQlWZWxnIGRh
dG8ACwtWZWxnIGRhdG9lcgALC1ZlbGcgZW4gYXBwAA0NVmVsZyBtaW51dHRlcgAJCVZlbGcgdGlt
ZQALDFZlcmt0w7h5dGlwcwASElZpcyBmZWx0ZXQgbmVkZXJzdAAPEFZpcyB2ZXJrdMO4eXRpcHMA
BQVWaXNlcwAJCWZvciB0aW1lcgAJCW1lbGxvbXJvbQAFBXNsZXR0ABUWw4Vyc3ZlbGdlcmVuIGVy
IHN5bmxpZwAJDSUxJGQg0LPQsNC00LcABwklMSRkINGF0LIABQZBbHTCoCsABgdDdHJswqArAAYG
RGVsZXRlAAUFRW50ZXIABAVGbsKgKwAGB01ldGHCoCsABwhTaGlmdMKgKwAFBlN5bcKgKwAOG9CQ
0LHQsNCz0YPQu9GW0YbRjCDQv9GA0LDQtwAcMdCQ0LHQsNCz0YPQu9GW0YbRjCDQv9GA0LDQtyDQ
v9GA0LDQs9GA0LDQvNGDICIlcyIACBDQkNC00LrQsNC30LDRhtGMAA8d0JDQtNC/0YDQsNCy0ZbR
htGMINC30LDQv9GL0YIACBDQkNC00YXRltC70ZbRhtGMABw10JHQsNGH0L3RiyDRltC90YHRgtGA
0YPQvNC10L3RgiDQstGL0LHQsNGA0YMg0LPQvtC00LAAEB/QkdC10Lcg0LDQsdC80LXQttCw0LLQ
sNC90L3Rj9GeABId0JHRj9Cz0YPRh9GLINCy0YvQsdCw0YA6ICUxJHMADRnQkdGP0LPRg9GH0Ysg
0LLRi9C60LvRltC6AAUJ0JLQq9Ca0JsuAC1L0JLRi9Cx0LXRgNGL0YbQtSBBTSAo0LTQsCDQv9Cw
0Z7QtNC90Y8pINCw0LHQviBQTSAo0L/QsNGB0LvRjyDQv9Cw0Z7QtNC90Y8pABAf0JLRi9Cx0LXR
gNGL0YbQtSDQs9Cw0LTQt9GW0L3RiwANGdCS0YvQsdC10YDRi9GG0LUg0LTQsNGC0YMADRnQktGL
0LHQtdGA0YvRhtC1INC00LDRgtGLABEh0JLRi9Cx0LXRgNGL0YbQtSDQv9GA0LDQs9GA0LDQvNGD
ABAf0JLRi9Cx0LXRgNGL0YbQtSDRhdCy0ZbQu9GW0L3RiwAHDtCS0YvQsdGA0LDQvdCwABAf0JLR
i9Cx0YDQsNC90LAg0YfQsNGB0YLQutC+0LLQsAANGdCS0YvQsdGA0LDQvdCw0Y8g0LTQsNGC0LAA
DhvQktGL0LTQsNC70ZbRhtGMINC30LDQv9GL0YIACRLQktGL0LrQu9GO0YfQsNC90LAADRnQktGL
0L/QsNC00L3QvtC1INC80LXQvdGOAAUK0JLRltC00Y3QsAAHDtCT0LDQtNC30ZbQvdGLAA4b0JPQ
sNC70LDRgdCw0LLRiyDQv9C+0YjRg9C6AAYM0JPQsNGC0L7QstCwABQn0JTQsNC00LDRgtC60L7Q
stGL0Y8g0L/QsNGA0LDQvNC10YLRgNGLAAQI0JTQsNGC0LAANFnQlNCw0YLQsCDQstGL0YXQvtC0
0LfRltGG0Ywg0LfQsCDQtNCw0LfQstC+0LvQtdC90Ysg0LTRi9GP0L/QsNC30L7QvSDQs9Cw0LTQ
vtGeICUxJHMtJTIkcwAVI9CU0LDRgtCwINC30LDQsdCw0YDQvtC90LXQvdCwOiAlMSRzAA8d0JTQ
sNGC0LAg0LfQsNC60LDQvdGH0Y3QvdC90Y8AHTHQlNCw0YLQsCDQvdC1INCw0LTQv9Cw0LLRj9C0
0LDQtSDRntC30L7RgNGDOiAlMSRzAAwX0JTQsNGC0LAg0L/QsNGH0LDRgtC60YMADx3QlNGL0Y/Q
u9C+0LPQsNCy0LDQtSDQsNC60L3QvgAJEtCX0LDQstGP0YDRiNGL0YbRjAAHDtCX0LDQutGA0YvR
htGMAA0Z0JfQsNC60YDRi9GG0Ywg0LDRgNC60YPRiAAWKtCX0LDQutGA0YvRhtGMINC80LXQvdGO
INC90LDQstGW0LPQsNGG0YvRlgATJNCX0LDQutGA0YvRhtGMINC90ZbQttC90ZYg0LDRgNC60YPR
iAAIENCX0LPQsNGA0L3Rg9GG0YwAFCbQl9Cz0LDRgNC90YPRhtGMINC90ZbQttC90ZYg0LDRgNC6
0YPRiAAIENCX0LPQvtGA0L3Rg9GC0LAADhvQmtCw0L3QtdGGINC/0LXRgNCw0LvRltC60YMAEyXQ
nNCw0YDQutC10YAg0L/QtdGA0LDRhtGP0LPQstCw0L3QvdGPAA4b0JzQtdC90Y4g0L3QsNCy0ZbQ
s9Cw0YbRi9GWAAYL0JzQtdC90Y7CoCsAChPQndC1INCy0YvQsdGA0LDQvdCwAAgQ0J/QsNC00LrQ
sNC30LrQsAAMF9Cf0LDQutCw0LfQsNGG0Ywg0YPRgdC1AB880J/QsNC60LDQt9Cy0LDRhtGMINGD
0YHQv9C70YvQstCw0LvRjNC90YPRjiDQv9Cw0LTQutCw0LfQutGDAA0Z0J/QsNC80YvQu9C60LAg
0Z7QstC+0LTRgwAQH9Cf0LDRh9Cw0YLQsNC6INC/0LXRgNCw0LvRltC60YMAFyvQn9C10YDQsNC5
0YHRhtGWINC00LAg0LLRi9Cx0LDRgNGDINCz0L7QtNCwAB030J/QtdGA0LDQudGB0YbRliDQtNCw
INC90LDRgdGC0YPQv9C90LDQs9CwINC80LXRgdGP0YbQsAAeOdCf0LXRgNCw0LnRgdGG0ZYg0LTQ
sCDQv9Cw0L/Rj9GA0Y3QtNC90Y/Qs9CwINC80LXRgdGP0YbQsAAdN9Cf0LXRgNCw0LnRgdGG0ZYg
0L3QsCDQs9Cw0LvQvtGe0L3Rg9GOINGB0YLQsNGA0L7QvdC60YMAEx/Qn9C10YDQsNC50YHRhtGW
INGeINCz0L7QtCAlMSRzAA4b0J/QtdGA0LDQudGB0YbRliDRntCy0LXRgNGFAA4c0J/QtdGA0LDQ
utC70Y7Rh9Cw0LvRjNC90ZbQugAlRNCf0LXRgNCw0LrQu9GO0YfRi9GG0YbQsCDRniDRgNGN0LbR
i9C8INGD0LLQvtC00YMgItCa0LDQu9GP0L3QtNCw0YAiACI+0J/QtdGA0LDQutC70Y7Rh9GL0YbR
htCwINGeINGA0Y3QttGL0Lwg0YPQstC+0LTRgyAi0KLRjdC60YHRgiIABQrQn9C+0YjRg9C6AA4b
0J/QvtGI0YPQutCw0LLRiyDQt9Cw0L/Ri9GCAAYN0J/QvtGI0YPQuuKApgAGDNCf0YDQsNCx0LXQ
uwBPgJDQn9GA0LDQstGP0LTQt9GW0YbQtSDQv9Cw0LvRjNGG0LDQvCwg0LrQsNCxINCy0YvQsdGA
0LDRhtGMINCz0L7QtCwg0LDQsdC+INC90LDRhtGW0YHQvdGW0YbQtSwg0LrQsNCxINCy0Y/RgNC9
0YPRhtGG0LAg0LTQsCDQstGL0LHQsNGA0YMg0LTQsNGC0YsAL1jQn9GA0LDQs9Cw0YDRgtCw0LnR
htC1INGN0LrRgNCw0L0sINC60LDQsSDQv9GA0LDQs9C70Y/QtNC30LXRhtGMINC80ZbQvdGD0LvR
iyDQvNC10YHRj9GGADFc0J/RgNCw0LPQsNGA0YLQsNC50YbQtSDRjdC60YDQsNC9LCDQutCw0LEg
0L/RgNCw0LPQu9GP0LTQt9C10YbRjCDQvdCw0YHRgtGD0L/QvdGLINC80LXRgdGP0YYAMVzQn9GA
0LDQs9Cw0YDRgtCw0LnRhtC1INGN0LrRgNCw0L0sINC60LDQsSDQv9GA0LDQs9C70Y/QtNC30LXR
htGMINC/0LDQt9C90LXQudGI0YvRjyDQs9Cw0LTRiwAwWtCf0YDQsNCz0LDRgNGC0LDQudGG0LUg
0Y3QutGA0LDQvSwg0LrQsNCxINC/0YDQsNCz0LvRj9C00LfQtdGG0Ywg0YDQsNC90LXQudGI0YvR
jyDQs9Cw0LTRiwAPHdCf0YDQsNC/0LDQvdC+0LLRiyDRntC90ZbQt9C1ABAZ0J/RgNCw0YbRjdC9
0YLQsNGeOiAlMSRkLgAWKtCg0LDQt9Cz0LDRgNC90YPRhtGMINC90ZbQttC90ZYg0LDRgNC60YPR
iAAKFNCg0LDQt9Cz0L7RgNC90YPRgtCwAAUK0KHRkdC90L3RjwAUJtCjINC30L7QvdC1INC00LDR
gdGP0LPQsNC70YzQvdCw0YHRhtGWAAkR0KMg0L/RgNCw0YbRjdGB0LUABAfQo9Ca0JsuAA8d0KPQ
stCw0YXQvtC00L3RiyDQstGL0LrQu9GW0LoADhvQo9Cy0LXQtNC30LXQvdCw0Y8g0LTQsNGC0LAA
FCHQo9Cy0LXQtNC30LXQvdCw0Y8g0LTQsNGC0LA6ICUxJHMAIT/Qo9Cy0LXQtNC30LXQvdGLINC9
0Y/Qv9GA0LDQstGW0LvRjNC90Ysg0LTRi9GP0L/QsNC30L7QvSDQtNCw0YIADRnQo9Cy0Y/QtNC3
0ZbRhtC1INC00LDRgtGLAAcO0KPQutC70LDQtNC60LAACBDQo9C60LvRjtGH0LDQvdCwABEh0KPR
gdC/0LvRi9Cy0LDQu9GM0L3QsNC1INCw0LrQvdC+AB880KTRltC70YzRgtGA0LDQstCw0L3QvdC1
INGe0LLQsNGF0L7QtNC90LDQs9CwINCy0YvQutC70ZbQutGDAAcO0KXQstGW0LvRltC90YsABw7Q
s9Cw0LTQt9GW0L3RiwAJEdC00LAg0L/QsNGe0LTQvdGPAAwX0L/QsNGB0LvRjyDQv9Cw0Z7QtNC9
0Y8ABw7RhdCy0ZbQu9GW0L3RiwAMDSUxJGTCoE1pbnV0ZW4ADQ4lMSRkwqBQcm96ZW50LgAMDSUx
JGTCoFN0dW5kZW4ACAklMSRkwqBVaHIAFBVBTSBvZGVyIFBNIGF1c3fDpGhsZW4AAgJBTgADA0FV
UwAICEFibGVobmVuABYWQWt0dWVsbGUgQXVzd2FobDogJTEkcwAPD0FrdHVlbGxlciBBbnJ1ZgAN
DUFsbGUgYW56ZWlnZW4AAgJBbgAODkFuZnJhZ2Ugc2VuZGVuAB0eQW5nZWdlYmVuZXIgWmVpdHJh
dW0gdW5nw7xsdGlnAAgIQW5uZWhtZW4AIiJBbnNpY2h0IGFtIHVudGVyZW4gUmFuZCBtYXhpbWll
cmVuACIiQW5zaWNodCBhbSB1bnRlcmVuIFJhbmQgbWluaW1pZXJlbgAhIkFuc2ljaHQgYW0gdW50
ZXJlbiBSYW5kIHNjaGxpZcOfZW4ADQ5BcHAgYXVzd8OkaGxlbgAICEF1ZmxlZ2VuAAMDQXVzAAoL
QXVzZ2V3w6RobHQAEhNBdXNnZXfDpGhsdGVzIERhdHVtAAwMQmVyZWljaHNlbmRlAA0NQmVyZWlj
aHNzdGFydAAPEERhdGVuIGF1c3fDpGhsZW4ADg5EYXRlbiBlaW5nZWJlbgAPEERhdHVtIGF1c3fD
pGhsZW4AMjJEYXR1bSBlbnRzcHJpY2h0IG5pY2h0IGRlbSBlcndhcnRldGVuIEZvcm1hdDogJTEk
cwA/QkRhdHVtIGxpZWd0IGF1w59lcmhhbGIgZGVzIGVyd2FydGV0ZW4gSmFocmVzYmVyZWljaHMg
KCUxJHPigJMlMiRzKQAKCkRpYWxvZ2ZlbGQADg9Ecm9wLWRvd24tTWVuw7wADQ1FaW5nYWJlZGF0
dW06ABISRWluZ2FiZWRhdHVtOiAlMSRzAAwMRWluZ2FiZXRhc3RlABERRWluZ2VoZW5kZXIgQW5y
dWYACAhFbmRkYXR1bQAGBkZlcnRpZwAcHUZpbHRlciBmw7xyIGVpbmdlaGVuZGVuIEFucnVmABAR
RnVua3Rpb25zdGFzdGXCoCsABQVIZXV0ZQALC0ltIFplaXRyYXVtAA4OSW4gQmVhcmJlaXR1bmcA
JCRJbiBkZW4gS2FsZW5kZXJlaW5nYWJlbW9kdXMgd2VjaHNlbG4AICBJbiBkZW4gVGV4dGVpbmdh
YmVtb2R1cyB3ZWNoc2VsbgAWFkphaHJlc2F1c3dhaGwgc2ljaHRiYXIACgpLZWluIERhdHVtAAUF
S2VpbmUACAhLdXJ6aW5mbwAREUt1cnppbmZvIGFuemVpZ2VuAAkJTGVlcnRhc3RlAAcITMO2c2No
ZW4ACQlNYXhpbWllcnQACw1NZW7DvHRhc3RlwqArAAwNTWV0YS1UYXN0ZcKgKwAKCk1pbmltaWVy
ZW4ACQlNaW5pbWllcnQABgZNaW51dGUAERJNaW51dGVuIGF1c3fDpGhsZW4ADQ1NaXQgJXMgdGVp
bGVuAAkJTmFjaCBvYmVuAA8QTmF2aWdhdGlvbnNtZW7DvAAZG05hdmlnYXRpb25zbWVuw7wgc2No
bGllw59lbgAQEU5pY2h0IGF1c2dld8OkaGx0AA4OUG9wLXVwLUZlbnN0ZXIACQpTY2hsaWXDn2Vu
AAsLU3ByYWNoc3VjaGUACgpTdGFydGRhdHVtAAYHU3RyZ8KgKwAGBlN0dW5kZQAQEVN0dW5kZSBh
dXN3w6RobGVuAAsLU3VjaGFuZnJhZ2UAExRTdWNoYW5mcmFnZSBsw7ZzY2hlbgAFBVN1Y2hlAAYG
U3VjaGVuAAcJU3VjaGVu4oCmAAsMU3ltLVRhc3RlwqArABESVGFiZWxsZSBzY2hsaWXDn2VuAAoK
VGVpbGVuIG1pdAATE1RlaWx3ZWlzZSBha3RpdmllcnQADxBVbXNjaGFsdHRhc3RlwqArABESVW5n
w7xsdGlnZSBFaW5nYWJlABgZVW56dWzDpHNzaWdlcyBEYXR1bTogJTEkcwAQEVZvcnNjaGzDpGdl
IHVudGVuAAgIV2VjaHNlbG4AEBBXZWl0ZXJlIE9wdGlvbmVuAFFTV2lzY2hlbiwgdW0gZWluIEph
aHIgYXVzenV3w6RobGVuLCBvZGVyIHRpcHBlbiwgdW0genVyIFRhZ2VzYXVzd2FobCB6dXLDvGNr
enVrZWhyZW4ACQlaaWVocHVua3QAKCladW0gQW5zZWhlbiBkZXMgbsOkY2hzdGVuIE1vbmF0cyBz
Y3JvbGxlbgAqKlp1bSBBbnNlaGVuIGRlcyB2b3JoZXJpZ2VuIE1vbmF0cyBzY3JvbGxlbgAoKFp1
bSBBbnNlaGVuIG5hY2hmb2xnZW5kZXIgSmFocmUgc2Nyb2xsZW4AJSVadW0gQW5zZWhlbiB2b3Jo
ZXJpZ2VyIEphaHJlIHNjcm9sbGVuABYXWnVtIEphaHLCoCUxJHMgd2VjaHNlbG4AGxxadW0gbsOk
Y2hzdGVuIE1vbmF0IHdlY2hzZWxuAB0dWnVtIHZvcmhlcmlnZW4gTW9uYXQgd2VjaHNlbG4AGhpa
dXIgSmFocmVzYXVzd2FobCB3ZWNoc2VsbgAODlp1ciBTdGFydHNlaXRlAAsMZsO8ciBNaW51dGVu
AAoLZsO8ciBTdHVuZGUAChQlMSRkIOCkmOCko+CljeCkn+CkvgANHSUxJGQg4KSq4KWN4KSw4KSk
4KS/4KS24KSk4KWkAAoUJTEkZCDgpK7gpL/gpKjgpYfgpJ8AGD4lcyDgpK7gpL7gpLDgpY3gpKvg
pKQg4KS44KWH4KSv4KSwIOCkl+CksOCljeCkqOClgeCkueCli+CkuOCljQAECuCkheCkqCDgpJsA
BArgpIXgpKsg4KSbAC194KSF4KSw4KWN4KSV4KWLIOCkruCkueCkv+CkqOCkvuCkleCliyDgpJzg
pL7gpKjgpJXgpL7gpLDgpYAg4KS54KWH4KSw4KWN4KSoIOCkuOCljeCkleCljeCksOCli+CksiDg
pJfgpLDgpY3gpKjgpYHgpLngpYvgpLjgpY0ADSXgpIXgpLXgpYjgpKbgpY3gpK8g4KSH4KSo4KWN
4KSq4KWB4KSfABc/4KSG4KSC4KS24KS/4KSVIOCksOClguCkquCkruCkviDgpJzgpL7gpIHgpJog
4KSX4KSw4KS/4KSP4KSV4KWLAAcT4KSG4KSX4KSu4KSoIOCkleCksgASMOCkhuCkl+CkruCkqCDg
pJXgpLIg4KSc4KS+4KSB4KSa4KS/4KSB4KSm4KWIIOCkmwAugIDgpIbgpJfgpL7gpK7gpYAg4KS4
4KS+4KSy4KS54KSw4KWC4KSV4KWLIOCknOCkvuCkqOCkleCkvuCksOClgCDgpLngpYfgpLDgpY3g
pKgg4KS44KWN4KSV4KWN4KSw4KWL4KSyIOCkl+CksOCljeCkqOClgeCkueCli+CkuOCljQASMuCk
huCkteCkvuCknOCkruCkviDgpIbgpKfgpL7gpLDgpL/gpKQg4KSW4KWL4KSc4KWAABIy4KSP4KSJ
4KSf4KS+IOCkj+CkqiDgpJvgpL7gpKjgpY3gpKjgpYHgpLngpYvgpLjgpY0AEC7gpI/gpJXgpY3g
pLjgpY3gpKrgpL7gpKjgpY3gpKEg4KSX4KSw4KS/4KSv4KWLAAoe4KSV4KS+4KSf4KWN4KSo4KWB
4KS54KWL4KS44KWNAAsd4KSV4KS+4KSuIOCkueClgeCkgeCkpuCliCDgpJsADSPgpJXgpYHgpKjg
pYgg4KSq4KSo4KS/IOCkueCli+Ckh+CkqABDgLPgpJXgpYHgpKjgpYgg4KS44KS+4KSyIOCkm+Ck
qOCljOCknyDgpJfgpLDgpY3gpKgg4KS44KWN4KS14KS+4KSH4KSqIOCkl+CksOCljeCkqOClgeCk
ueCli+CkuOCljSDgpLXgpL4g4KSm4KS/4KSoIOCkmuCkr+CkqCDgpJfgpLDgpY3gpKgg4KSf4KWN
4KSv4KS+4KSqIOCkl+CksOCljeCkqOClgeCkueCli+CkuOCljQAPK+CkleCli+CksuCljeCkr+Ck
vuCkquCljeCkuCDgpJfgpLDgpL/gpK/gpYsAFTvgpJXgpY3gpLXgpYfgpLDgpYAg4KSW4KS+4KSy
4KWAIOCkl+CksOCljeCkqOClgeCkueCli+CkuOCljQAUOOCkleCljeCkteClh+CksOClgCDgpKrg
pYfgpLgg4KSX4KSw4KWN4KSo4KWB4KS54KWL4KS44KWNAAMJ4KSW4KWL4KScAAoc4KSW4KWL4KSc
IOCkquCljeCksOCktuCljeCkqAAKHuCkluCli+CknOCljeCkqOClgeCkueCli+CkuOCljQALIeCk
luCli+CknOCljeCkqOClgeCkueCli+CkuOCljeKApgAqdOCkl+CkpCDgpK7gpLngpL/gpKjgpL7g
pJXgpYsg4KSc4KS+4KSo4KSV4KS+4KSw4KWAIOCkueClh+CksOCljeCkqCDgpLjgpY3gpJXgpY3g
pLDgpYvgpLIg4KSX4KSw4KWN4KSo4KWB4KS54KWL4KS44KWNABQ44KSX4KWD4KS5IOCkquClg+Ck
t+CljeCkoOCkruCkviDgpJzgpL7gpKjgpYHgpLngpYvgpLjgpY0ABQ/gpJjgpKPgpY3gpJ/gpL4A
EzXgpJjgpKPgpY3gpJ/gpL4g4KSa4KSv4KSoIOCkl+CksOCljeCkqOClgeCkueCli+CkuOCljQAM
IuCkmOCko+CljeCkn+CkvuCkleCkviDgpLLgpL7gpJfgpL8AGkjgpJrgpK/gpKgg4KSX4KSw4KS/
4KSP4KSV4KS+IOCkruCkv+CkpOCkv+CkreCkv+CkpOCljeCksCDgpKrgpLDgpY3gpKjgpYcADCDg
pJrgpK/gpKgg4KSX4KSw4KS/4KSP4KSV4KWLIOCkmwAOJuCkmuCkr+CkqCDgpJfgpLDgpL/gpI/g
pJXgpYsg4KSb4KWI4KSoAA8p4KSa4KSv4KSoIOCkl+CksOCkv+Ckj+CkleCliyDgpK7gpL/gpKTg
pL8ADSXgpJzgpLXgpL7gpKsg4KSm4KS/4KSo4KWB4KS54KWL4KS44KWNAAYS4KSf4KWB4KSy4KSf
4KS/4KSqABAu4KSf4KWB4KSy4KSf4KS/4KSqIOCkpuClh+CkluCkvuCkh+Ckr+Cli+CkuOCljQAi
XuCkn+Clh+CkleCljeCkuOCljeCknyDgpIfgpKjgpKrgpYHgpJ8g4KSu4KWL4KShIOCkquCljeCk
sOCkr+Cli+CklyDgpJfgpLDgpY3gpKjgpYHgpLngpYvgpLjgpY0ABQ/gpJ/gpY3gpK/gpL7gpKwA
BQ/gpKHgpL7gpK/gpLLgpJcADSXgpKHgpY3gpLDgpKrgpKHgpL7gpIngpKgg4KSu4KWH4KSo4KWB
ABAu4KSh4KWN4KSw4KWN4KSv4KS+4KSXIOCkueCljeCkr+CkvuCkqOCljeCkoeCksgAMIuCkpeCk
qiDgpLXgpL/gpJXgpLLgpY3gpKrgpLngpLDgpYIAFTvgpKbgpL7gpK/gpLDgpL7gpJXgpYsg4KSF
4KSo4KWN4KSk4KS/4KSuIOCkrOCkv+CkqOCljeCkpuClgQAWPuCkpuCkvuCkr+CksOCkvuCkleCl
iyDgpLjgpYHgpLDgpYHgpLXgpL7gpKQg4KSs4KS/4KSo4KWN4KSm4KWBAAkb4KSo4KS/4KS34KWN
4KSV4KWN4KSw4KS/4KSvAA0l4KSo4KWH4KSt4KS/4KSX4KWH4KS44KSoIOCkruClh+CkqOClgQAc
TuCkqOClh+CkreCkv+Ckl+Clh+CkuOCkqCDgpK7gpYfgpKjgpYEg4KSs4KSo4KWN4KSmIOCkl+Ck
sOCljeCkqOClgeCkueCli+CkuOCljQALH+CkquCkquCkheCkqiDgpLXgpL/gpKjgpY3gpKHgpYsA
I2HgpKrgpL7gpKTgpY3gpLDgpYvgpJXgpYsg4KSH4KSo4KSq4KWB4KSfIOCkruCli+CkoSDgpKrg
pY3gpLDgpK/gpYvgpJcg4KSX4KSw4KWN4KSo4KWB4KS54KWL4KS44KWNABM14KSq4KS+4KSo4KS+
IOCkrOCkqOCljeCkpiDgpJfgpLDgpY3gpKjgpYHgpLngpYvgpLjgpY0AIV3gpKrgpYHgpJvgpL7g
pLDgpJXgpYsg4KSq4KS+4KSo4KS+IOCkj+CkleCljeCkuOCljeCkquCkvuCkqOCljeCkoSDgpJfg
pLDgpY3gpKjgpYHgpLngpYvgpLjgpY0AIFrgpKrgpYHgpJvgpL7gpLDgpJXgpYsg4KSq4KS+4KSo
4KS+IOCkleCli+CksuCljeCkr+CkvuCkquCljeCkuCDgpJfgpLDgpY3gpKjgpYHgpLngpYvgpLjg
pY0AF0HgpKrgpYHgpJvgpL7gpLDgpJXgpYsg4KSq4KS+4KSo4KS+IOCkueCkn+CkvuCkieCkqOCl
geCkueCli+CkuOCljQAiXuCkquClguCksOCljeCkteCkvuCkueCljeCkqCDgpLXgpL4g4KSF4KSq
4KSw4KS+4KS54KWN4KSoIOCkmuCkr+CkqCDgpJfgpLDgpY3gpKjgpYHgpLngpYvgpLjgpY0ADijg
pKvgpYvgpKgg4KSw4KS+4KSW4KWN4KSo4KWB4KS54KWL4KS44KWNAAoe4KSs4KSm4KSy4KWN4KSo
4KWB4KS54KWL4KS44KWNAAoc4KSt4KSH4KSw4KS54KWH4KSV4KWLIOCkleCksgAGEuCkreCkv+Ck
oeCkv+Ckr+CliwAWPuCkruCkvuCkpeCkvyDgpKjgpYfgpK3gpL/gpJfgpYfgpJ8g4KSX4KSw4KWN
4KSo4KWB4KS54KWL4KS44KWNAAQM4KSu4KS/4KSk4KS/ABIy4KSu4KS/4KSk4KS/IOCkmuCkr+Ck
qCDgpJfgpLDgpY3gpKjgpYHgpLngpYvgpLjgpY0AGELgpK7gpL/gpKTgpL/gpJXgpYsg4KSF4KS1
4KWI4KSnIOCkpuCkvuCkr+CksOCkviDgpKTgpYvgpJXgpL/gpK/gpYsAFTvgpK7gpL/gpKTgpL/g
pLngpLDgpYIg4KSa4KSv4KSoIOCkl+CksOCljeCkqOClgeCkueCli+CkuOCljQASNOCkruCkv+Ck
pOCkv+CkueCksOClgiDgpLngpL7gpLLgpY3gpKjgpYHgpLngpYvgpLjgpY0ABQ/gpK7gpL/gpKjg
pYfgpJ8AEzXgpK7gpL/gpKjgpYfgpJ8g4KSa4KSv4KSoIOCkl+CksOCljeCkqOClgeCkueCli+Ck
uOCljQAMIuCkruCkv+CkqOClh+Ckn+CkleCkviDgpLLgpL7gpJfgpL8AF0HgpK/gpLjgpK7gpL7g
pLDgpY3gpKvgpKQg4KS44KWH4KSv4KSwIOCkl+CksOCljeCkqOClgeCkueCli+CkuOCljQAbP+Ck
r+CliyDgpK7gpL/gpKTgpL8g4KS54KS+4KSy4KWN4KSoIOCkquCkvuCkh+CkgeCkpuCliOCkqDog
JTEkcwAvgIPgpLXgpL/gpJfgpKTgpJXgpL4g4KS44KS+4KSy4KS54KSw4KWC4KSV4KWLIOCknOCk
vuCkqOCkleCkvuCksOClgCDgpLngpYfgpLDgpY3gpKgg4KS44KWN4KSV4KWN4KSw4KWL4KSyIOCk
l+CksOCljeCkqOClgeCkueCli+CkuOCljQATN+CkuOCkguCkleCljeCkt+Ckv+CkquCljeCkpCDg
pJfgpLDgpY3gpKjgpYHgpLngpYvgpLjgpY0ABhLgpLjgpJXgpY3gpLDgpL/gpK8ADijgpLjgpKzg
pYgg4KS54KWH4KSw4KWN4KSo4KWB4KS54KWL4KS44KWNAA8p4KS44KSu4KS+4KSq4KSoIOCkueCl
geCkqOClhyDgpK7gpL/gpKTgpL8ACx/gpLjgpK7gpY3gpKrgpKjgpY3gpKgg4KSt4KSv4KWLABQu
4KS44KS+4KSyICUxJHMg4KSu4KS+IOCknOCkvuCkqOClgeCkueCli+CkuOCljQAeUuCkuOCkvuCk
siDgpJrgpK/gpKgg4KSX4KSw4KWN4KSo4KWHIOCkq+Ckv+CksuCljeCkoeCkruCkviDgpJzgpL7g
pKjgpYHgpLngpYvgpLjgpY0AEjDgpLjgpL7gpLIg4KSq4KS/4KSV4KSwIOCkpuClh+CkluCkv+Ck
j+CkleCliyDgpJsAFjzgpLjgpYHgpJ3gpL7gpLXgpLngpLDgpYIg4KSk4KSyIOCkpuCkv+Ckh+Ck
j+CkleCkviDgpJvgpKjgpY0ADibgpLjgpYHgpLDgpYEg4KS54KWB4KSo4KWHIOCkruCkv+CkpOCk
vwAKHuCkueCkn+CkvuCkieCkqOClgeCkueCli+CkuOCljQA6gJ7gpLngpL7gpLIg4KSa4KSv4KSo
IOCkl+CksOCkv+Ckj+CkleCliyDgpK7gpLngpL/gpKjgpL4g4KSq4KSw4KS/4KS14KSw4KWN4KSk
4KSoIOCkl+CksOClgCDgpIXgpJjgpL/gpLLgpY3gpLLgpYsg4KSu4KS54KS/4KSo4KS+IOCkrOCk
qOCkvuCkieCkqOClgeCkueCli+CkuOCljQA4gJjgpLngpL7gpLIg4KSa4KSv4KSoIOCkl+CksOCk
v+Ckj+CkleCliyDgpK7gpLngpL/gpKjgpL4g4KSq4KSw4KS/4KS14KSw4KWN4KSk4KSoIOCkl+Ck
sOClgCDgpIbgpJfgpL7gpK7gpYAg4KSu4KS54KS/4KSo4KS+IOCkrOCkqOCkvuCkieCkqOClgeCk
ueCli+CkuOCljQAQIuCkueCkvuCksuCkleCliyDgpJvgpKjgpYzgpJ86ICUxJHMADCLgpLngpL7g
pLLgpL/gpI/gpJXgpYsg4KSu4KS/4KSk4KS/ADyAjOCkueCkvuCksuCkv+Ckj+CkleCliyDgpK7g
pL/gpKTgpL8g4KS44KS+4KSy4KSV4KWLIOCkheCkquClh+CkleCljeCkt+Ckv+CkpCDgpKbgpL7g
pK/gpLDgpL4gKCUxJHMgLSAlMiRzKSDgpK3gpL/gpKTgpY3gpLAg4KSq4KSw4KWN4KSm4KWI4KSo
ABIo4KS54KS+4KSy4KS/4KSP4KSV4KWLIOCkruCkv+CkpOCkvzogJTEkcwAygIDgpLngpL7gpLLg
pL/gpI/gpJXgpYsg4KSu4KS/4KSk4KS/4KSV4KWLIOCkouCkvuCkgeCkmuCkviDgpIXgpKrgpYfg
pJXgpY3gpLfgpL/gpKQg4KSi4KS+4KSB4KSa4KS+4KS44KSB4KSXIOCkruCkv+CksuClh+CkqDog
JTEkcwAKFCUxJGQg4LCX4LCC4LCf4LCy4LGBAA0dJTEkZCDgsKjgsL/gsK7gsL/gsLfgsL7gsLLg
sYEAChIlMSRkIOCwtuCwvuCwpOCwgi4AGkIlMSRzIOCwuOCwguCwteCwpOCxjeCwuOCwsOCwvuCw
qOCwv+CwleCwvyDgsLXgsYbgsLPgsY3gsLLgsILgsKHgsL8AEzElc+CwpOCxiyDgsLfgsYfgsLDg
sY0g4LCa4LGH4LC44LGN4LCk4LGB4LCC4LCm4LC/ABY0QU0g4LCy4LGH4LCm4LC+IFBN4LCo4LGB
IOCwjuCwguCwmuCxgeCwleCxi+CwguCwoeCwvwAMIuCwheCwqOCxjeCwqOCxgCDgsJrgsYLgsKHg
sILgsKHgsL8AAwngsIbgsKjgsY0ACx/gsIbgsKjgsY3igIzgsLLgsYsg4LCJ4LCC4LCm4LC/AAMJ
4LCG4LCr4LGNAAsf4LCG4LCr4LGN4oCM4LCy4LGLIOCwieCwguCwpuCwvwAPK+Cwh+CwqOCxjeKA
jOCwleCwruCwv+CwguCwl+CxjSDgsJXgsL7gsLLgsY0AImDgsIfgsKjgsY3igIzgsJXgsK7gsL/g
sILgsJfgsY0g4LCV4LC+4LCy4LGN4oCM4LCo4LGBIOCwuOCxjeCwleCxjeCwsOCxgOCwqOCxjSDg
sJrgsYfgsK/gsILgsKHgsL8AEC7gsIfgsKjgsY3igIzgsKrgsYHgsJ/gsY0g4LCa4LGG4LCy4LGN
4LCy4LCm4LGBAAYQ4LCIIOCwsOCxi+CwnOCxgQAyduCwieCwguCwoeCwvuCwsuCxjeCwuOCwv+Cw
qCDgsLjgsILgsLXgsKTgsY3gsLjgsLDgsL7gsLIg4LCq4LCw4LC/4LCn4LC/ICUxJHMgLSAlMiRz
4oCM4LCy4LGLIOCwpOCxh+CwpuCxgCDgsLLgsYfgsKbgsYEADijgsI7gsILgsJrgsYHgsJXgsYHg
sKjgsY3gsKgg4LCk4LGH4LCm4LGAAAwk4LCO4LCC4LCa4LGB4LCV4LGL4LCs4LCh4LCy4LGH4LCm
4LGBAAwk4LCO4LCC4LCa4LGB4LCV4LGL4LCs4LCh4LC/4LCC4LCm4LC/ABAs4LCO4LCC4LCf4LCw
4LGNIOCwmuCxh+CwuOCwv+CwqCDgsKTgsYfgsKbgsYAAFjLgsI7gsILgsJ/gsLDgsY0g4LCa4LGH
4LC44LC/4LCoIOCwpOCxh+CwpuCxgDogJTEkcwAIFuCwj+CwpuCxgCDgsLLgsYfgsKbgsYEACx3g
sJLgsJUg4LCX4LCC4LCfIOCwquCwvuCwn+CxgQApc+CwkuCwlSDgsLjgsILgsLXgsKTgsY3gsLjg
sLDgsL7gsKjgsY3gsKjgsL8g4LCO4LCC4LCa4LGB4LCV4LGB4LCo4LGHIOCwhuCwquCxjeCwt+Cw
qOCxjeKAjOCwleCxgSDgsK7gsL7gsLDgsILgsKHgsL8AChzgsJXgsJ/gsY0g4LCa4LGH4LCv4LCC
4LCh4LC/ABEx4LCV4LC+4LCy4LGNIOCwleCxiuCwqOCwuOCwvuCwl+CxgeCwpOCxi+CwguCwpuCw
vwAMJOCwleCxgeCwpuCwv+CwguCwmuCwrOCwoeCwv+CwguCwpuCwvwALIeCwleCxgeCwpuCwv+Cw
uOCxjeCwpOCxgeCwguCwpuCwvwAqduCwleCxjeCwr+CwvuCwsuCxhuCwguCwoeCwsOCxjSDgsIfg
sKjgsY3igIzgsKrgsYHgsJ/gsY0g4LCu4LGL4LCh4LGN4oCM4LCV4LGBIOCwuOCxjeCwteCwv+Cw
muCxjSDgsIXgsLXgsY3gsLXgsILgsKHgsL8AAwngsJfgsILgsJ8ADyvgsJfgsILgsJ/gsKjgsYEg
4LCO4LCC4LCa4LGB4LCV4LGL4LCC4LCh4LC/ABIo4LCa4LGG4LCy4LGN4LCy4LCo4LC/IOCwpOCx
h+CwpuCxgDogJTEkcwAJG+Cwn+CxguCwsuCxjeKAjOCwn+Cwv+CwquCxjQAUOuCwn+CxguCwsuCx
jeKAjOCwn+Cwv+CwquCxjeKAjOCwqOCxgSDgsJrgsYLgsKrgsL/gsILgsJrgsYEAKHDgsJ/gsYbg
sJXgsY3gsLjgsY3gsJ/gsY0g4LCH4LCo4LGN4oCM4LCq4LGB4LCf4LGNIOCwruCxi+CwoeCxjeKA
jOCwleCxgSDgsLjgsY3gsLXgsL/gsJrgsY0g4LCF4LC14LGN4LC14LCC4LCh4LC/AAYS4LCf4LGN
4LCv4LC+4LCs4LGNAAYS4LCh4LGI4LCy4LC+4LCX4LGNABAu4LCh4LGN4LCw4LC+4LCq4LGN4oCM
4LCh4LGM4LCo4LGNIOCwruCxhuCwqOCxggAxgIngsKTgsKbgsYHgsKrgsLDgsL8g4LC44LCC4LC1
4LCk4LGN4LC44LCw4LC+4LCyIOCwoeCxh+Cwn+CwvuCwqOCxgSDgsJrgsYLgsKHgsJ/gsL7gsKjg
sL/gsJXgsL8g4LC44LGN4LCV4LGN4LCw4LGL4LCy4LGNIOCwmuCxh+Cwr+CwguCwoeCwvwAEDOCw
pOCxh+CwpuCxgAAuduCwpOCxh+CwpuCxgCDgsIngsILgsKHgsL7gsLLgsY3gsLjgsL/gsKgg4LCr
4LC+4LCw4LGN4LCu4LC+4LCf4LGN4oCM4LCk4LGLIOCwruCxjeCwr+CwvuCwmuCxjSDgsJXgsL7g
sLLgsYfgsKbgsYE6ICUxJHMADijgsKTgsYfgsKbgsYAg4LCO4LCC4LCa4LGB4LCV4LGL4LCC4LCh
4LC/ABAu4LCk4LGH4LCm4LGA4LCo4LC/IOCwjuCwguCwmuCxgeCwleCxi+CwguCwoeCwvwAcTuCw
pOCxh+CwpuCxgOCwsiDgsKrgsLDgsL/gsKfgsL8g4LCH4LCo4LGN4oCM4LCq4LGB4LCf4LGNIOCw
muCxhuCwsuCxjeCwsuCwpuCxgQARMeCwpOCxh+CwpuCxgOCwsuCwqOCxgSDgsI7gsILgsJrgsYHg
sJXgsYvgsILgsKHgsL8AFDjgsKTgsYfgsKbgsYDgsLLgsKjgsYEg4LCO4LCC4LCf4LCw4LGNIOCw
muCxh+Cwr+CwguCwoeCwvwAgWuCwpuCwv+Cwl+CxgeCwteCxgeCwqCDgsIngsKjgsY3gsKgg4LC3
4LGA4LCf4LGN4oCM4LCo4LGBIOCwleCxgeCwpuCwv+CwuOCxjeCwpOCxgeCwguCwpuCwvwAjY+Cw
puCwv+Cwl+CxgeCwteCxgeCwqCDgsIngsKjgsY3gsKgg4LC34LGA4LCf4LGN4oCM4LCo4LGBIOCw
teCwv+CwuOCxjeCwpOCwsOCwv+CwuOCxjeCwpOCxgeCwguCwpuCwvwAjY+CwpuCwv+Cwl+CxgeCw
teCxgeCwqCDgsIngsKjgsY3gsKgg4LC34LGA4LCf4LGN4oCM4LCo4LGBIOCwteCwv+CwuOCxjeCw
ruCwsOCwv+CwuOCxjeCwpOCxgeCwguCwpuCwvwAOKOCwqOCwvuCwteCwv+Cwl+Cxh+Cwt+CwqOCx
jSDgsK7gsYbgsKjgsYIAGUfgsKjgsL7gsLXgsL/gsJfgsYfgsLfgsKjgsY0g4LCu4LGG4LCo4LGC
4LCo4LGBIOCwruCxguCwuOCwv+CwteCxh+Cwr+CwvwAGEuCwqOCwv+CwruCwv+Cwt+CwggAJG+Cw
qOCwv+CwruCwv+Cwt+CwvuCwsuCwleCxgQATN+CwqOCwv+CwruCwv+Cwt+CwvuCwsuCwqOCxgSDg
sI7gsILgsJrgsYHgsJXgsYvgsILgsKHgsL8AEzfgsKrgsLDgsL/gsKfgsL8g4LCq4LGN4LCw4LC+
4LCw4LCC4LCt4LCu4LCv4LC/4LCC4LCm4LC/AA8r4LCq4LCw4LC/4LCn4LC/IOCwruCxgeCwl+Cw
v+CwuOCwv+CwguCwpuCwvwAMIuCwquCwsOCwv+Cwp+Cwv+CwsuCxiyDgsIngsILgsKbgsL8AF0Pg
sKrgsL7gsJXgsY3gsLfgsL/gsJXgsILgsJfgsL4g4LCO4LCC4LCa4LGB4LCV4LGL4LCs4LCh4LC/
4LCC4LCm4LC/AA4m4LCq4LC+4LCq4LGNLeCwheCwquCxjSDgsLXgsL/gsILgsKHgsYsADCLgsKrg
sL/gsJXgsKrgsY0g4LCa4LGH4LCv4LCC4LCh4LC/AAoe4LCq4LGC4LCw4LGN4LCk4LCv4LC/4LCC
4LCm4LC/ABdB4LCq4LGI4LCV4LC/IOCwqOCwvuCwteCwv+Cwl+Cxh+Cwn+CxjSDgsJrgsYfgsLjg
sY3gsKTgsYHgsILgsKbgsL8AFkDgsKrgsY3gsLDgsLbgsY3gsKjgsKjgsL8g4LC44LCu4LCw4LGN
4LCq4LC/4LC44LGN4LCk4LGB4LCC4LCm4LC/ABZA4LCq4LGN4LCw4LC24LGN4LCo4LCo4LGBIOCw
pOCxgOCwuOCwv+CwteCxh+CwuOCxjeCwpOCxgeCwguCwpuCwvwAULuCwquCxjeCwsOCwuOCxjeCw
pOCxgeCwpCDgsI7gsILgsKrgsL/gsJU6ICUxJHMADCLgsKrgsY3gsLDgsL7gsLDgsILgsK0g4LCk
4LGH4LCm4LGAABI04LCq4LGN4LCw4LGL4LCX4LGN4LCw4LGG4LC44LGN4oCM4LCy4LGLIOCwieCw
guCwpuCwvwAPK+CwruCwsOCwv+CwqOCxjeCwqOCwvyDgsI7gsILgsKrgsL/gsJXgsLLgsYEACRvg
sK7gsYHgsJfgsL/gsILgsJrgsILgsKHgsL8ADCLgsK7gsYHgsJfgsL/gsILgsKrgsYEg4LCk4LGH
4LCm4LGAACx64LCu4LGB4LCo4LGB4LCq4LCf4LC/IOCwqOCxhuCwsiDgsKHgsYfgsJ/gsL7gsKjg
sYEg4LCa4LGC4LCh4LCf4LC+4LCo4LC/4LCV4LC/IOCwuOCxjeCwleCxjeCwsOCxi+CwsuCxjSDg
sJrgsYfgsK/gsILgsKHgsL8AFj7gsK7gsYHgsKjgsYHgsKrgsJ/gsL8g4LCo4LGG4LCy4LCV4LGB
IOCwruCwvuCwsOCxjeCwmuCwguCwoeCwvwAygIzgsK7gsYHgsKjgsYHgsKrgsJ/gsL8g4LC44LCC
4LC14LCk4LGN4LC44LCw4LC+4LCyIOCwoeCxh+Cwn+CwvuCwqOCxgSDgsJrgsYLgsKHgsJ/gsL7g
sKjgsL/gsJXgsL8g4LC44LGN4LCV4LGN4LCw4LGL4LCy4LGNIOCwmuCxh+Cwr+CwguCwoeCwvwAR
MeCwr+CwvuCwquCxjeKAjOCwqOCxgSDgsI7gsILgsJrgsYHgsJXgsYvgsILgsKHgsL8ADijgsLLg
sL7gsJfgsYcg4LC54LGN4LCv4LC+4LCC4LCh4LC/4LCy4LGNACp04LC14LCa4LGN4LCa4LGHIOCw
qOCxhuCwsiDgsKHgsYfgsJ/gsL7gsKjgsYEg4LCa4LGC4LCh4LCf4LC+4LCo4LC/4LCV4LC/IOCw
uOCxjeCwleCxjeCwsOCxi+CwsuCxjSDgsJrgsYfgsK/gsILgsKHgsL8AFDjgsLXgsJrgsY3gsJrg
sYcg4LCo4LGG4LCy4LCV4LGBIOCwruCwvuCwsOCxjeCwmuCwguCwoeCwvwALH+CwteCwvuCwr+Cw
v+CwuOCxjSDgsLbgsYvgsKfgsKgADy3gsLXgsL/gsLjgsY3gsKTgsLDgsL/gsILgsJrgsKzgsKHg
sL/gsILgsKbgsL8ADCTgsLXgsL/gsLjgsY3gsK7gsLDgsL/gsILgsJrgsILgsKHgsL8ACx/gsLXg
sYDgsKHgsL/gsK/gsYsg4LCV4LC+4LCy4LGNABU74LC14LGA4LCw4LC/4LCk4LGLIOCwt+Cxh+Cw
sOCxjSDgsJrgsYfgsLjgsY3gsKTgsYHgsILgsKbgsL8ACBjgsLXgsYbgsKTgsJXgsILgsKHgsL/i
gKYACx/gsLbgsYvgsKfgsKgg4LCq4LGN4LCw4LC24LGN4LCoABAu4LC34LGA4LCf4LGN4oCM4LCo
4LGBIOCwruCxguCwuOCwv+CwteCxh+Cwr+CwvwAbTeCwuOCwguCwteCwpOCxjeCwuOCwsOCwgiDg
sKrgsL/gsJXgsLDgsY0g4LCV4LCo4LC/4LCq4LC/4LC44LGN4LCk4LGB4LCC4LCm4LC/AGKBEOCw
uOCwguCwteCwpOCxjeCwuOCwsOCwvuCwqOCxjeCwqOCwvyDgsI7gsILgsJrgsYHgsJXgsYvgsLXg
sKHgsL7gsKjgsL/gsJXgsL8g4LC44LGN4LC14LGI4LCq4LGNIOCwmuCxh+Cwr+CwguCwoeCwvywg
4LCy4LGH4LCm4LC+IOCwsOCxi+CwnOCxgeCwqOCxgSDgsI7gsILgsJrgsYHgsJXgsYHgsKjgsYfg
sILgsKbgsYHgsJXgsYEg4LCk4LC/4LCw4LC/4LCX4LC/IOCwruCwvuCwsOCwoeCwvuCwqOCwv+Cw
leCwvyDgsJ/gsY3gsK/gsL7gsKrgsY0g4LCa4LGH4LCv4LCC4LCh4LC/ABY+4LC44LGC4LCa4LCo
4LCy4LGBIOCwpuCwv+Cwl+CxgeCwteCxgeCwqCDgsIngsKjgsY3gsKjgsL7gsK/gsL8ABhLgsLjg
sYbgsLDgsY3gsJrgsY0ADSXgsLjgsYbgsLDgsY3gsJrgsY0g4LCa4LGH4LCv4LCC4LCh4LC/AAYS
4LC44LGN4LCq4LGH4LC44LGNABpK4LC54LGL4LCu4LGN4oCM4LCV4LGBIOCwqOCwvuCwteCwv+Cw
l+Cxh+Cwn+CxjSDgsJrgsYfgsLjgsY3gsKTgsYHgsILgsKbgsL8ADQ0lMSRkIHBlcnNlbnQuAAsM
JTEkZMKgbWludXRlAAgJJTEkZMKgdXVyAAQEOTk5KwADA0FBTgACAkFGAAMDQWFuAAICQWYADQ1B
ZnRyZWtraWVzbHlzAAQEQWx0KwAICEFudHdvb3JkAAoKQmVnaW5kYXR1bQAKCkJlZ2luZ3JlbnMA
BQVCZXNpZwAPD0Jpbm5lIHJlaWt3eWR0ZQAFBUN0cmwrAAUFRGF0dW0ALy9EYXR1bSBwYXMgbmll
IGJ5IGRpZSB2ZXJ3YWd0ZSBwYXRyb29uIG5pZTogJTEkcwA9PURhdHVtIHZhbCBidWl0ZSBkaWUg
b212YW5nIHZhbiBkaWUgdmVyd2FndGUgamFhcnRhbCAlMSRzLSUyJHMAFRVEYXR1bSB3YXQgaW5n
ZXZvZXIgaXMAGxtEYXR1bSB3YXQgaW5nZXZvZXIgaXM6ICUxJHMAIiJEYXR1bSB3b3JkIG5pZSB0
b2VnZWxhYXQgbmllOiAlMSRzAAgIRGVlbCBtZXQACwtEZWVsIG1ldCAlcwAHB0RpYWxvb2cADw9E
aWVuIG5hdnJhYWcgaW4ACQlFaW5kZGF0dW0ACQlFaW5kZ3JlbnMACAhGdW5rc2llKwAREUdhYW4g
bmEgamFhciAlMSRzABERR2FhbiBuYSB0dWlzc2tlcm0ABwdHYWFuIG9wABISR2VkZWVsdGVsaWsg
Z2VtZXJrAAQER2VlbgAGBkdla2llcwATE0dlc2VsZWt0ZWVyZGUgZGF0dW0AExNIdWlkaWdlIGtl
dXNlOiAlMSRzAAcHSW5nZXZvdQAQEElua29tZW5kZSBvcHJvZXAAEhJKYWFya2llc2VyIHNpZ2Jh
YXIAHR1LZXVyIHRhbnMgJ24gaW5rb21lbmRlIG9wcm9lcAAPD0tpZXMgJ24gcHJvZ3JhbQAKCktp
ZXMgZGF0dW0ACwtLaWVzIGRhdHVtcwALC0tpZXMgbWludXRlAAgIS2llcyB1dXIADw9LaWVzIHZt
LiBvZiBubS4ACAhLaWVzbHlzKwAFBUtsYWFyAAYGTHVpIGFmABkZTWFhayBuYXZpZ2FzaWVraWVz
bHlzIHRvZQAWFk1hYWsgb25kZXJzdGUgYmxhZCB0b2UAEBBNYWFrIHNpZ2JsYWQgdG9lAAgITWFh
ayB0b2UABQVNZXRhKwAGBk1pbnV1dAAQEE5hdmlnYXNpZWtpZXNseXMADg5OaWUgZ2VraWVzIG5p
ZQAKCk5vZyBvcHNpZXMACAhOdXRzd2VuawAaGk9uZ2VsZGlnZSBkYXR1bXJlZWtzaW52b2VyABAQ
T25nZWxkaWdlIGludm9lcgAHB09vcnRqaWUAExNPcHJvZXAgYWFuIGRpZSBnYW5nAA8PT3BzcHJp
bmd2ZW5zdGVyACQkUm9sbGVlcyBvbSBkaWUgdm9sZ2VuZGUgbWFhbmQgdGUgd3lzACIiUm9sbGVl
cyBvbSBkaWUgdm9yaWdlIG1hYW5kIHRlIHd5cwAcHFJvbGxlZXMgb20gbGF0ZXIgamFyZSB0ZSB3
eXMAHR5Sb2xsZWVzIG9tIHZyb2XDq3IgamFyZSB0ZSB3eXMABgZTaGlmdCsACgpTaWVuIGFsbGVz
AAgIU2ltYm9vbCsACgpTa2FrZWwgb29yACEhU2tha2VsIG9vciBuYSBrYWxlbmRlcmludm9lcm1v
ZHVzAB4gU2tha2VsIG9vciBuYSBraWVzIHZhbiDigJluIGphYXIAHR1Ta2FrZWwgb29yIG5hIHRl
a3NpbnZvZXJtb2R1cwAPD1NsZWVwaGFuZHZhdHNlbAAEBFNvZWsABghTb2VrIOKApgAODlNvZWt0
b2duYXZyYWFnAAsLU3RlbXNvZWt0b2cAREhTd2llcCBvbSDigJluIGphYXIgdGUga2llcyBvZiB0
aWsgb20gdGVydWcgdGUgc2tha2VsIG9tIOKAmW4gZGFnIHRlIGtpZXMACAhVaXRnZXZvdQADA1V1
cgAGBlZhbmRhZwAPD1ZlZSBuYXZyYWFnIHVpdAAaGlZlcmFuZGVyIG5hIHZvbGdlbmRlIG1hYW5k
ABgYVmVyYW5kZXIgbmEgdm9yaWdlIG1hYW5kAAUFVmlkZW8ADg5Wb2VyIGRhdHVtcyBpbgAUFFZv
b3JzdGVsbGUgaGllcm9uZGVyAAYGVm91IGluABQUVm91IG9uZGVyc3RlIGJsYWQgaW4AFRVWb3Ug
b25kZXJzdGUgYmxhZCB1aXQABgZXeXMgYWYADAxXeXMgbnV0c3dlbmsABgZkZWxldGUABQVlbnRl
cgADA25tLgAKCnNwYXNpZWJhbGsACgp2aXIgbWludXRlAAcHdmlyIHV1cgADA3ZtLgALESUxJGQg
0LzQuNC90YPRgtC4AA4WJTEkZCDQv9GA0L7RhtC10L3RgtCwLgAJDSUxJGQg0YfQsNGB0LAAAwbQ
kdC10LcACxXQkiDQtNC40LDQv9Cw0LfQvtC90LAABQnQkiDRhdC+0LQABAfQktCa0JsuAA0a0JLQ
uNC00LXQvtC+0LHQsNC20LTQsNC90LUABAfQktC60LsuABAf0JLRhdC+0LTRj9GJ0L4g0L7QsdCw
0LbQtNCw0L3QtQAjQdCS0YrQstC10LTQtdC9INC1INC90LXQstCw0LvQuNC00LXQvSDQv9C10YDQ
uNC+0LQg0L7RgiDQstGA0LXQvNC1AA0Z0JLRitCy0LXQtNC10L3QsCDQtNCw0YLQsAATH9CS0YrQ
stC10LTQtdC90LAg0LTQsNGC0LA6ICUxJHMAFirQktGK0LLQtdC00LXQvdC+0YLQviDQtSDQvdC1
0LLQsNC70LjQtNC90L4ADRnQktGK0LLQtdC00LXRgtC1INC00LDRgtC4AA8d0JPQu9Cw0YHQvtCy
0L4g0YLRitGA0YHQtdC90LUABgzQk9C+0YLQvtCy0L4ANl3QlNCw0YLQsNGC0LAg0LUg0LjQt9Cy
0YrQvSDQvtGH0LDQutCy0LDQvdC40Y8g0LPQvtC00LjRiNC10L0g0LTQuNCw0L/QsNC30L7QvTog
JTEkc8Kg4oCTICUyJHMAJD3QlNCw0YLQsNGC0LAg0L3QtSDQtSDQsiDQvtGH0LDQutCy0LDQvdC4
0Y8g0YTQvtGA0LzQsNGCOiAlMSRzABst0JTQsNGC0LDRgtCwINC90LUg0LUg0YDQsNC30YDQtdGI
0LXQvdCwOiAlMSRzABEh0JTQuNCw0LvQvtCz0L7QsiDQv9GA0L7Qt9C+0YDQtdGGAAQI0JTQvdC1
0YEACRLQl9Cw0YLQstCw0YDRj9C90LUAIDzQl9Cw0YLQstCw0YDRj9C90LUg0L3QsCDQvNC10L3R
jtGC0L4g0LfQsCDQvdCw0LLQuNCz0LDRhtC40Y8AFirQl9Cw0YLQstCw0YDRj9C90LUg0L3QsCDR
gtCw0LHQu9C40YbQsNGC0LAAESDQl9Cw0Y/QstC60LAg0LfQsCDRgtGK0YDRgdC10L3QtQAFCdCY
0JfQmtCbLgASHdCY0LfQsdC10YDQtdGC0LUgQU0g0LjQu9C4IFBNABMl0JjQt9Cx0LXRgNC10YLQ
tSDQv9GA0LjQu9C+0LbQtdC90LjQtQAQHtCY0LfQsdC40YDQsNC90LUg0L3QsCDQtNCw0YLQsAAQ
HtCY0LfQsdC40YDQsNC90LUg0L3QsCDQtNCw0YLQuAASItCY0LfQsdC40YDQsNC90LUg0L3QsCDQ
vNC40L3Rg9GC0LgADxzQmNC30LHQuNGA0LDQvdC1INC90LAg0YfQsNGBAAwX0JjQt9Cx0YDQsNC9
0LAg0LTQsNGC0LAABw7QmNC30LHRgNCw0L3QvgAFCdCY0LfQutC7LgAVKNCY0LfQv9GA0LDRidCw
0L3QtSDQvdCwINC30LDRj9Cy0LrQsNGC0LAAESHQmNC30YHQutCw0YfQsNGJINC/0YDQvtC30L7R
gNC10YYAFirQmNC30YfQuNGB0YLQstCw0L3QtSDQvdCwINC30LDRj9Cy0LrQsNGC0LAAJ0jQmNC9
0YHRgtGA0YPQvNC10L3RgtGK0YIg0LfQsCDQuNC30LHQvtGAINC90LAg0LPQvtC00LjQvdCwINC1
INCy0LjQtNC40LwADxzQmtGA0LDQuSDQvdCwINC+0LHRhdCy0LDRgtCwAAsV0JrRgNCw0LnQvdCw
INC00LDRgtCwACVG0JzQsNC90LjQv9GD0LvQsNGC0L7RgCDQt9CwINC/0YDQtdC80LXRgdGC0LLQ
sNC90LUg0YEg0L/Qu9GK0LfQs9Cw0L3QtQARINCc0LXQvdGOINC30LAg0L3QsNCy0LjQs9Cw0YbQ
uNGPAAYM0JzQuNC90YPRgtCwABkr0J3QsNCy0LjQs9C40YDQsNC90LUg0LTQviAlMSRzINCz0L7Q
tNC40L3QsAAdN9Cd0LDQstC40LPQuNGA0LDQvdC1INC60YrQvCDQvdCw0YfQsNC70L3QuNGPINC1
0LrRgNCw0L0AESHQndCw0LLQuNCz0LjRgNCw0L3QtSDQvdCw0LPQvtGA0LUADBfQndCw0YfQsNC7
0L3QsCDQtNCw0YLQsAARINCd0LDRh9Cw0LvQviDQvdCwINC+0LHRhdCy0LDRgtCwAAwW0J3QtSDQ
tSDQuNC30LHRgNCw0L3QvgAECNCd0Y/QvNCwAAcO0J7RgtCz0L7QstC+0YAAChTQntGC0YXQstGK
0YDQu9GP0L3QtQAZL9Ce0YLRhdCy0YrRgNC70Y/QvdC1INC90LAg0LTQvtC70L3QuNGPINC70LjR
gdGCAAkR0J7RidC1INC+0L/RhtC40LgACxXQn9Cw0LTQsNGJ0L4g0LzQtdC90Y4ACRLQn9C+0LTR
gdC60LDQt9C60LAAFirQn9C+0LrQsNC30LLQsNC90LUg0L3QsCDQv9C+0LTRgdC60LDQt9C60LAA
DBjQn9GA0LXQstC60LvRjtGH0LLQsNC90LUAI0LQn9GA0LXQstC60LvRjtGH0LLQsNC90LUg0LrR
itC8INC40LfQsdC40YDQsNC90LUg0L3QsCDQs9C+0LTQuNC90LAALlbQn9GA0LXQstC60LvRjtGH
0LLQsNC90LUg0LrRitC8INGA0LXQttC40Lwg0LfQsCDQstGK0LLQtdC20LTQsNC90LUg0LIg0LrQ
sNC70LXQvdC00LDRgAAsUtCf0YDQtdCy0LrQu9GO0YfQstCw0L3QtSDQutGK0Lwg0YDQtdC20LjQ
vCDQt9CwINCy0YrQstC10LbQtNCw0L3QtSDQvdCwINGC0LXQutGB0YIAKErQn9GA0LXQstGK0YDR
gtC10YLQtSwg0LfQsCDQtNCwINCy0LjQtNC40YLQtSDQvNC40L3QsNC70LjRgtC1INCz0L7QtNC4
0L3QuAAoStCf0YDQtdCy0YrRgNGC0LXRgtC1LCDQt9CwINC00LAg0LLQuNC00LjRgtC1INC/0YDQ
tdC00LjRiNC90LjRjyDQvNC10YHQtdGGACpO0J/RgNC10LLRitGA0YLQtdGC0LUsINC30LAg0LTQ
sCDQstC40LTQuNGC0LUg0YHQu9C10LTQstCw0YnQuNGC0LUg0LPQvtC00LjQvdC4AChK0J/RgNC1
0LLRitGA0YLQtdGC0LUsINC30LAg0LTQsCDQstC40LTQuNGC0LUg0YHQu9C10LTQstCw0YnQuNGP
INC80LXRgdC10YYAESDQn9GA0LXQs9C70LXQtCDQvdCwINCy0YHQuNGH0LrQuAAdN9Cf0YDQtdCz
0LvQtdC20LTQsCDRgdC1INCy0YXQvtC00Y/RidC+INC+0LHQsNC20LTQsNC90LUAGC3Qn9GA0LXQ
tNC70L7QttC10L3QuNGP0YLQsCDRgdCwINC/0L4t0LTQvtC70YMAWoCi0J/RgNC10LrQsNGA0LDQ
udGC0LUg0L/RgNGK0YHRgiwg0LfQsCDQtNCwINC40LfQsdC10YDQtdGC0LUg0LPQvtC00LjQvdCw
LCDQuNC70Lgg0LTQvtC60L7RgdC90LXRgtC1LCDQt9CwINC00LAg0YHQtSDQstGK0YDQvdC10YLQ
tSDQutGK0Lwg0LjQt9Cx0L7RgNCwINC90LAg0LTQtdC9AB870J/RgNC10LzQuNC90LDQstCw0L3Q
tSDQutGK0Lwg0L/RgNC10LTQuNGI0L3QuNGPINC80LXRgdC10YYAHzvQn9GA0LXQvNC40L3QsNCy
0LDQvdC1INC60YrQvCDRgdC70LXQtNCy0LDRidC40Y8g0LzQtdGB0LXRhgAYLdCg0LDQt9Cz0YrQ
stCw0L3QtSDQvdCwINC00L7Qu9C90LjRjyDQu9C40YHRggAJEtCg0LDQt9Cz0YrQvdCw0YLQvgAG
DNCg0LDQt9C00LXQuwAHDtCh0LLQuNCy0LDQvdC1ABYp0KHQstC40LLQsNC90LUg0L3QsCDQtNC+
0LvQvdC40Y8g0LvQuNGB0YIABQrQodCy0LjRgtC+AA4a0KHQv9C+0LTQtdC70Y/QvdC1INGB0YrR
gToAER3QodC/0L7QtNC10LvRj9C90LUg0YHRitGBOiAlcwARG9Ci0LXQutGD0Ykg0LjQt9Cx0L7R
gDogJTEkcwAPHdCi0LXQutGD0YnQviDQvtCx0LDQttC00LDQvdC1AAcO0KLRitGA0YHQtdC90LUA
CBHQotGK0YDRgdC10YLQteKApgADBtCn0LDRgQASI9Cn0LDRgdGC0LjRh9C90L4g0L7RgtC80LXR
gtC90LDRgtC+AAsV0LfQsCDQvNC40L3Rg9GC0LjRgtC1AAcN0LfQsCDRh9Cw0YHQsAATJNC60LvQ
sNCy0LjRiNCwINC30LAg0LjQvdGC0LXRgNCy0LDQuwAMGiUxJGQg4LiK4Lix4LmI4Lin4LmC4Lih
4LiHAAkRJTEkZCDguJnguLLguJfguLUACxclMSRkIOC4meC4suC4rOC4tOC4geC4sgAQJiUxJGQg
4LmA4Lib4Lit4Lij4LmM4LmA4LiL4LmH4LiZ4LiV4LmMAAQM4LiB4Lil4Lix4LiaAAsh4LiB4Lil
4LmI4Lit4LiH4LmC4LiV4LmJ4LiV4Lit4LiaACFj4LiB4Liy4Lij4Lib4LmJ4Lit4LiZ4LiC4LmJ
4Lit4Lih4Li54Lil4LiK4LmI4Lin4LiH4Lin4Lix4LiZ4LiX4Li14LmI4LmE4Lih4LmI4LiW4Li5
4LiB4LiV4LmJ4Lit4LiHABY24LiB4Liy4Lij4LmA4Lil4Li34Lit4LiB4Lib4Lix4LiI4LiI4Li4
4Lia4Lix4LiZOiAlMSRzAA4q4LiB4Liz4Lil4Lix4LiH4LiU4Liz4LmA4LiZ4Li04LiZ4LiB4Liy
4LijABZC4LiB4Liz4Lil4Lix4LiH4Liq4LiB4Lij4Li14LiZ4Liq4Liy4Lii4LmA4Lij4Li14Lii
4LiB4LmA4LiC4LmJ4LiyAAQM4LiC4Lii4Liy4LiiABEZ4LiC4Lii4Liy4LiiIEJvdHRvbSBTaGVl
dAAHFeC4hOC4s+C4hOC5ieC4meC4q+C4sgAFD+C4hOC5ieC4meC4q+C4sgAOKuC4hOC5ieC4meC4
q+C4suC4lOC5ieC4p+C4ouC5gOC4quC4teC4ouC4hwAGEuC4hOC5ieC4meC4q+C4suKApgARM+C4
iOC4uOC4lOC4quC4tOC5ieC4meC4quC4uOC4lOC4guC4reC4h+C4iuC5iOC4p+C4hwASNuC4iOC4
uOC4lOC5gOC4o+C4tOC5iOC4oeC4leC5ieC4meC4guC4reC4h+C4iuC5iOC4p+C4hwAHFeC4iuC4
seC5iOC4p+C5guC4oeC4hwAJG+C4lOC4ueC4l+C4seC5ieC4h+C4q+C4oeC4lAAMJOC4leC4seC4
p+C5gOC4peC4t+C4reC4geC4reC4t+C5iOC4mQAEDOC4meC4suC4l+C4tQAOKuC4meC4s+C4l+C4
suC4h+C5hOC4m+C4q+C4meC5ieC4suC5geC4o+C4gQAGEuC4m+C4j+C4tOC5gOC4quC4mAA2gKLg
uJvguLHguJTguYDguJ7guLfguYjguK3guYDguKXguLfguK3guIHguJvguLXguKvguKPguLfguK3g
uYHguJXguLDguYDguJ7guLfguYjguK3guYDguJvguKXguLXguYjguKLguJnguIHguKXguLHguJrg
uYTguJvguKLguLHguIfguIHguLLguKPguYDguKXguLfguK3guIHguKfguLHguJkAAwnguJvguLTg
uJQAEBbguJvguLTguJQgQm90dG9tIFNoZWV0AAYS4Lib4Li04LiU4LiK4Li14LiVAA8t4Lib4Li0
4LiU4LmA4Lih4LiZ4Li54LiB4Liy4Lij4LiZ4Liz4LiX4Liy4LiHAAoe4Lib4LmJ4Lit4LiZ4Lin
4Lix4LiZ4LiX4Li14LmIABQ84Lih4Li14LiE4Liz4LmB4LiZ4Liw4LiZ4Liz4LiX4Li14LmI4LiU
4LmJ4Liy4LiZ4Lil4LmI4Liy4LiHAAMJ4Lii4Li44LiaABAW4Lii4Li44LiaIEJvdHRvbSBTaGVl
dAAGEuC4o+C4seC4muC4quC4suC4ogACBuC4peC4mgALIeC4peC5ieC4suC4h+C4hOC4s+C4hOC5
ieC4meC4q+C4sgAGEuC4p+C4seC4meC4l+C4teC5iAAOKuC4p+C4seC4meC4l+C4teC5iOC4l+C4
teC5iOC5gOC4peC4t+C4reC4gQAKHuC4p+C4seC4meC4l+C4teC5iOC4m+C5ieC4reC4mQAQJOC4
p+C4seC4meC4l+C4teC5iOC4m+C5ieC4reC4mTogJTEkcwANJ+C4p+C4seC4meC4l+C4teC5iOC4
quC4tOC5ieC4meC4quC4uOC4lAAweOC4p+C4seC4meC4l+C4teC5iOC4reC4ouC4ueC5iOC4meC4
reC4geC5gOC4q+C4meC4t+C4reC4iOC4suC4geC4iuC5iOC4p+C4h+C4m+C4teC4l+C4teC5iOC4
hOC4suC4lOC5hOC4p+C5iSAlMSRzIC0gJTIkcwAOKuC4p+C4seC4meC4l+C4teC5iOC5gOC4o+C4
tOC5iOC4oeC4leC5ieC4mQAkYOC4p+C4seC4meC4l+C4teC5iOC5hOC4oeC5iOC4leC4o+C4h+C4
geC4seC4muC4o+C4ueC4m+C5geC4muC4muC4l+C4teC5iOC4hOC4suC4lOC5hOC4p+C5iTogJTEk
cwAGEuC4p+C4seC4meC4meC4teC5iQAGEuC4p+C4suC4h+C4quC4suC4ogAGEuC4p+C4tOC4lOC4
teC5guC4rQAbUeC4quC4peC4seC4muC5hOC4m+C5g+C4iuC5ieC5guC4q+C4oeC4lOC4geC4suC4
o+C4m+C5ieC4reC4meC4guC5ieC4reC4hOC4p+C4suC4oQAdV+C4quC4peC4seC4muC5hOC4m+C5
g+C4iuC5ieC5guC4q+C4oeC4lOC4m+C5ieC4reC4meC4guC5ieC4reC4oeC4ueC4peC4m+C4j+C4
tOC4l+C4tOC4mQAPLeC4quC4suC4ouC4l+C4teC5iOC4quC4meC4l+C4meC4suC4reC4ouC4ueC5
iAAMJOC4quC4suC4ouC5gOC4o+C4teC4ouC4geC5gOC4guC5ieC4sgANJ+C4quC4s+C4q+C4o+C4
seC4muC4iuC4seC5iOC4p+C5guC4oeC4hwAKHuC4quC4s+C4q+C4o+C4seC4muC4meC4suC4l+C4
tQAKHuC4quC5iOC4h+C4hOC4s+C4hOC5ieC4meC4q+C4sgAPLeC4q+C4meC5ieC4suC4leC5iOC4
suC4h+C4m+C5iuC4reC4m+C4reC4seC4mwAYSOC4reC4ouC4ueC5iOC5g+C4meC4iuC5iOC4p+C4
h+C4p+C4seC4meC4l+C4teC5iOC4l+C4teC5iOC5gOC4peC4t+C4reC4gQAQMOC4reC4tOC4meC4
nuC4uOC4leC5hOC4oeC5iOC4luC4ueC4geC4leC5ieC4reC4hwASNuC5gOC4hOC4peC5h+C4lOC4
peC4seC4muC5gOC4hOC4o+C4t+C5iOC4reC4h+C4oeC4t+C4rQAHFeC5gOC4m+C4peC4teC5iOC4
ouC4mQAWQuC5gOC4m+C4peC4teC5iOC4ouC4meC5hOC4m+C4l+C4teC5iOC4geC4suC4o+C5gOC4
peC4t+C4reC4geC4m+C4tQAZS+C5gOC4m+C4peC4teC5iOC4ouC4meC5hOC4m+C4l+C4teC5iOC5
gOC4lOC4t+C4reC4meC4geC5iOC4reC4meC4q+C4meC5ieC4sgAWQuC5gOC4m+C4peC4teC5iOC4
ouC4meC5hOC4m+C4l+C4teC5iOC5gOC4lOC4t+C4reC4meC4luC4seC4lOC5hOC4mwAEDOC5gOC4
m+C4tOC4lAAFDeC5gOC4oeC4meC4uSsADCTguYDguKHguJnguLnguIHguLLguKPguJnguLPguJfg
uLLguIcADy3guYDguKHguJnguLnguYHguJrguJrguYDguKXguLfguYjguK3guJnguKXguIcAECLg
uYDguKXguLfguK3guIEgQU0g4Lir4Lij4Li34LitIFBNAAwk4LmA4Lil4Li34Lit4LiB4LiK4Lix
4LmI4Lin4LmC4Lih4LiHAAkb4LmA4Lil4Li34Lit4LiB4LiZ4Liy4LiX4Li1AAwk4LmA4Lil4Li3
4Lit4LiB4Lia4Liy4LiH4Liq4LmI4Lin4LiZAAsh4LmA4Lil4Li34Lit4LiB4Lin4Lix4LiZ4LiX
4Li14LmIAAgY4LmA4Lil4Li34Lit4LiB4LmB4Lit4LibAAgY4LmA4Lil4Li34Lit4LiB4LmE4Lin
4LmJABxU4LmA4Lil4Li34LmI4Lit4LiZ4LmA4Lie4Li34LmI4Lit4LmB4Liq4LiU4LiH4Lib4Li1
4LiB4LmI4Lit4LiZ4Lir4LiZ4LmJ4Liy4LiZ4Li14LmJABtR4LmA4Lil4Li34LmI4Lit4LiZ4LmA
4Lie4Li34LmI4Lit4LmB4Liq4LiU4LiH4Lib4Li14Lir4Lil4Lix4LiH4LiI4Liy4LiB4LiZ4Li1
4LmJABxU4LmA4Lil4Li34LmI4Lit4LiZ4LmA4Lie4Li34LmI4Lit4LmB4Liq4LiU4LiH4LmA4LiU
4Li34Lit4LiZ4LiB4LmI4Lit4LiZ4Lir4LiZ4LmJ4LiyABlL4LmA4Lil4Li34LmI4Lit4LiZ4LmA
4Lie4Li34LmI4Lit4LmB4Liq4LiU4LiH4LmA4LiU4Li34Lit4LiZ4LiW4Lix4LiU4LmE4LibAAUP
4LmA4Liq4Lij4LmH4LiIAAcV4LmB4LiK4Lij4LmM4LiB4Lix4LiaAAoY4LmB4LiK4Lij4LmM4LiX
4Liy4LiHICVzAAQM4LmB4LiX4LmH4LiaAA4q4LmB4Liq4LiU4LiH4LiV4Lix4Lin4LmA4Lil4Li3
4Lit4LiB4Lib4Li1ABZC4LmB4Liq4LiU4LiH4LmA4LiE4Lil4LmH4LiU4Lil4Lix4Lia4LmA4LiE
4Lij4Li34LmI4Lit4LiH4Lih4Li34LitAA0n4LmB4Liu4LiZ4LmA4LiU4Li04Lil4LiB4Liy4Lij
4Lil4Liy4LiBAAwa4LmE4Lib4Lii4Lix4LiH4Lib4Li1ICUxJHMABQ/guYTguKHguYjguKHguLUA
Hk7guYTguKHguYjguK3guJnguLjguI3guLLguJXguYPguKvguYnguYPguIrguYnguKfguLHguJng
uJfguLXguYjguJnguLXguYk6ICUxJHMACyHguYTguKHguYjguYTguJTguYnguYDguKXguLfguK3g
uIEADg4lMSRkIG1pbnV1dHRpYQAPDyUxJGQgcHJvc2VudHRpYQAGByUxJGTCoGgAAgJBUAAMDkFs
a2FtaXNww6RpdsOkAAsLQWx1ZWVuIGFsa3UADAxBbHVlZW4gbG9wcHUAEBBBdmF0dGF2YSB2YWxp
a2tvAA8PRWhkb3R1a3NpYSBhbGxhAAoKRWkgdmFsaXR0dQADA0hhZQAEBEhha3UACgpIYWt1a3lz
ZWx5AAUHSGFrdeKApgAGCEh5bGvDpMOkABETSHlsa8Okw6QgYWxhcGFuZWVsaQACAklQAAcHSmFh
OiAlcwAEBkphYeKApgAKCktlbGxvICUxJGQABgZLZXNrZW4AFhhLw6R5bm5pc3PDpCBvbGV2YSBw
dWhlbHUAExNMYWFqZW5uYSBhbGFwYW5lZWxpAAsLTGFhamVubmV0dHUADQ5MaXPDpGFzZXR1a3Nl
dAASGExpc8OkdHR5IHDDpGl2w6Rtw6TDpHLDpAAYHkxpc8OkdHR5IHDDpGl2w6Rtw6TDpHLDpDog
JTEkcwARGExpc8Okw6QgcMOkaXbDpG3DpMOkcsOkdAANDUxvcGV0YSBwdWhlbHUADQ9Mw6RoZXTD
pCBreXNlbHkACAhNaW51dXR0aQAREU5hdmlnb2ludGl2YWxpa2tvABYWTnlreWluZW4gdmFsaW50
YTogJTEkcwAMDk7DpHl0w6Qga2Fpa2tpABETTsOkeXTDpCB2aWhqZXRla3N0aQAUFE9zaXR0YWlu
IHRhcmtpc3RldHR1AAsOUE9JUyBQw4TDhExUw4QABARQb2lzAA8PUG9ubmFoZHVzaWtrdW5hAAgI
UHVoZWhha3UABglQw4TDhExMw4QACg9Qw6RpdsOkbcOkw6Ryw6QAHCFQw6RpdsOkbcOkw6Ryw6Qg
ZWkgc2FsbGl0dHU6ICUxJHMAO0RQw6RpdsOkbcOkw6Ryw6QgZWkgc2lzw6RsbHkgb2RvdGV0dHV1
biB2dW9zaWFpa2F2w6RsaWluOiAlMSRz4oCTJTIkcwArMFDDpGl2w6Rtw6TDpHLDpCBlaSB2YXN0
YWEgb2RvdGV0dHVhIG1hbGxpYTogJTEkcwAGCVDDpMOkbGzDpAAOElDDpMOkdHR5bWlzcMOkaXbD
pAAODlNhYXB1dmEgcHVoZWx1ABoaU2V1bG90YWFuIHNhYXB1dmFhIHB1aGVsdWEAERFTaWlycnkg
ZXR1c2l2dWxsZQATE1NpaXJyeSB2dW90ZWVuICUxJHMACwxTaWlycnkgeWzDtnMAFxdTdWxqZSBu
YXZpZ29pbnRpdmFsaWtrbwAODlN1bGplIHRhdWx1a2tvAAsLVGlpdmlzdGV0dHkACAlUaWl2aXN0
w6QAExRUaWl2aXN0w6QgYWxhcGFuZWVsaQAFBVR1bnRpAA8QVHloamVubsOkIGt5c2VseQAGCVTD
pG7DpMOkbgAGBlZhaWhkYQAcHFZhaWhkYSBlZGVsbGlzZWVuIGt1dWthdXRlZW4AHBxWYWloZGEg
c2V1cmFhdmFhbiBrdXVrYXV0ZWVuAB4gVmFpaGRhIHN5w7Z0dMO2dGF2YWtzaSBrYWxlbnRlcmkA
GhxWYWloZGEgdGVrc3RpbnN5w7Z0dMO2dGlsYWFuABcXVmFpaGRhIHZ1b2RlbiB2YWxpbnRhYW4A
BwdWYWlodG8rAAgIVmFsaWtrbysADQ1WYWxpbnRhaWtrdW5hABERVmFsaXRzZSBBUCB0YWkgSVAA
EBBWYWxpdHNlIG1pbnV1dGl0ABIXVmFsaXRzZSBww6RpdsOkbcOkw6Ryw6QAExhWYWxpdHNlIHDD
pGl2w6Rtw6TDpHLDpHQAEBBWYWxpdHNlIHNvdmVsbHVzAA0NVmFsaXRzZSB0dW50aQBFSlZhbGl0
c2UgdnVvc2kgcHl5aGvDpGlzZW3DpGxsw6QgdGFpIHBhbGFhIHDDpGl2w6RuIHZhbGludGFhbiBu
YXBhdXR0YW1hbGxhAAcHVmFsaXR0dQASF1ZhbGl0dHUgcMOkaXbDpG3DpMOkcsOkABETVmFsaXR1
bGxhIHbDpGxpbGzDpAAGBlZhc3RhYQAJCVZldG9rYWh2YQAhJFZpZXJpdMOkIG7DpGhkw6Rrc2Vz
aSBhaWVtbWF0IHZ1b2RldAAmKVZpZXJpdMOkIG7DpGhkw6Rrc2VzaSBlZGVsbGlzZW4ga3V1a2F1
ZGVuACMoVmllcml0w6QgbsOkaGTDpGtzZXNpIG15w7ZoZW1tw6R0IHZ1b2RldAAmKVZpZXJpdMOk
IG7DpGhkw6Rrc2VzaSBzZXVyYWF2YW4ga3V1a2F1ZGVuAAsLVmloamV0ZWtzdGkAFhZWaXJoZWVs
bGluZW4gYWphbmpha3NvABITVmlyaGVlbGxpbmVuIHN5w7Z0ZQAXGVZ1b3NpdmFsaXRzaW4gbsOk
a3l2aWxsw6QACQpWw6RsaWxlaHRpAA8PbWludXV0dGllbiBhamFuAAsLdHVubmluIGFqYW4ACgx2
w6RsaWx5w7ZudGkAAQPigJMACRElMSRkIOCkmOCkguCkn+ClhwANGyUxJGQg4KSq4KWN4KSw4KSk
4KS/4KS24KSkLgAIDiUxJGQg4KSs4KSc4KWHAAkRJTEkZCDgpK7gpL/gpKjgpJ8ADyMlcyDgpLjg
pYcg4KS24KWH4KSv4KSwIOCkleCksOClh+CkggAOHEFNIOCkr+CkviBQTSDgpJrgpYHgpKjgpYfg
pIIALXfgpIXgpJfgpLLgpYcg4KSu4KS54KWA4KSo4KWHIOCkleClgCDgpKTgpL7gpLDgpYDgpJYg
4KSm4KWH4KSW4KSo4KWHIOCkleClhyDgpLLgpL/gpI8g4KS44KWN4KSV4KWN4KSw4KWL4KSyIOCk
leCksOClh+CkggASMOCkheCkl+CksuClhyDgpK7gpLngpYDgpKjgpYcg4KSq4KSwIOCknOCkvuCk
j+CkggAMIuCkheCkruCkvuCkqOCljeCkryDgpIfgpKjgpKrgpYHgpJ8ADSXgpIXgpLjgpY3gpLXg
pYDgpJXgpL7gpLAg4KSV4KSw4KWH4KSCAAIG4KSG4KScABY44KSG4KSo4KWHIOCkteCkvuCksuCk
viAo4KSH4KSo4KSV4KSu4KS/4KSC4KSXKSDgpJXgpYngpLIAJWHgpIfgpKjgpJXgpK7gpL/gpILg
pJcg4KSV4KWJ4KSyIOCkleCliyDgpLjgpY3gpJXgpY3gpLDgpYDgpKgg4KSV4KS/4KSv4KS+IOCk
nOCkviDgpLDgpLngpL4g4KS54KWIAA8n4KSH4KS44KS44KWHIOCktuClh+Ckr+CksCDgpJXgpLDg
pYfgpII6ABhA4KSV4KWB4KSbIOCkteCkv+CkleCksuCljeCkquCli+CkgiDgpJXgpYsg4KSa4KWB
4KSo4KS+IOCkl+Ckr+CkvgAfU+CkleCliOCksuClh+CkguCkoeCksCDgpIfgpKjgpKrgpYHgpJ8g
4KSu4KWL4KShIOCkquCksCDgpLjgpY3gpLXgpL/gpJog4KSV4KSw4KWH4KSCAAkZ4KSV4KWJ4KSy
IOCkleCkvuCkn+Clh+CkggATNeCkleCli+CkiCDgpJDgpKrgpY3gpLLgpL/gpJXgpYfgpLbgpKgg
4KSa4KWB4KSo4KWH4KSCAAgW4KSV4KWL4KSIIOCkqOCkueClgOCkggARL+CkleCljeCkteClh+Ck
sOClgCDgpLjgpKzgpK7gpL/gpJ8g4KSV4KSw4KWH4KSCAA0l4KSV4KWN4oCN4KS14KWH4KSw4KWA
IOCkueCkn+CkvuCkj+CkggASMOCkluCkpOCljeCkriDgpLngpYvgpKjgpYcg4KSV4KWAIOCkpOCk
vuCksOClgOCklgAKHOCkluCkvuCksOCkv+CknCDgpJXgpLDgpYfgpIIAGELgpJbgpYDgpILgpJrg
pJXgpLAg4KSb4KWL4KSh4KS84KSo4KWHIOCkteCkvuCksuCkviDgpLngpYjgpILgpKHgpLIABQ/g
pJbgpYvgpJzgpYfgpIIABhLgpJbgpYvgpJzgpYfgpILigKYABAzgpJjgpILgpJ/gpL4AChzgpJjg
pILgpJ/gpL4g4KSa4KWB4KSo4KWH4KSCAAsd4KSY4KSC4KSf4KWHIOCkleClhyDgpLLgpL/gpI8A
BAzgpJrgpL7gpLLgpYIABxPgpJrgpL7gpLLgpYIg4KS54KWIAAgW4KSa4KWB4KSo4KS+IOCkl+Ck
r+CkvgANI+CkmuClgeCkqOClgCDgpJfgpIgg4KSk4KS+4KSw4KWA4KSWAAkZ4KSb4KWL4KSf4KS+
IOCkleCksOClh+CkggANI+Ckm+Cli+Ckn+CkviDgpJXgpL/gpK/gpL4g4KSX4KSv4KS+AAgW4KSc
4KS14KS+4KSsIOCkpuClh+CkggAOKOCknOCkvOCljeCkr+CkvuCkpuCkviDgpLXgpL/gpJXgpLLg
pY3gpKoABxPgpJzgpL7gpLDgpYAg4KS54KWIAAYS4KSf4KWC4KSy4KSf4KS/4KSqAAwi4KSf4KWC
4KSy4KSf4KS/4KSqIOCkpuClh+CkluClh+CkggAfU+Ckn+Clh+CkleCljeCkuOCljeCknyDgpIfg
pKjgpKrgpYHgpJ8g4KSu4KWL4KShIOCkquCksCDgpLjgpY3gpLXgpL/gpJog4KSV4KSw4KWH4KSC
AAMJ4KSf4KWI4KSsAAYS4KSh4KS+4KSv4KSy4KWJ4KSXAA0j4KSh4KS+4KSy4KWAIOCkl+CkiCDg
pKTgpL7gpLDgpYDgpJYAEyngpKHgpL7gpLLgpYAg4KSX4KSIIOCkpOCkvuCksOClgOCkljogJTEk
cwAQLuCkoeCljeCksOClieCkquCkoeCkvuCkieCkqCDgpK7gpYfgpKjgpY3gpK/gpYIABQ/gpKTg
pL7gpLDgpYDgpJYAGkLgpKTgpL7gpLDgpYDgpJYg4KSV4KWAIOCkpuClgCDgpJfgpIgg4KS44KWA
4KSu4KS+IOCkl+CksuCkpCDgpLngpYgAPYCL4KSk4KS+4KSw4KWA4KSWIOCkleCliyDgpLjgpL7g
pLIg4KSV4KWHIOCkuOCkueClgCDgpKvgpLzgpYngpLDgpY3gpK7gpYjgpJ8g4KSu4KWH4KSCIOCk
qOCkueClgOCkgiDgpKHgpL7gpLLgpL4g4KSX4KSv4KS+IOCkueCliCAlMSRzIC0gJTIkcwALH+Ck
pOCkvuCksOClgOCkliDgpJrgpYHgpKjgpYfgpIIALGrgpKTgpL7gpLDgpYDgpJYg4KS44KS54KWA
IOCkq+CkvOClieCksOCljeCkruCliOCknyDgpK7gpYfgpIIg4KSo4KS54KWA4KSCIOCkoeCkvuCk
suClgCDgpJfgpIgg4KS54KWIOiAlMSRzAA0l4KSk4KS+4KSw4KWA4KSW4KWH4KSCIOCkmuClgeCk
qOClh+CkggANJeCkpOCkvuCksOClgOCkluClh+CkgiDgpKHgpL7gpLLgpYfgpIIADSPgpKjgpLng
pYDgpIIg4KSa4KWB4KSo4KS+IOCkl+Ckr+CkvgAPK+CkqOClh+CkteCkv+Ckl+Clh+CktuCkqCDg
pK7gpYfgpKjgpY3gpK/gpYIAGELgpKjgpYfgpLXgpL/gpJfgpYfgpLbgpKgg4KSu4KWH4KSo4KWN
4KSv4KWCIOCkrOCkguCkpiDgpJXgpLDgpYfgpIIAECrgpKrgpLngpLLgpYcg4KS44KWHIOCknOCk
vuCksOClgCDgpJXgpYngpLIALnrgpKrgpL/gpJvgpLLgpYcg4KSu4KS54KWA4KSo4KWHIOCkleCl
gCDgpKTgpL7gpLDgpYDgpJYg4KSm4KWH4KSW4KSo4KWHIOCkleClhyDgpLLgpL/gpI8g4KS44KWN
4KSV4KWN4KSw4KWL4KSyIOCkleCksOClh+CkggATM+CkquCkv+Ckm+CksuClhyDgpK7gpLngpYDg
pKjgpYcg4KSq4KSwIOCknOCkvuCkj+CkggAueuCkquCkv+Ckm+CksuClhyDgpLjgpL7gpLLgpYvg
pIIg4KSV4KWAIOCkpOCkvuCksOClgOCkliDgpKbgpYfgpJbgpKjgpYcg4KSV4KWHIOCksuCkv+Ck
jyDgpLjgpY3gpJXgpY3gpLDgpYvgpLIg4KSV4KSw4KWH4KSCAAwg4KSq4KWJ4KSqLeCkheCkqiDg
pLXgpL/gpILgpKHgpYsAHUHgpKvgpLzgpL/gpLLgpLngpL7gpLIsIOCkr+CkuSDgpJrgpYHgpKjg
pL4g4KSX4KSv4KS+IOCkueCliDogJTEkcwADCeCkrOCkguCkpgAGEOCkrOCkguCkpiDgpLngpYgA
DSPgpKzgpKHgpLzgpL4g4KSV4KS/4KSv4KS+IOCkl+Ckr+CkvgAxgIHgpKzgpL7gpKYg4KS14KS+
4KSy4KWHIOCkuOCkvuCksuCli+CkgiDgpJXgpYAg4KSk4KS+4KSw4KWA4KSWIOCkpuClh+CkluCk
qOClhyDgpJXgpYcg4KSy4KS/4KSPIOCkuOCljeCkleCljeCksOCli+CksiDgpJXgpLDgpYfgpIIA
FjrgpKzgpYngpJ/gpK4g4KS24KWA4KSfIOCkleCliyDgpJbgpL7gpLDgpL/gpJwg4KSV4KSw4KWH
4KSCABU34KSs4KWJ4KSf4KSuIOCktuClgOCknyDgpJXgpYsg4KSb4KWL4KSf4KS+IOCkleCksOCl
h+CkggAVN+CkrOClieCkn+CkriDgpLbgpYDgpJ8g4KSV4KWLIOCkrOCkoeCkvOCkviDgpJXgpLDg
pYfgpIIACx/gpKzgpYvgpLLgpJXgpLAg4KSW4KWL4KSc4KWH4KSCAAQM4KSu4KS/4KSo4KSfAAsd
4KSu4KS/4KSo4KSfIOCkleClhyDgpLLgpL/gpI8AChzgpK7gpL/gpKjgpJ8g4KSa4KWB4KSo4KWH
4KSCABo64KSv4KS5IOCkpOCkvuCksOClgOCkliDgpLjgpLngpYAg4KSo4KS54KWA4KSCIOCkueCl
iDogJTEkcwAOJuCksOClh+CkguCknCDgpJXgpYAg4KS24KWB4KSw4KWB4KSG4KSkAAwg4KSw4KWH
4KSC4KScIOCkleClgCDgpLjgpYDgpK7gpL4ACBbgpLDgpYfgpILgpJwg4KSu4KWH4KSCAAkZ4KS1
4KS+4KSq4KS4IOCknOCkvuCkj+CkggAGEuCkteClgOCkoeCkv+Ckr+CliwAMIOCktuClgOCknyDg
pKzgpILgpKYg4KSV4KSw4KWH4KSCABIw4KS24KWB4KSw4KWCIOCkueCli+CkqOClhyDgpJXgpYAg
4KSk4KS+4KSw4KWA4KSWAAkZ4KS44KSt4KWAIOCkpuClh+CkluClh+CkggALH+CkuOCksOCljeCk
miDgpJXgpY3gpLXgpYfgpLDgpYAAECLgpLjgpL7gpLIgJTEkcyDgpKrgpLAg4KSc4KS+4KSP4KSC
AB5O4KS44KS+4KSyIOCkmuClgeCkqOCkqOClhyDgpJXgpL4g4KS14KS/4KSV4KSy4KWN4KSqIOCk
puCkv+CkliDgpLDgpLngpL4g4KS54KWIAEmAveCkuOCkvuCksiDgpJrgpYHgpKjgpKjgpYcg4KSV
4KWHIOCksuCkv+CkjyDgpLjgpY3gpLXgpL7gpIfgpKog4KSV4KSw4KWH4KSCIOCkr+CkviDgpKbg
pL/gpKgg4KSa4KWB4KSo4KSo4KWHIOCkquCksCDgpLXgpL7gpKrgpLgg4KS44KWN4KS14KS/4KSa
IOCkleCksOCkqOClhyDgpLLgpL/gpI8g4KSf4KWI4KSqIOCkleCksOClh+CkggAbR+CkuOCkvuCk
siDgpJrgpYHgpKjgpKjgpYcg4KSV4KWHIOCksuCkv+CkjyDgpLjgpY3gpLXgpL/gpJog4KSV4KSw
4KWH4KSCABQ24KS44KWB4KSd4KS+4KS1IOCkr+CkueCkvuCkgiDgpK7gpYzgpJzgpYLgpKYg4KS5
4KWI4KSCAAoc4KS44KWN4KS14KS/4KSaIOCkleCksOClh+CkggAGEOCkueCliyDgpJfgpK/gpL4A
DyfgpLngpYvgpK4g4KSq4KWH4KScIOCkquCksCDgpJzgpL7gpI/gpIIABQclMSRk4LanABg4JTEk
cyDgt4Dgt4Pgtrsg4LeA4LeZ4LatIOC3g+C2guC2oOC2veC2sSDgtprgtrvgtrHgt4rgtrEAECYl
cyDgt4Pgtrjgtp8g4La24LeZ4Lav4LePIOC2nOC2seC3iuC2sQASMOC2heC2qSDgt4Dgt4Hgtrrg
t5ngtrHgt4og4La94Laa4LeU4Lar4LeUIOC2muC3hQACBuC2heC2rwAVOeC2heC3gOC2veC2guC2
nOC3lCDgtq/gt5LgtrEg4La04La74LeP4LeDIOC2huC2r+C3j+C2seC2ugAKHOC2heC3gOC3g+C3
j+C2sSDgtq/gt5LgtrHgtroACRngtoXgt4Pgt4og4Laa4La74Lax4LeK4LaxAAsf4LaG4La74La4
4LeK4La34LaaIOC2r+C3kuC2seC2ugANI+C2h+C2reC3lOC3heC3lCDgtprgt4Ug4Lav4LeS4Lax
4La6AAsf4LaH4Lav4LeT4La44LeKIOC3hOC3kOC2rOC2veC2ugASMuC2ieC3hOC3heC2pyDgt4Pg
toLgtqDgt4/gtr3gtrHgtrog4Laa4La74Lax4LeK4LaxAB5S4LaK4LeF4LafIOC2uOC3j+C3g+C2
uiDgtrTgt5ngtrHgt4rgt4Dgt5Pgtrjgtqcg4LaF4Lax4LeU4Lag4La94LaxIOC2muC2u+C2seC3
iuC2sQANJeC2i+C2reC3iuC2tOC2reC2sSDgtprgt4Dgt5Tgt4Xgt5Tgt4AADx/gtpHgtprgt4og
4Laa4La74Lax4LeK4LaxOiAlMSRzAAgW4LaR4LaxIOC2h+C2uOC2reC3lOC2uAAYQuC2keC2sSDg
tofgtrjgtq3gt5Tgtrjgtprgt4og4La04La74LeT4Laa4LeK4LeC4LePIOC2muC2u+C2seC3iuC2
sQAOJuC2muC2u+C2nOC3meC2sSDgtrrgtrEg4LaH4La44Lat4LeU4La4ABc/4Laa4La94LeS4Lax
4LeKIOC2uOC3j+C3g+C2uuC2pyDgt4Dgt5ngtrHgt4Pgt4og4Laa4La74Lax4LeK4LaxAAMJ4Laa
4LeF4LePAA0n4Laa4LeK4oCN4La74LeS4La64LeP4Lat4LeK4La44Laa4La64LeSAA8t4Laa4LeK
4oCN4La74LeS4La64LeP4LeA4LeS4La74LeE4LeS4Lat4La64LeSAAsf4Laa4LeS4LeD4LeS4LeA
4Laa4LeKIOC2seC3kOC2rQAEDOC2p+C3kOC2tuC2ugALH+C2reC3gOC2reC3iiDgt4Dgt5Lgtprg
tr3gt4rgtrQACRngtq3gt5rgtrvgt5Yg4Lav4LeS4Lax4La6AAgW4Lat4Led4La74LaxIOC2veC2
r+C3kgAIFuC2reC3neC2u+C3jyDgtrHgt5Dgtq0ADCDgtq/gt5Lgtpwg4LeE4La74LeS4LaxIOC2
veC2r+C3kgAPKeC2r+C3kuC2sSDgtofgtq3gt5Tgt4Xgt5Qg4Laa4La74Lax4LeK4LaxAAoc4Lav
4LeS4LaxIOC2reC3neC2u+C2seC3iuC2sQAiXOC2r+C3kuC2sSDgtq/gtrvgt4rgt4HgtrEg4LaG
4Lav4LeP4LaxIOC2tOC3iuKAjeC2u+C2muC3j+C2u+C2uuC2pyDgtrjgt4/gtrvgt5Qg4LeA4Lax
4LeK4LaxAAQM4Lav4LeS4Lax4La6ACNX4Lav4LeS4Lax4La6IOC2heC2tOC3muC2muC3iuC3guC3
kuC2rSDgtrvgtqfgt4/gt4Dgtqcg4Lax4Lec4Lac4LeQ4LeF4La04LeZ4La64LeSOiAlMSRzAC5o
4Lav4LeS4Lax4La6IOC2heC2tOC3muC2muC3iuC3guC3kuC2rSDgt4Dgt4Pgtrsg4La04La74LeP
4LeD4La64LeZ4Lax4LeKIOC2tOC3kuC2p+C2rSDgt4Dgt5ogJTEkcyAtICUyJHMAFCzgtq/gt5Lg
trHgtrog4LaJ4LapIOC2seC3nOC2r+C3meC2uuC3kjogJTEkcwALH+C2r+C3kuC2seC2uiDgtq3g
t53gtrvgtrHgt4rgtrEABAjgtrQu4LeALgAJGeC2tOC2reC2sSDgtrjgt5ngtrHgt5Tgt4AADCLg
trTgtq3gt4rigI3gtrvgtrog4LeA4LeD4Lax4LeK4LaxAAoc4La04La74LeP4LeDIOC2heC2seC3
iuC2reC2ugALH+C2tOC2u+C3j+C3gyDgtobgtrvgtrjgt4rgtrfgtroACRngtrTgtrvgt4/gt4Pg
trog4Lat4LeU4LeFAB1P4La04LeD4LeUIOC3gOC3g+C2uyDgtrTgt5ngtrHgt4rgt4Dgt5Pgtrjg
tqcg4LaF4Lax4LeU4Lag4La94LaxIOC2muC2u+C2seC3iuC2sQAJGeC2tOC3hOC2rSDgtrrgt53g
tqLgtrHgt48AFTngtrTgt4Tgt4Xgtrgg4La04Lat4LeK4oCN4La74La6IOC2heC3g+C3iiDgtprg
trvgtrHgt4rgtrEAFjzgtrTgt4Tgt4Xgtrgg4La04Lat4LeK4oCN4La74La6IOC2r+C3kuC2nCDg
t4Tgtrvgt5LgtrHgt4rgtrEAEzXgtrTgt4Tgt4Xgtrgg4La04Lat4LeK4oCN4La74La6IOC3hOC2
muC3lOC3heC2seC3iuC2sQAOKOC2tOC3iuKAjeC2u+C2nOC2reC3kuC2uuC3miDgtrTgt4Dgtq3g
t5MADSXgtrTgt4rigI3gtrvgtq3gt5Lgtprgt4rgt4Lgt5rgtrQg4LaaAAMJ4La04LeQ4La6AAgO
4La04LeQ4La6ICUxJGQAChzgtrTgt5Dgtrog4Lat4Led4La74Lax4LeK4LaxAAoc4La04LeQ4La6
4Laa4LeKIOC3g+C2s+C3hOC3jwAMIOC2tOC3kuC3heC3kuC2reC3lOC2u+C3lCDgtq/gt5kuAAUL
4La04LeZLuC3gC4AFC7gtrTgt5ku4LeALiDgt4Tgt50g4La0LuC3gC4g4Lat4Led4La74Lax4LeK
4LaxAB5S4La04LeZ4La7IOC2uOC3j+C3g+C2uiDgtrTgt5ngtrHgt4rgt4Dgt5Pgtrjgtqcg4LaF
4Lax4LeU4Lag4La94LaxIOC2muC2u+C2seC3iuC2sQAdT+C2tOC3meC2uyDgt4Dgt4Pgtrsg4La0
4LeZ4Lax4LeK4LeA4LeT4La44LanIOC2heC2seC3lOC2oOC2veC2sSDgtprgtrvgtrHgt4rgtrEA
HEzgtrTgt5ngt4Ug4LaG4Lav4LeP4LaxIOC2tOC3iuKAjeC2u+C2muC3j+C2u+C2uuC2pyDgtrjg
t4/gtrvgt5Qg4LeA4Lax4LeK4LaxAAUP4La44Laa4Lax4LeK4LaxAAoc4La44LeP4La74LeUIOC2
muC2u+C2seC3iuC2sQANHeC2uOC3kuC2seC3kuC2reC3iuC2reC3lCAlMSRkABM14La44LeS4Lax
4LeS4Lat4LeK4Lat4LeUIOC2nOC2q+C2seC2muC3iiDgt4PgtrPgt4Tgt48ADyvgtrjgt5LgtrHg
t5Lgtq3gt4rgtq3gt5Qg4Lat4Led4La74Lax4LeK4LaxABlF4La44LeU4La94LeKIOC2tOC3kuC2
p+C3lOC3gOC2pyDgt4PgtoLgtqDgt4/gtr3gtrHgtrog4Laa4La74Lax4LeK4LaxAAsf4La44LeZ
4LeA4La94La44LeKIOC2ieC2n+C3kuC2ugAUOOC2uOC3meC3gOC2veC2uOC3iiDgtongtp/gt5Lg
trog4La04LeZ4Lax4LeK4LeA4Lax4LeK4LaxAA4o4La64LeZ4Lav4LeU4La44Laa4LeKIOC2reC3
neC2u+C2seC3iuC2sQAVOeC2veC2tuC2sSDgtrjgt4/gt4Pgtrrgtqcg4LeA4LeZ4Lax4LeD4LeK
IOC2muC2u+C2seC3iuC2sQASKOC3gOC2reC3iuC2uOC2seC3iiDgtq3gt5rgtrvgt5Pgtrg6ICUx
JHMAEjLgt4Dgtr3gtoLgtpzgt5Qg4Lax4Lec4LeA4LaxIOC2huC2r+C3j+C2seC2uuC2muC3kgAV
O+C3gOC3g+C2uyDgtq3gt53gtrvgtprgtrog4Lav4LeY4LeB4LeK4oCN4La64La44LeP4Lax4La6
4LeSABY84LeA4LeD4La74Laa4LeKIOC2reC3muC2u+C3k+C2uOC2pyDgtrjgt4/gtrvgt5Qg4LeA
4Lax4LeK4LaxAEuAyeC3gOC3g+C2u+C2muC3iiDgtq3gt5rgtrvgt5Pgtrjgtqcg4LeD4LeK4LeA
4La64LeS4La04LeKIOC2muC2u+C2seC3iuC2sSwg4Lax4LeQ4Lat4LeE4Lec4Lat4LeKIOC2r+C3
kuC2seC2muC3iiDgtq3gt5rgtrvgt5Pgtrjgtqcg4LaG4La04LeD4LeUIOC2uOC3j+C2u+C3lCDg
t4Dgt5Pgtrjgtqcg4Lat4Lan4LeK4Lan4LeUIOC2muC2u+C2seC3iuC2sQAGEuC3gOC3kuC2seC3
j+C2qeC3kgARL+C3gOC3kuC2uOC3g+C3lOC2uCDgtrrgt5zgtrjgt5Qg4Laa4La74Lax4LeK4Lax
ABEv4LeA4LeS4La44LeD4LeU4La4IOC3hOC3kuC3g+C3iiDgtprgtrvgtrHgt4rgtrEADSXgt4Dg
t5Lgt4PgtrHgt4rgtrDgt5Ig4Laa4La74Lax4LeK4LaxAAYS4LeA4LeT4Lap4LeS4La64LedAAwi
4LeD4LaC4Lag4LeP4La94LaxIOC2uOC3meC2seC3lOC3gAASMuC3g+C2guC2oOC3j+C2veC2sSDg
trjgt5ngtrHgt5Tgt4Ag4LeA4LeD4Lax4LeK4LaxAAYS4LeD4LaC4LeA4LeP4Lav4La6AA0j4LeD
4La44LacIOC2tuC3meC2r+C3jyDgtpzgtrHgt4rgtrEACxXgt4Pgt5LgtrrgtrrgtqcgJTEkZC4A
DCLgt4Pgt5Lgtrrgtr3gt4rgtr0g4La24La94Lax4LeK4LaxAAUP4LeD4LeZ4LeA4LeT4La4AA0l
4LeD4LeZ4LeA4LeU4La44LeKIOC3gOC3kuC2uOC3g+C3lOC2uAAJFeC3g+C3nOC2uuC2seC3iuC2
sS4uLgAJGeC3hOC2muC3lOC3heC2sSDgtr3gtq/gt5IABxXgt4Tgtprgt5Tgt4XgtrHgt4rgtrEA
CBbgt4Tgtqwg4LeD4LeZ4LeA4LeT4La4AAgKJTEkZCBnaeG7nQAJCiUxJGQgcGjDunQABwclMSRk
JSUuAAMFQuG6rFQAFR1C4buPIHF1YSBi4bqjbmcgZMaw4bubaSBjw7luZwAUHULhu5kgY2jhu41u
IG7Eg20gaGnhu4NuIHRo4buLAAICQ0gACw9DaGlhIHPhursgduG7m2kADhJDaGlhIHPhursgduG7
m2kgJXMABghDaHV54buDbgAcJ0NodXnhu4NuIHNhbmcgY2jhur8gxJHhu5kgbmjhuq1wIGzhu4tj
aAAfK0NodXnhu4NuIHNhbmcgY2jhur8gxJHhu5kgbmjhuq1wIHbEg24gYuG6o24AFBlDaHV54buD
biBzYW5nIGNo4buNbiBuxINtABsgQ2h1eeG7g24gc2FuZyB0aMOhbmcgdGnhur9wIHRoZW8AFR1D
aHV54buDbiB24buBIHRow6FuZyB0csaw4bubYwATGUNodXnhu4NuIMSR4bq/biBuxINtICUxJHMA
EBZDaMO6IGdp4bqjaSBjw7RuZyBj4bulAAkMQ2jGsGEgY2jhu41uABAZQ2jhu4kgxJHGsOG7nW5n
IHbhu4EgbmjDoAAPE0No4buNbiBTQSBob+G6t2MgQ0gACAxDaOG7jW4gZ2nhu50AERlDaOG7jW4g
beG7mXQg4bupbmcgZOG7pW5nAAkMQ2jhu41uIG5nw6B5AAkMQ2jhu41uIHBow7p0ABcgQ3Xhu5lj
IGfhu41pIMSRYW5nIHRo4buxYyBoaeG7h24ADBNDdeG7mWMgZ+G7jWkgxJHhur9uABokQ3Xhu5lu
IMSR4buDIGhp4buHbiBuaOG7r25nIG7Eg20gc2F1ABwpQ3Xhu5luIMSR4buDIGhp4buHbiBuaOG7
r25nIG7Eg20gdHLGsOG7m2MAFh5DdeG7mW4gxJHhu4MgaGnhu4duIHRow6FuZyBzYXUAGCNDdeG7
mW4gxJHhu4MgaGnhu4duIHRow6FuZyB0csaw4bubYwAWIkPDoWMgxJHhu4EgeHXhuqV0IOG7nyBi
w6puIGTGsOG7m2kADhVD4butYSBz4buVIGLhuq10IGzDqm4ADRBEaSBjaHV54buDbiBsw6puABkj
R2nDoSB0cuG7iyBuaOG6rXAga2jDtG5nIGjhu6NwIGzhu4cAAwVHaeG7nQAMEEfhu61pIHRydXkg
duG6pW4AGSNIaeG7g24gdGjhu4sgY2jDuiBnaeG6o2kgY8O0bmcgY+G7pQAHCEjDtG0gbmF5AAkN
SOG7mXAgdGhv4bqhaQAICktow7RuZyBjw7MACAtL4bq/dCB0aMO6YwAXH0zhu7FhIGNo4buNbiBo
aeG7h24gdOG6oWk6ICUxJHMAFiBN4bufIHLhu5luZyBi4bqjbmcgZMaw4bubaSBjw7luZwAEBU5n
w6B5AAwSTmfDoHkgYuG6r3QgxJHhuqd1ACs6TmfDoHkga2jDtG5nIGto4bubcCB24bubaSDEkeG7
i25oIGThuqFuZyBk4buxIGtp4bq/bjogJTEkcwAwPU5nw6B5IGtow7RuZyB0aHXhu5ljIHBo4bqh
bSB2aSBuxINtIGThu7Ega2nhur9uICUxJHMg4oCTICUyJHMAGiFOZ8OgeSBraMO0bmcgxJHGsOG7
o2MgcGjDqXA6ICUxJHMADRFOZ8OgeSBr4bq/dCB0aMO6YwAMEU5nw6B5IMSRw6MgY2jhu41uAAwR
TmfDoHkgxJHDoyBuaOG6rXAAEhdOZ8OgeSDEkcOjIG5o4bqtcDogJTEkcwAJDE5o4bqtcCBuZ8Og
eQAHCU7DunQga8OpbwAEBVBow7p0ACEtUGjhuqFtIHZpIG5nw6B5IMSRw6Mgbmjhuq1wIGtow7Ru
ZyBo4bujcCBs4buHAAICU0EABwlUaHUgZ+G7jW4AFh5UaHUgZ+G7jW4gYuG6o25nIGTGsOG7m2kg
Y8O5bmcAAwVUaOG6uwAMDlRyb25nIGtob+G6o25nABEWVHJ1eSB24bqlbiB0w6xtIGtp4bq/bQAT
GlRyw6xuaCDEkcahbiB0aOG6oyB4deG7kW5nABQdVHLDrG5oIMSRxqFuIMSRaeG7gXUgaMaw4bub
bmcABwtUcuG6oyBs4budaQAIC1TDrG0ga2nhur9tABcfVMOsbSBraeG6v20gYuG6sW5nIGdp4buN
bmcgbsOzaQAJDlTDrG0ga2nhur9t4oCmAA0RVMO5eSBjaOG7jW4ga2jDoWMAAwVU4bquVAAHC1Th
u6sgY2jhu5FpAD1ZVnXhu5F0IMSR4buDIGNo4buNbiBt4buZdCBuxINtIGhv4bq3YyBuaOG6pW4g
xJHhu4MgY2h1eeG7g24gbOG6oWkgduG7gSBjaOG7jW4gbeG7mXQgbmfDoHkACg5YZW0gdOG6pXQg
Y+G6owAEBFhvbmcADA9Yw7NhIHRydXkgduG6pW4ACQ924buBIHPhu5EgZ2nhu50ACg924buBIHPh
u5EgcGjDunQACAvEkGFuZyBi4bqtdAAaJcSQYW5nIHPDoG5nIGzhu41jIGN14buZYyBn4buNaSDE
keG6v24ADhPEkGFuZyB0aOG7sWMgaGnhu4duAAgLxJBhbmcgdOG6r3QAFB7EkGnhu4NtIGLhuq90
IMSR4bqndSBwaOG6oW0gdmkAFR3EkGnhu4NtIGvhur90IHRow7pjIHBo4bqhbSB2aQAHC8SQw6Mg
Y2jhu41uABQcxJDDoyBraeG7g20gdHJhIG3hu5l0IHBo4bqnbgAKEMSQw6MgbeG7nyBy4buZbmcA
Cg7EkMOjIHRodSBn4buNbgAEBsSQw7NuZwAPEsSQw7NuZyB0cmFuZyB0w61uaAAZJMSQw7NuZyB0
csOsbmggxJHGoW4gxJFp4buBdSBoxrDhu5tuZwAgNCJBTSIg0L3QtdC80LXRgdC1ICJQTSIg0YTQ
vtGA0LzQsNGC0YvQvSDRgtCw0qPQtNCw0YMACg8lMSRkINC80LjQvdGD0YIACxAlMSRkINC/0LDQ
udGL0LcuAAoPJTEkZCDRgdCw0pPQsNGCABcqJXMg0pvQvtC70LTQsNC90LHQsNGB0YvQvNC10L0g
0LHTqdC70ZbRgdGDAAUJTdC40L3Rg9GCAAUK0IbQt9C00LXRgwAMF9CG0LfQtNC10YMg0YHSsdGA
0LDRg9GLAAYN0IbQt9C00LXRg+KApgAnSdCQ0LvQtNGL0qPSk9GLINCw0LnQtNGLINC606nRgNGB
0LXRgtGDINKv0YjRltC9INCw0LnQvdCw0LvQtNGL0YDRi9Kj0YvQty4AFCbQkNC70LTRi9Kj0pPR
iyDQsNC50pPQsCDTqdC30LPQtdGA0YLRgwArUdCQ0LvQtNGL0qPSk9GLINC20YvQu9C00LDRgNC0
0Ysg0LrTqdGA0YHQtdGC0YMg0q/RiNGW0L0g0LDQudC90LDQu9C00YvRgNGL0qPRi9C3LgAOG9CQ
0YDQsNC70YvSm9GC0YvSoyDQsdCw0YHRiwAOG9CQ0YDQsNC70YvSm9GC0YvSoyDRgdC+0qPRiwAF
CtCQ0YPRi9GB0YMADhvQkNGI0YvQu9C80LDQu9GLINC805nQt9GW0YAADBfQkNGP0pvRgtCw0LvR
gyDQutKv0L3RlgANGdCR0LDRgNC70YvSk9GL0L0g0LrTqdGA0YMADBfQkdCw0YHRgtCw0LvRgyDQ
utKv0L3RlgAOG9CR0LDRgdKb0LAg0L7Qv9GG0LjRj9C70LDRgAAFCtCR0LXQudC90LUABQrQkdKv
0LPRltC9AAYM0JHTqdC70ZbRgdGDAAUK0JTQsNC50YvQvQAOG9CU0LDRg9GL0YHQv9C10L0g0ZbQ
t9C00LXRgwAsTtCU0LXRgNC10LrRgtC10YAg0LHQvtC70LbQsNC70LTRiyDTqdGA0L3QtdC60LrQ
tSDRgdCw0Lkg0LrQtdC70LzQtdC50LTRljogJTEkcwASI9CU0LXRgNC10LrRgtC10YAg0LXQvdCz
0ZbQt9GW0LvQtNGWABgp0JTQtdGA0LXQutGC0LXRgCDQtdC90LPRltC30ZbQu9C00ZY6ICUxJHMA
HzbQlNC10YDQtdC60YLQtdGAINGA0rHSm9GB0LDRgiDQtdGC0ZbQu9C80LXQudC00ZY6ICUxJHMA
EB/QlNC40LDQu9C+0LPRgtGW0Log0YLQtdGA0LXQt9C1ABgt0JXQvdCz0ZbQt9GW0LvQs9C10L0g
0LzTmdC9INC20LDRgNCw0LzRgdGL0LcuAAgQ0JXRiNKb0LDQvdC00LDQuQAECNCW0LDQsdGDAAcO
0JbQsNC50YvQu9C00YsAI0LQltCw0YDQsNC80YHRi9C3INC60q/QvdC00LXRgCDQsNGA0LDQu9GL
0pPRiyDQtdC90LPRltC30ZbQu9Cz0LXQvS4AFCbQltCw0YDRgtGL0LvQsNC5INCx0LXQu9Cz0ZbQ
u9C10L3QtNGWLgAFCtCW0LDRg9Cw0L8ABgzQltC40YvQu9C00YsAAwbQltC40Y4AEB7QltC+0pPQ
sNGA0Ysg0pvQsNGA0LDQuSDTqdGC0YMAAwbQltC+0psAPXDQltGL0Lsg0YLQsNKj0LTQsNGDINKv
0YjRltC9INGB0YvRgNKT0YvRgtGL0qPRi9C3LiDQmtKv0L0g0YLQsNKj0LTQsNGD0pPQsCDQsNGD
0YvRgdGDINKv0YjRltC9INGC0q/RgNGC0ZbSo9GW0LcuABAe0JbRi9C7INGC0LDSo9C00LDRg9KT
0LAg06nRgtGDACtR0JrQtdC50ZbQvdCz0ZYg0LbRi9C70LTQsNGA0LTRiyDQutOp0YDRgdC10YLR
gyDSr9GI0ZbQvSDQsNC50L3QsNC70LTRi9GA0YvSo9GL0LcuABUo0JrQtdC70LPQtdC9INKb0L7S
o9GL0YDQsNGD0LTRiyDRgdKv0LfRgwAmR9Ca0LXQu9C10YHRliDQsNC50LTRiyDQutOp0YDRgdC1
0YLRgyDSr9GI0ZbQvSDQsNC50L3QsNC70LTRi9GA0YvSo9GL0LcuABMk0JrQtdC70LXRgdGWINCw
0LnSk9CwINOp0LfQs9C10YDRgtGDAA0Z0JrRltGA0ZbRgSDSm9C+0qPRi9GA0LDRgwAKE9Ca0q/Q
vSDRgtCw0qPQtNCw0YMAESHQmtKv0L3QtNC10YAg0LDRgNCw0LvRi9KT0YvQvdC00LAADRnQmtKv
0L3QtNC10YAg0YLQsNKj0LTQsNGDABIj0JrSr9C90LTQtdGA0LTRliDQtdC90LPRltC30ZbSo9GW
0LcADhvQmtKv0L3QtNGWINGC0LDSo9C00LDSo9GL0LcAIT/QmtKv0L3RgtGW0LfQsdC10L3RltKj
INC10L3Qs9GW0LfRgyDRgNC10LbQuNC80ZbQvdC1INCw0YPRi9GB0YMABAjQmtKv0L3RlgAgNdCa
0q/RgtGW0LvQtdGC0ZbQvSDQttGL0Lsg0LDRgNCw0LvRi9KT0Ys6ICUxJHPigJMlMiRzABkw0JrT
qdGA0YHQtdGC0ZbQu9Cz0LXQvSDQttGL0Lsg0YLQsNKj0LTQsNKT0YvRiNGLAAwX0JzQuNC90YPR
giDRgtCw0qPQtNCw0YMAFCDQnNGL0L3QsCDQttGL0LvSk9CwINOp0YLRgzogJTEkcwAbM9Cc05nR
gtGW0L0g0LXQvdCz0ZbQt9GDINGA0LXQttC40LzRltC90LUg0LDRg9GL0YHRgwAQH9Cd0LDQstC4
0LPQsNGG0LjRjyDQvNOZ0LfRltGA0ZYAFirQndCw0LLQuNCz0LDRhtC40Y8g0LzTmdC30ZbRgNGW
0L0g0LbQsNCx0YMAESDQndC10LPRltC30LPRliDQsdC10YLQutC1INOp0YLRgwAKFNCe0YDRi9C9
0LTQsNC70YPQtNCwAAwX0J/QsNGA0LDSm9GC0Ysg0LbQsNCx0YMABQrQodCw0pPQsNGCAA4b0KHQ
sNKT0LDRgtGC0Ysg0YLQsNKj0LTQsNGDAA8d0KHSr9C50YDQtdC50YLRltC9INGC0LXRgtGW0LoA
DhvQodKx0YDQsNGD0LTRiyDQttGW0LHQtdGA0YMADRnQodKx0YDQsNGD0LTRiyDTqdGI0ZbRgNGD
AAgQ0KLQsNKj0LTQsNC70LTRiwAKFNCi0LDSo9C00LDQu9C80LDQtNGLAA0Z0KLQsNKj0LTQsNC7
0pPQsNC9INC60q/QvQALFdCi0rHRgtKb0LDQvdGLINKb0L7RjgAWKtCi06nQvNC10L3Qs9GWINC/
0LDRgNCw0pvRiNCw0L3RiyDQttCw0LHRgwAVKNCi06nQvNC10L3Qs9GWINC/0LDRgNCw0pvRiNCw
0L3RiyDQttCw0Y4AFSjQotOp0LzQtdC90LPRliDQv9Cw0YDQsNKb0YjQsNC90Ysg0LbQuNGOABMl
0KLTqdC80LXQvdC00LXQs9GWINKx0YHRi9C90YvRgdGC0LDRgAAID9Cx0L7RgSDQvtGA0YvQvQAF
CtC80LjQvdGD0YIABQrRgdCw0pPQsNGCAAsV0YLSr9GB0LrQtSDQtNC10LnRltC9AAwX0YLSr9GB
0YLQtdC9INC60LXQudGW0L0ABAjSmtCe0KHQowAKFNKa0LDQsdGL0LvQtNCw0LzQsNGDABQh0prQ
sNC30ZbRgNCz0ZYg0YLQsNKj0LTQsNGDOiAlMSRzAA0Z0prQsNC70pvRi9C80LAg0LrTqdC80LXQ
ugAXLNKa0LDQu9Kb0YvQvNCwINC606nQvNC10LrRgtGWINC606nRgNGB0LXRgtGDABAf0prQsNC7
0pvRi9C80LDQu9GLINGC0LXRgNC10LfQtQAHDtKa0L7QudGL0L3QtNGLABEh0prQvtC70LTQsNC9
0LHQsNC90Ysg0YLQsNKj0LTQsNGDAAYM0prQvtGB0YPQu9GLAAcO0prQvtKj0YvRgNCw0YMABQrT
qNCo0IbQoNCjAAcO06jRiNGW0YDRg9C70ZYADhYlMSRkINC/0YDQvtGG0LXQvdGC0LguAAoPJTEk
ZCDRh9Cw0YHQvtGCAAgQ0JLQmtCb0KPQp9CV0J3QngAIENCS0LrQu9GD0YfQtdC90L4ADBfQktC9
0LXRgdC10L0g0LTQsNGC0YPQvAASHdCS0L3QtdGB0LXQvSDQtNCw0YLRg9C8OiAlMSRzAA4b0JLQ
vdC10YHQtdGC0LUg0LTQsNGC0YPQvNC4ACND0JLQvdC10YHQvtCy0YLQtSDQvdC10LLQsNC20LXR
h9C60Lgg0LLRgNC10LzQtdC90YHQutC4INC/0LXRgNC40L7QtAAID9CS0L4g0L7Qv9GB0LXQswAG
C9CS0L4g0YLQtdC6ABQn0JPQu9Cw0YHQvtCy0L3QviDQv9GA0LXQsdCw0YDRg9Cy0LDRmtC1AAUK
0JTQsNGC0YPQvAATJNCU0LDRgtGD0Lwg0L3QsCDQt9Cw0LLRgNGI0YPQstCw0ZrQtQAUJtCU0LDR
gtGD0Lwg0L3QsCDQt9Cw0L/QvtGH0L3Rg9Cy0LDRmtC1ADdb0JTQsNGC0YPQvNC+0YIg0L3QtSDQ
tSDQstC+INC+0YfQtdC60YPQstCw0L3QuNC+0YIg0L7Qv9GB0LXQsyDQvdCwINCz0L7QtNC40L3Q
uCAlMSRzIC0gJTIkcwAbLdCU0LDRgtGD0LzQvtGCINC90LUg0LUg0LTQvtC30LLQvtC70LXQvTog
JTEkcwARH9CU0LLQuNC20Lgg0YHQtSDQutC+0L0g0LTQvtC80LAADxzQlNCy0LjQttC4INGB0LUg
0L3QsNCz0L7RgNC1ABEh0JTQtdC70YPQvNC90L4g0L/RgNC+0LLQtdGA0LXQvdC+AAUK0JTQtdC9
0LXRgQAHDtCU0LjRmNCw0LvQvtCzAA4b0JTQvtGY0LTQvtCy0LXQvSDQv9C+0LLQuNC6ABMk0JfQ
sNGC0LLQvtGA0LXRgtC1INCz0L4g0LvQuNGB0YLQvtGCACE+0JfQsNGC0LLQvtGA0LXRgtC1INCz
0L4g0LzQtdC90LjRgtC+INC30LAg0L3QsNCy0LjQs9Cw0YbQuNGY0LAACRLQmNCh0JrQm9Cj0KfQ
ldCd0J4ADhvQmNC30LHQtdGA0LXRgtC1INC00LDRgtGD0LwADx3QmNC30LHQtdGA0LXRgtC1INC0
0LDRgtGD0LzQuAAPHdCY0LfQsdC10YDQtdGC0LUg0LzQuNC90YPRgtC4ACA90JjQt9Cx0LXRgNC1
0YLQtSDQv9GA0LXRgtC/0LvQsNC00L3QtSDQuNC70Lgg0L/QvtC/0LvQsNC00L3QtQAMF9CY0LfQ
sdC10YDQtdGC0LUg0YfQsNGBABEh0JjQt9Cx0LXRgNC4INCw0L/Qu9C40LrQsNGG0LjRmNCwABw0
0JjQt9Cx0LjRgNCw0YfQvtGCINC90LAg0LPQvtC00LjQvdCwINC1INCy0LjQtNC70LjQsgAMF9CY
0LfQsdGA0LDQvSDQtNCw0YLRg9C8AAkS0JjRgdC60LvRg9GH0LXQvdC+AA4b0JjRgdC/0YDQsNGC
0Lgg0LHQsNGA0LDRmtC1AA4b0JjRgdGH0LjRgdGC0Lgg0LHQsNGA0LDRmtC1AAgQ0JrQsNGA0YLQ
uNGH0LrQsAAPHNCa0YDQsNGYINC90LAg0L7Qv9GB0LXQs9C+0YIAL1jQm9C40LfQs9Cw0ZjRgtC1
INC30LAg0LTQsCDQs9C4INC/0YDQuNC60LDQttC10YLQtSDQv9C+0LTQvtGG0L3QtdC20L3QuNGC
0LUg0LPQvtC00LjQvdC4AC5W0JvQuNC30LPQsNGY0YLQtSDQt9CwINC00LAg0LPQuCDQv9GA0LjQ
utCw0LbQtdGC0LUg0L/RgNC10YLRhdC+0LTQvdC40YLQtSDQs9C+0LTQuNC90LgALVTQm9C40LfQ
s9Cw0ZjRgtC1INC30LAg0LTQsCDQs9C+INC/0YDQuNC60LDQttC10YLQtSDQv9GA0LXRgtGF0L7Q
tNC90LjQvtGCINC80LXRgdC10YYAKk7Qm9C40LfQs9Cw0ZjRgtC1INC30LAg0LTQsCDQs9C+INC/
0YDQuNC60LDQttC10YLQtSDRgdC70LXQtNC90LjQvtGCINC80LXRgdC10YYAEiLQnNC10L3QuCDQ
t9CwINC90LDQstC40LPQsNGG0LjRmNCwACdD0J3QtSDRgdC1INGB0L7QstC/0LDRk9CwINGB0L4g
0L7Rh9C10LrRg9Cy0LDQvdCw0YLQsCDRiNC10LzQsDogJTEkcwAPHdCd0LXQstCw0LbQtdGH0LrQ
uCDQt9Cw0L/QuNGBAAQI0J3QtdC80LAABQrQntC00LHQuNGYAAgQ0J7QtNCz0L7QstC+0YDQuAAW
JdCe0LTQtdGC0LUg0L3QsCDQs9C+0LTQuNC90LDRgtCwICUxJHMABgzQntGC0YTRgNC70LgAFinQ
ntGC0YTRgNC70Lgg0LPQviDQtNC+0LvQvdC40L7RgiDQu9C40YHRggAMF9Cf0LDRk9Cw0YfQutC+
INC80LXQvdC4AAwX0J/QvtCy0LXRnNC1INC+0L/RhtC40LgASoCH0J/QvtCy0LvQtdGH0LXRgtC1
INC30LAg0LTQsCDQuNC30LHQtdGA0LXRgtC1INCz0L7QtNC40L3QsCDQuNC70Lgg0LTQvtC/0YDQ
tdGC0LUg0LfQsCDQtNCwINGB0LUg0LLRgNCw0YLQuNGC0LUg0L3QsCDQsdC40YDQsNGa0LUg0LTQ
tdC9ABIi0J/QvtGH0LXRgtC+0Log0L3QsCDQvtC/0YHQtdCz0L7RggAIENCf0YDQtdCx0LDRgNCw
0ZgADx3Qn9GA0LXQsdCw0YDQsNGYINCx0LDRgNCw0ZrQtQALFtCf0YDQtdCx0LDRgNGD0LLQsNGa
0LUADBnQn9GA0LXQsdCw0YDRg9Cy0LDRmtC14oCmAB030J/RgNC10LTQu9C+0LfQuNGC0LUg0YHQ
tSDQvdCw0LLQtdC00LXQvdC4INC/0L7QtNC+0LvRgwAKFNCf0YDQtdC60LjQvdGD0LLQsNGHABgt
0J/RgNC10YTRgNC70Lgg0L3QsCDQsdC40YDQsNGa0LUg0LPQvtC00LjQvdCwACtQ0J/RgNC10YTR
gNC70Lgg0L3QsCDRgNC10LbQuNC8INC30LAg0LLQvdC10YHRg9Cy0LDRmtC1INCy0L4g0LrQsNC7
0LXQvdC00LDRgNC+0YIAI0HQn9GA0LXRhNGA0LvQuCDQvdCwINGA0LXQttC40Lwg0LfQsCDQstC9
0LXRgdGD0LLQsNGa0LUg0YLQtdC60YHRggAPHNCf0YDQuNC60LDQttC4INCz0Lgg0YHQuNGC0LUA
FyvQn9GA0LjQutCw0LbQuCDRgdC+0LLQtdGCINC30LAg0LDQu9Cw0YLQutCwABox0J/RgNC+0LLQ
tdGA0LrQsCDQvdCwINC00L7RmNC00L7QstC10L0g0L/QvtCy0LjQugAcNdCf0YDQvtC80LXQvdC4
INC90LAg0L/RgNC10YLRhdC+0LTQvdC40L7RgiDQvNC10YHQtdGGABkv0J/RgNC+0LzQtdC90Lgg
0L3QsCDRgdC70LXQtNC90LjQvtGCINC80LXRgdC10YYACRLQn9GA0L7RiNC40YDQtdC90L4AFyvQ
n9GA0L7RiNC40YDQuCDQs9C+INC00L7Qu9C90LjQvtGCINC70LjRgdGCABAe0KDQsNGH0LrQsCDQ
t9CwINCy0LvQtdGH0LXRmtC1ABEh0KHQutC+0LrQsNGH0LrQuCDQv9GA0L7Qt9C+0YDQtdGGAAYM
0KHQvtCx0LXRgNC4ABYp0KHQvtCx0LXRgNC4INCz0L4g0LTQvtC70L3QuNC+0YIg0LvQuNGB0YIA
Bw7QodC+0LHRgNCw0L3QvgAPHNCh0L7QstC10YIg0LfQsCDQsNC70LDRgtC60LAAChPQodC/0L7Q
tNC10LvQuCDRgdC+AA0W0KHQv9C+0LTQtdC70Lgg0YHQviAlcwAGDNCh0L/Rg9GI0YLQuAATH9Ci
0LXQutC+0LLQtdC9INC40LfQsdC+0YA6ICUxJHMADRnQotC10LrQvtCy0LXQvSDQv9C+0LLQuNC6
AAcO0LLRgdC10LvQtdC90LAACRHQt9CwINC80LjQvdGD0YLQuAAGC9C30LAg0YfQsNGBAAcO0LjQ
t9Cx0YDQuNGI0LgACBDQv9C+0L/Qu9Cw0LTQvdC1AAoU0L/RgNC10YLQv9C70LDQtNC90LUABwgl
MSRkwqAlJQAICSUxJGTCoG1pbgAUFkFrdHXDoWxueSB2w71iZXI6ICUxJHMADhBEaWFsw7Nnb3bD
qSBva25vACkuRMOhdHVtIG5lem9kcG92ZWTDoSBvxI1ha8OhdmFuw6ltdSB2em9ydTogJTEkcwA7
QkTDoXR1bSBzYSBuZW5hY2jDoWR6YSB2wqBvxI1ha8OhdmFub20gcm96c2FodSByb2tvdjogJTEk
cyDigJMgJTIkcwAPEUTDoXR1bSB1a29uxI1lbmlhAA0PRMOhdHVtIHphxI1hdGlhABQXSGxhc292
w6kgdnloxL5hZMOhdmFuaWUABghIxL5hZGHFpQAODktvbmllYyByb3pzYWh1AAYHTWluw7p0eQAQ
Ek5hdmlnYcSNbsOhIHBvbnVrYQAOD05lcGxhdG7DvSB2c3R1cAAWF05lcGxhdG7DvSB2c3R1cCBv
YmRvYmlhABYYTmVwb3ZvbGVuw70gZMOhdHVtOiAlMSRzAAkKTmV2eWJyYW7DqQAQFE7DoXZyaHkg
c8O6IG5pxb7FoWllAAkKT2RtaWV0bnXFpQANDk9kb3NsYcWlIGRvcHl0AAUFUG9waXMAKCpQb3N1
bnV0w61tIHNpIHpvYnJhenRlIG5hc2xlZHVqw7pjaSBtZXNpYWMAJCZQb3N1bnV0w61tIHNpIHpv
YnJhenRlIG5lc2tvcsWhaWUgcm9reQArLlBvc3VudXTDrW0gc2kgem9icmF6dGUgcHJlZGNow6Fk
emFqw7pjaSBtZXNpYWMAIiRQb3N1bnV0w61tIHNpIHpvYnJhenRlIHNrb3LFoWllIHJva3kAQkhQ
b3RpYWhudXTDrW0gdnliZXJ0ZSByb2sgYWxlYm8ga2xlcG51dMOtbSBwcmVwbml0ZSBzcMOkxaUg
bmEgdsO9YmVyIGTFiGEACAhQcmViaWVoYQASE1ByZWJpZWhhasO6Y2kgaG92b3IAExNQcmVjaG9k
IG5hIHJvayAlMSRzABARUHJlanPFpSBuYSBwbG9jaHUADA1QcmVqc8WlIG5haG9yAAcJUHJlcG7D
usWlACMoUHJlcG7DusWlIG5hIGthbGVuZMOhcm92w70gcmXFvmltIHZzdHVwdQAfI1ByZXBuw7rF
pSBuYSB0ZXh0b3bDvSByZcW+aW0gdnN0dXB1ABUYUHJlcG7DusWlIG5hIHbDvWJlciByb2thAAoL
UHJlc8O6dmFkbG8AICJQcmV2ZXJ1amUgc2EgcHJpY2jDoWR6YWrDumNpIGhvdm9yABMVUHJpY2jD
oWR6YWrDumNpIGhvdm9yAAYHUHJpamHFpQAJClJvemJhbGVuw6kAFBdSb3piYWxpxaUgZG9sbsO9
IGjDoXJvawATFFJvemJhxL5vdmFjaWEgcG9udWthAAQEVllQLgATE1Z5YmVydGUgQU0gYWxlYm8g
UE0ADg9WeWJlcnRlIGTDoXR1bXkABwhWeWJyYW7DqQAND1Z5YnJhbsO9IGTDoXR1bQAQElZ5YnJh
xaUgYXBsaWvDoWNpdQAMDlZ5YnJhxaUgZMOhdHVtAA0OVnlicmHFpSBob2RpbnUADQ9WeWJyYcWl
IG1pbsO6dHkACQ1WeWjEvmFkYcWl4oCmABEUVnloxL5hZMOhdmFjw60gZG9weXQADA5WeWjEvmFk
w6F2YW5pZQANDlZ5bWF6YcWlIGRvcHl0AAcIVnlwbnV0w6kAERFWeXNrYWtvdmFjaWUgb2tubwAJ
ClbCoHJvenNhaHUAFxpWw71iZXIgcm9rYSBqZSB2aWRpdGXEvm7DvQAEBFpBUC4ADg9aYWRhanRl
IGTDoXR1bXkADA5aYWRhbsO9IGTDoXR1bQASFFphZGFuw70gZMOhdHVtOiAlMSRzAAcIWmFwbnV0
w6kABwhaYXZyaWXFpQATFlphdnJpZcWlIGRvbG7DvSBow6Fyb2sADQ9aYXZyaWXFpSBow6Fyb2sA
GBtaYXZyaWXFpSBuYXZpZ2HEjW7DuiBwb251a3UAEBFaYcSNaWF0b2sgcm96c2FodQAHCFpiYWxl
bsOpAAYHWmJhbGnFpQASFVpiYWxpxaUgZG9sbsO9IGjDoXJvawAJC1pkaWXEvmHFpSBzABcbWmRp
ZcS+YcWlIHPCoGFwbGlrw6FjaW91ICVzAAYIWmxvxb5pxaUAHB5abWVuacWlIG5hIG5hc2xlZHVq
w7pjaSBtZXNpYWMAHyJabWVuacWlIG5hIHByZWRjaMOhZHphasO6Y2kgbWVzaWFjAA0OWm9icmF6
acWlIG9waXMADxFab2JyYXppxaUgdsWhZXRreQAGBmhvZGluYQAJCm1lZHplcm7DrWsABgdtaW7D
unR5AAkLb2RzdHLDoW5pxaUAFRnEjGlhc3RvxI1uZSB6YcSNaWFya251dMOpAA8SxI5hbMWhaWUg
bW/Fvm5vc3RpAAYHxb1pYWRuZQAGB8W9aWFkbnkACAslMSRkINCz0L7QtAAPHdCQ0LrRgtC40LLQ
vdC40Lkg0LLQuNC60LvQuNC6AAwX0JHRltC70YzRiNC1INC+0L/RhtGW0LkADBfQktCy0LXQtNC1
0L3QsCDQtNCw0YLQsAASHdCS0LLQtdC00LXQvdCwINC00LDRgtCwOiAlMSRzABUo0JLQstC10LTQ
tdC90L4g0L3QtdC00ZbQudGB0L3RliDQtNCw0L3RlgAMF9CS0LLQtdC00ZbRgtGMINC00LDRgtC4
ABgv0JLQstC10LTRltGC0Ywg0L/QvtGI0YPQutC+0LLQuNC5INC30LDQv9C40YLigKYAER/QktC4
0LHQtdGA0ZbRgtGMINCU0J8g0YfQuCDQn9CfAA0Z0JLQuNCx0LXRgNGW0YLRjCDQtNCw0YLQuAAN
GdCS0LjQsdC10YDRltGC0Ywg0LTQsNGC0YMADBfQktC40LHRgNCw0L3QsCDQtNCw0YLQsAAHDtCS
0LjQsdGA0LDQvdC+AA4b0JLQuNCx0YDQsNGC0Lgg0LPQvtC00LjQvdGDAAwX0JLQuNCx0YDQsNGC
0Lgg0LTQsNGC0YMAEB/QktC40LHRgNCw0YLQuCDQv9GA0L7Qs9GA0LDQvNGDAA8d0JLQuNCx0YDQ
sNGC0Lgg0YXQstC40LvQuNC90LgACxbQktC40LrQvtC90YPRlNGC0YzRgdGPAAgQ0JLQuNC80LrQ
vdC10L3QvgAOG9CS0YXRltC00L3QuNC5INCy0LjQutC70LjQugAXKtCS0YXRltC00L3QuNC5INCy
0LjQutC70LjQuiAo0KTRltC70YzRgtGAKQAFCtCS0ZbQtNC10L4AChTQktGW0LTQv9C+0LLRltGB
0YLQuAAQGdCS0ZbQtNGB0L7RgtC60ZbQsjogJTEkZC4ACRLQktGW0LTRhdC40LvQuNGC0LgABQrQ
ktGW0LrQvdC+AAYM0JPQvtC00LjQvdCwAA8d0JPQvtC70L7RgdC+0LLQuNC5INC/0L7RiNGD0LoA
AgTQlNCfADZd0JTQsNGC0LAg0LfQsCDQvNC10LbQsNC80Lgg0L7Rh9GW0LrRg9Cy0LDQvdC+0LPQ
viDQtNGW0LDQv9Cw0LfQvtC90YMg0YDQvtC60ZbQsiAlMSRzIOKAkyAlMiRzAA8d0JTQsNGC0LAg
0LfQsNCy0LXRgNGI0LXQvdC90Y8ALE7QlNCw0YLQsCDQvdC1INCy0ZbQtNC/0L7QstGW0LTQsNGU
INC+0YfRltC60YPQstCw0L3QvtC80YMg0YjQsNCx0LvQvtC90YM6ICUxJHMADBfQlNCw0YLQsCDQ
v9C+0YfQsNGC0LrRgwAGDNCX0J3QmNCW0JrQkAAJEtCX0LDQstC10YDRiNC40YLQuAAHDtCX0LDQ
utGA0LjRgtC4AA0Z0JfQsNC60YDQuNGC0Lgg0LDRgNC60YPRiAAWKtCX0LDQutGA0LjRgtC4INC8
0LXQvdGOINC90LDQstGW0LPQsNGG0ZbRlwAUJtCX0LDQutGA0LjRgtC4INC90LjQttC90ZbQuSDQ
tdC60YDQsNC9AAgQ0JfQs9C+0YDQvdGD0YLQuAAVKNCX0LPQvtGA0L3Rg9GC0Lgg0L3QuNC20L3R
ltC5INC10LrRgNCw0L0ACBDQl9Cz0L7RgNC90YPRgtC+ABAf0JrRltC90LXRhtGMINC00ZbQsNC/
0LDQt9C+0L3RgwASI9Cc0LDRgNC60LXRgCDQv9C10YDQtdC80ZbRidC10L3QvdGPAA4b0JzQtdC9
0Y4g0L3QsNCy0ZbQs9Cw0YbRltGXAA4b0J3QsNGW0YHQu9Cw0YLQuCDQt9Cw0L/QuNGCAAoT0J3Q
tSDQstC40LHRgNCw0L3QvgAWJdCd0LXQtNC+0L/Rg9GB0YLQuNC80LAg0LTQsNGC0LA6ICUxJHMA
BQrQndC10LzQsNGUAA4b0J7Rh9C40YHRgtC40YLQuCDQt9Cw0L/QuNGCAAIE0J/QnwAkQ9Cf0LXR
gNC10LnRgtC4INCyINGA0LXQttC40Lwg0LLQstC10LTQtdC90L3RjyDQsiDQutCw0LvQtdC90LTQ
sNGA0ZYAHzrQn9C10YDQtdC50YLQuCDQsiDRgNC10LbQuNC8INCy0LLQtdC00LXQvdC90Y8g0YLQ
tdC60YHRgtGDAA0Z0J/QtdGA0LXQudGC0Lgg0LLQs9C+0YDRgwAUIdCf0LXRgNC10LnRgtC4INC0
0L4gJTEkcyDRgNC+0LrRgwAWKdCf0LXRgNC10LnRgtC4INC00L4g0LLQuNCx0L7RgNGDINGA0L7Q
utGDABw10J/QtdGA0LXQudGC0Lgg0LTQviDQvdCw0YHRgtGD0L/QvdC+0LPQviDQvNGW0YHRj9GG
0Y8AHjnQn9C10YDQtdC50YLQuCDQtNC+INC/0L7Qv9C10YDQtdC00L3RjNC+0LPQviDQvNGW0YHR
j9GG0Y8AEiLQn9C10YDQtdC50YLQuCDQvdCwINCz0L7Qu9C+0LLQvdGDAAkS0J/QtdGA0LXQvNC4
0LrQsNGHABsx0J/QvtC00ZbQu9C40YLQuNGB0Y8g0YfQtdGA0LXQtyDQtNC+0LTQsNGC0L7QuiAl
cwALFdCf0L7QtNGW0LvQuNGC0LjRgdGPOgAMF9Cf0L7QutCw0LfQsNGC0Lgg0LLRgdGWABEh0J/Q
vtC60LDQt9Cw0YLQuCDQv9GW0LTQutCw0LfQutGDABw10J/QvtC60LDQt9GD0LLQsNGC0Lgg0LfQ
sNGB0ZbQsSDQstC40LHQvtGA0YMg0YDQvtC60YMAFCHQn9C+0YLQvtGH0L3QuNC5INCy0LjQsdGW
0YA6ICUxJHMAESHQn9C+0YfQsNGC0L7QuiDQtNGW0LDQv9Cw0LfQvtC90YMADx3Qn9C+0YjRg9C6
0L7QstC40Lkg0LfQsNC/0LjRggBbgKbQn9GA0L7QstC10LTRltGC0Ywg0L/QsNC70YzRhtC10Lwg
0L/QviDQtdC60YDQsNC90YMsINGJ0L7QsSDQstC40LHRgNCw0YLQuCDRgNGW0LosINCw0LHQviDR
gtC+0YDQutC90ZbRgtGM0YHRjywg0YnQvtCxINC/0L7QstC10YDQvdGD0YLQuNGB0Y8g0LTQviDQ
stC40LHQvtGA0YMg0LTQvdGPACxT0J/RgNC+0LrRgNGD0YLRltGC0YwsINGJ0L7QsSDQstGW0LTQ
vtCx0YDQsNC30LjRgtC4INC90LDRgdGC0YPQv9C90LjQuSDQvNGW0YHRj9GG0YwAKk/Qn9GA0L7Q
utGA0YPRgtGW0YLRjCwg0YnQvtCxINCy0ZbQtNC+0LHRgNCw0LfQuNGC0Lgg0L/QvtC/0LXRgNC1
0LTQvdGWINGA0L7QutC4AC1V0J/RgNC+0LrRgNGD0YLRltGC0YwsINGJ0L7QsSDQstGW0LTQvtCx
0YDQsNC30LjRgtC4INC/0L7Qv9C10YDQtdC00L3RltC5INC80ZbRgdGP0YbRjAAoS9Cf0YDQvtC6
0YDRg9GC0ZbRgtGMLCDRidC+0LEg0LLRltC00L7QsdGA0LDQt9C40YLQuCDQv9GW0LfQvdGW0YjR
liDRgNC+0LrQuAAOG9Cf0ZbQtNC60LDQt9C60Lgg0LLQvdC40LfRgwAXLNCg0L7Qt9Cz0L7RgNC9
0YPRgtC4INC90LjQttC90ZbQuSDQtdC60YDQsNC9AAoU0KDQvtC30LPQvtGA0L3Rg9GC0L4ACxXQ
odC/0LDQtNC90LUg0LzQtdC90Y4AEiPQodC/0LvQuNCy0LDRjtGH0LAg0L/RltC00LrQsNC30LrQ
sAAPHdCh0L/Qu9C40LLQsNGO0YfQtSDQstGW0LrQvdC+AAgQ0KHRjNC+0LPQvtC00L3RlgALFdCj
INC00ZbQsNC/0LDQt9C+0L3RlgAGC9Cj0JLQhtCc0JouAAkS0KPQstGW0LzQutC90LXQvdC+AB45
0KPQutCw0LfQsNC90L4g0L3QtdC00ZbQudGB0L3QuNC5INC00ZbQsNC/0LDQt9C+0L0g0LTQsNGC
AAcO0KXQstC40LvQuNC90LAAEB/Qp9Cw0YHRgtC60L7QstC+INCy0LjQsdGA0LDQvdC+AAkR0LTQ
u9GPINCz0L7QtNC40L0AChPQtNC70Y8g0YXQstC40LvQuNC9AAYM0L/RgNC+0LHRltC7AAoOJTEk
ZCDOtyDPjs+BzrEACg8lMSRkIM67zrXPgM+EzqwAEBklMSRkIM+Ezr/Ouc+CIM61zrrOsc+Ez4wu
ABUozojOs865zr3OtSDOvM61z4HOuc66z4zPgiDOrc67zrXOs8+Hzr/PggADBs6Pz4HOsQAIC86P
z4HOsSAlMSRkAA4czpHOoM6Vzp3Olc6hzpPOn86gzp/Omc6XzqPOlwAYLc6RzrvOu86xzrPOriDP
g8+Ezr/OvSDOtc+Az4zOvM61zr3OvyDOvM6uzr3OsQAcNc6RzrvOu86xzrPOriDPg8+Ezr/OvSDP
gM+Bzr/Ot86zzr/Pjc68zrXOvc6/IM68zq7Ovc6xABszzpHOvc6sz4DPhM+Fzr7OtyDPhs+NzrvO
u86/z4UgzrrOrM+Ez4kgzrzOrc+Bzr/Phc+CABMlzpHOvc6xzrTPhc+MzrzOtc69zr8gz4DOsc+B
zqzOuM+Fz4HOvwAJEs6Rzr3Osc62zq7PhM63z4POtwAKFc6Rzr3Osc62zq7PhM63z4POt+KApgAT
Jc6Rzr3Osc+Az4TPhc+Dz4PPjM68zrXOvc6/IM68zrXOvc6/z40ACBDOkc69zrXOvc61z4HOs8+M
AAsWzpHOvc61z4DPhM+FzrPOvM6tzr3OvwAIEM6Rz4DOrM69z4TOt8+DzrcACBDOkc+Az4zPgc+B
zrnPiM63AAsVzpHPgc+Hzq4gzrXPjc+Bzr/Phc+CAAYMzpLOr869z4TOtc6/ABIizpTOtc69IM6t
z4fOtc65IM61z4DOuc67zrXPh864zrXOrwATJc6UzrnOsc6zz4HOsc+Gzq4gzrXPgc+Jz4TOrs68
zrHPhM6/z4IAGzTOlM65zrHOu86/zrPOriDOtc65z4POtc+Bz4fPjM68zrXOvc63z4IgzrrOu86u
z4POt8+CAAwYzpXOnc6VzqHOk86fzqDOn86ZzpfOo86XABQnzpXOuc+DzrHOs8+JzrPOriDOt868
zrXPgc6/zrzOt869zq/Osc+CABotzpXOuc+DzrHOs8+JzrPOriDOt868zrXPgc6/zrzOt869zq/O
sc+COiAlMSRzABQnzpXOuc+DzrHOs8+JzrPOriDOt868zrXPgc6/zrzOt869zrnPjs69ABEhzpXO
uc+DzrXPgc+Hz4zOvM61zr3OtyDOus67zq7Pg863AA0ZzpXOvM+GzqzOvc65z4POtyDPjM67z4nO
vQAIEM6Vzr3Osc67zrvOsc6zzq4AGS/Olc69zrHOu867zrHOs86uIM+DzrUgzrXPgM65zrvOv86z
zq4gzq3PhM6/z4XPggAtVs6Vzr3Osc67zrvOsc6zzq4gz4PPhM63IM67zrXOuc+Ezr/Phc+BzrPO
r86xIM61zrnPg86xzrPPic6zzq7PgiDOt868zrXPgc6/zrvOv86zzq/Ov8+FACpQzpXOvc6xzrvO
u86xzrPOriDPg8+EzrcgzrvOtc65z4TOv8+Fz4HOs86vzrEgzrXOuc+DzrHOs8+JzrPOrs+CIM66
zrXOuc68zq3Ovc6/z4UABgzOlc69zrXPgc6zz4wADBfOlc69z4TPjM+CIM61z43Pgc6/z4XPggAT
Jc6Vz4DOtc6+zq7Os863z4POtyDOtc+BzrPOsc67zrXOr86/z4UAFSjOlc+AzrnOu86tzr7PhM61
IM68zrnOsSDOtc+GzrHPgc68zr/Os86uABQhzpXPgM65zrvOrc6+z4TOtSDPgC7OvC4gzq4gzrwu
zrwuABUpzpXPgM65zrvOtc6zzrzOrc69zrcgzrfOvM61z4HOv868zrfOvc6vzrEAChTOlc+AzrnO
u861zrPOvM6tzr3OvwATJc6Vz4DOuc67zr/Os86uIM63zrzOtc+Bzr/OvM63zr3Or86xz4IAEyXO
lc+AzrnOu86/zrPOriDOt868zrXPgc6/zrzOt869zrnPjs69AA4bzpXPgM65zrvOv86zzq4gzrvO
tc+Az4TPjs69AAwXzpXPgM65zrvOv86zzq4gz47Pgc6xz4IAEiPOlc+Bz47PhM63zrzOsSDOsc69
zrHOts6uz4TOt8+DzrfPggA5Zs6XIM63zrzOtc+Bzr/OvM63zr3Or86xIM60zrXOvSDOsc69z4TO
uc+Dz4TOv865z4fOtc6vIM+Dz4TOvyDOsc69zrHOvM61zr3PjM68zrXOvc6/IM68zr/PhM6vzrLO
vzogJTEkcwAiO86XIM63zrzOtc+Bzr/OvM63zr3Or86xIM60zrXOvSDOtc+AzrnPhM+Bzq3PgM61
z4TOsc65OiAlMSRzAEFvzpcgzrfOvM61z4HOv868zrfOvc6vzrEgzrXOr869zrHOuSDOtc66z4TP
jM+CIM+Ezr/PhSDOsc69zrHOvM61zr3PjM68zrXOvc6/z4UgzrXPjc+Bzr/Phc+CIM61z4TPjs69
ICUxJHMgLSAlMiRzAAoUzpfOvM61z4HOv868zrfOvc6vzrEAEiPOl868zrXPgc6/zrzOt869zq/O
sSDOrc69zrHPgc6+zrfPggAQH86XzrzOtc+Bzr/OvM63zr3Or86xIM67zq7Ovs63z4IAJ0nOms6s
zr3PhM61IM66z43Ou865z4POtyDOs865zrEgzrXOvM+GzqzOvc65z4POtyDOtc+Az4zOvM61zr3P
ic69IM61z4TPjs69ACtRzprOrM69z4TOtSDOus+NzrvOuc+DzrcgzrPOuc6xIM61zrzPhs6szr3O
uc+Dzrcgz4DPgc6/zrfOs86/z43OvM61zr3Pic69IM61z4TPjs69ACtQzprOrM69z4TOtSDOus+N
zrvOuc+DzrcgzrPOuc6xIM61zrzPhs6szr3Ouc+Dzrcgz4TOv8+FIM61z4DPjM68zrXOvc6/z4Ug
zrzOrs69zrEAL1jOms6szr3PhM61IM66z43Ou865z4POtyDOs865zrEgzrXOvM+GzqzOvc65z4PO
tyDPhM6/z4Ugz4DPgc6/zrfOs86/z43OvM61zr3Ov8+FIM68zq7Ovc6xAAUKzprOsc68zq/OsQAH
Ds6azrHPgc+Ezq3Ou86xABAezprOu86uz4POtyDPg861IM61zr7Orc67zrnOvs63ABw1zprOu861
zq/Pg865zrzOvyDPhM6/z4UgzrzOtc69zr/PjSDPgM67zr/Ors6zzrfPg863z4IADx3Oms67zrXO
r8+DzrnOvM6/IM+Gz43Ou867zr/PhQAOG86azr/Ouc69zr/PgM6/zq/Ot8+Dzrcgz4POtQAcM86a
zr/Ouc69zr/PgM6/zq/Ot8+Dzrcgz4PPhM63zr0gzrXPhs6xz4HOvM6/zrPOriAlcwAOG86bzrHO
ss6uIM68zrXPhM6xz4bOv8+BzqzPggAFCs6bzrXPgM+Ez4wAAgTOnM6cAA8dzpzOtc69zr/PjSDP
gM67zr/Ors6zzrfPg863z4IAFiXOnM61z4TOrM6yzrHPg863IM+Dz4TOvyDOrc+Ezr/PgiAlMSRz
ACVGzpzOtyDOrc6zzrrPhc+BzrcgzrXOuc+DzrHOs8+JzrPOriDOtc+Nz4HOv8+Fz4IgzrfOvM61
z4HOv868zrfOvc65z47OvQAUJs6czrcgzq3Os866z4XPgc63IM66zrHPhM6xz4fPjs+BzrnPg863
AAIEzqDOnAAJEs6gzrHPgc6szrLOu861z4jOtwAcNc6gzrHPgc6szrLOu861z4jOtyDPhs+NzrvO
u86/z4UgzrrOrM+Ez4kgzrzOrc+Bzr/Phc+CABEhzqDOsc+BzqzOuM+Fz4HOvyDOtM65zrHOu8+M
zrPOv8+FABUpzqDOtc+BzrnPg8+Dz4zPhM61z4HOtc+CIM61z4DOuc67zr/Os86tz4IAFinOoM67
zr/Ors6zzrfPg863IM+Az4HOv8+CIM+EzrEgzrXPgM6szr3PiQAbM86gzrvOv86uzrPOt8+Dzrcg
z4PPhM63zr0gzrHPgc+HzrnOus6uIM+DzrXOu86vzrTOsQASI86gz4HOv86yzr/Ou86uIM61z4DO
tc6+zq7Os863z4POt8+CABIjzqDPgc6/z4TOrM+DzrXOuc+CIM+AzrHPgc6xzrrOrM+Ez4kABgzO
o86uzrzOtc+BzrEAChPOo861IM61zr7Orc67zrnOvs63AAsWzqPPhc68z4DPhM+FzrPOvM6tzr3O
vwAIEM6jz43OvM+Az4TPhc6+zrcAGzPOo8+NzrzPgM+Ez4XOvs63IM+Gz43Ou867zr/PhSDOus6s
z4TPiSDOvM6tz4HOv8+Fz4IAUoCWzqPPjc+BzrXPhM61IM6zzrnOsSDOvc6xIM61z4DOuc67zq3O
vs61z4TOtSDOrc69zrEgzq3PhM6/z4Igzq4gz4DOsc+Ezq7Pg8+EzrUgzrPOuc6xIM69zrEgzrXP
gM65z4PPhM+Bzq3PiM61z4TOtSDPg8+EzrfOvSDOtc+AzrnOu86/zrPOriDOt868zq3Pgc6xz4Iu
AAUKzqTOrc67zr/PggAMF86kzq3Ou86/z4IgzrXPjc+Bzr/Phc+CAAsWzqTOtc+BzrzOsc+EzrnP
g868z4zPggAmR86kzr8gzrXPgc6zzrHOu861zq/OvyDOtc+AzrnOu86/zrPOrs+CIM6tz4TOv8+F
z4IgzrXOr869zrHOuSDOv8+BzrHPhM+MABYlzqTPgc6tz4fOv8+Fz4POsSDOtc+AzrnOu86/zrPO
rjogJTEkcwASI86lz4DOv86yzr/Ou86uIM61z4HPic+Ezq7OvM6xz4TOv8+CABIjzqbPic69zrfP
hM65zrrOriDOsc69zrHOts6uz4TOt8+DzrcACRHOs865zrEgzrvOtc+Az4TOrAAHDc6zzrnOsSDP
js+BzrEACBDOtM65zqzPg8+EzrfOvM6xAAwMJTEkZCBlbiBwdG8uAA8PJTEkZCBwb3IgY2VudG8u
AAoLJTEkZMKgaG9yYXMABAQ+OTk5ADw+QSBkYXRhIGVzdMOhIGbDs3JhIGRvIGludGVydmFsbyBk
ZSBhbm9zIGVzcGVyYWRvICglMSRzIC0gJTIkcykALC1BIGRhdGEgbm9uIGNvaW5jaWRlIGNvIHBh
ZHLDs24gZXNwZXJhZG86ICUxJHMAEBBCb3JyYSBhIGNvbnN1bHRhAAUFQnVzY2EAEBBCdXNjYSBh
IGNvbnN1bHRhAA0NQnVzY2EgcG9yIHZvegAGCEJ1c2Nh4oCmABARQ2Fkcm8gZGUgZGnDoWxvZ28A
FBVDYWRybyBkZSBpbmZvcm1hY2nDs24AHBxDYW1iaWFyIGEgc2VsZWNjaW9uYXIgdW4gYW5vABcX
Q2FtYmlhciBhbyBtZXMgYW50ZXJpb3IAFxdDYW1iaWFyIGFvIG1lcyBzZWd1aW50ZQAoKENhbWJp
YXIgYW8gbW9kbyBkZSBlbnRyYWRhIGRlIGNhbGVuZGFyaW8AJyhDYW1iaWFyIGFvIG1vZG8gZGUg
aW50cm9kdWNpw7NuIGRlIHRleHRvABAQQ2hhbWFkYSBlbiBjdXJzbwAQEENoYW1hZGEgZW50cmFu
dGUAIiNDb21wYXJ0ZSBjb250aWRvIGNvYSBhcGxpY2FjacOzbiAlcwAUFENvbXBhcnRlIGNvbnRp
ZG8gY29uAAkJQ29udGVzdGFyAAcHQ29udHJhZQAXF0NvbnRyYWVyIHBhbmVsIGluZmVyaW9yABQV
RGF0YSBkZSBmaW5hbGl6YWNpw7NuAA4ORGF0YSBkZSBpbmljaW8ADQ1EYXRhIGluc2VyaWRhABMT
RGF0YSBpbnNlcmlkYTogJTEkcwAYGERhdGEgbm9uIHBlcm1pdGlkYTogJTEkcwATE0RlbnRybyBk
byBpbnRlcnZhbG8ACgpEZXNwcmVnYWRvABgYRGVzcHJlZ2FyIHBhbmVsIGluZmVyaW9yACcoRGVz
cHLDoXphdGUgcGFyYSBtb3N0cmFyIGFub3MgYW50ZXJpb3JlcwAoKURlc3Byw6F6YXRlIHBhcmEg
bW9zdHJhciBhbm9zIHBvc3RlcmlvcmVzACYnRGVzcHLDoXphdGUgcGFyYSBtb3N0cmFyIG8gbWVz
IGFudGVyaW9yACYnRGVzcHLDoXphdGUgcGFyYSBtb3N0cmFyIG8gbWVzIHNlZ3VpbnRlABARRW52
w61hIGEgY29uc3VsdGEABQVGZWl0bwAaGkZpbHRyYW5kbyBjaGFtYWRhIGVudHJhbnRlABAQRmlu
IGRvIGludGVydmFsbwAJCkZ1bmNpw7NuICsAFRZIYWkgc3V4ZXN0acOzbnMgYWJhaXhvAAQESG94
ZQAPD0luZGljYSBhcyBkYXRhcwAwMkluZGljb3VzZSB1biBpbnRlcnZhbG8gZGUgZGF0YXMgcXVl
IG5vbiDDqSB2w6FsaWRvABMTSW5pY2lvIGRvIGludGVydmFsbwAODklyIGFvIGFubyAlMSRzAAcI
TWFpw7pzICsAFBRNYXJjYWRhIHBhcmNpYWxtZW50ZQAGB01lbsO6ICsAEBFNZW7DuiBkZXNwcmVn
YWJsZQAcHU1vc3RyYXIgY2Fkcm8gZGUgaW5mb3JtYWNpw7NuAAwOTcOhaXMgb3BjacOzbnMACAhO
aW5ndW5oYQAQEE5vbiBzZWxlY2Npb25hZG8AHB5PIHRleHRvIGVzY3JpdG8gbm9uIMOpIHbDoWxp
ZG8AVVhQYXNhIG8gZGVkbyBwYXJhIHNlbGVjY2lvbmFyIHVuIGFubyBvdSB0b2NhIGEgcGFudGFs
bGEgcGFyYSB2b2x2ZXIgw6Egc2VsZWNjacOzbiBkbyBkw61hAAYGUGVjaGFyAAwMUGVjaGFyIGZv
bGxhABkbUGVjaGFyIG1lbsO6IGRlIG5hdmVnYWNpw7NuABUVUGVjaGFyIHBhbmVsIGluZmVyaW9y
AA4OUmVhbGl6YSBidXNjYXMACAhSZXhlaXRhcgAREVNlbGVjY2lvbmEgYSBkYXRhABMTU2VsZWNj
aW9uYSBhcyBkYXRhcwAaG1NlbGVjY2lvbmEgdW5oYSBhcGxpY2FjacOzbgAaHFNlbGVjY2lvbmFy
IGEuwqBtLiBvdSBwLsKgbS4AEBBTZWxlY2Npb25hciBkYXRhABcXU2VsZWN0b3IgZGUgYW5vIHZp
c2libGUACQlUYWJ1bGFkb3IADQ1WYWkgYW8gaW5pY2lvAA8PVmFpIGNhcmEgYXJyaWJhAA8QVmVu
dMOhIGVtZXJ4ZW50ZQACAmFtAAgIZWxpbWluYXIABgZlc3Bhem8AAgJwbQAKCnBvciBtaW51dG8A
BwklMSRkIOC0ri4ACA4lMSRkIOC0ruC0o+C0vwANHSUxJGQg4LSu4LS/4LSo4LS/4LSx4LWN4LSx
4LWNAAwYJTEkZCDgtLbgtKTgtK7gtL7gtKjgtIIuAB1JJTEkcyDgtI7gtKjgtY3gtKgg4LS14LW8
4LS34LSk4LWN4LSk4LS/4LSy4LWH4LSV4LWN4LSV4LWNIOC0quC1i+C0leC1geC0lQAWOiVzIOC0
juC0qOC1jeC0qOC0pOC1geC0ruC0vuC0r+C0vyDgtKrgtJngtY3gtJXgtL/gtJ/gtYHgtJUAJ2kn
4LSF4LSf4LWB4LSk4LWN4LSkIOC0ruC0vuC0uOC0gicg4LSV4LS+4LSj4LS/4LSV4LWN4LSV4LS+
4LW7IOC0uOC1jeC0leC1jeC0sOC1i+C1viDgtJrgtYbgtK/gtY3gtK/gtYHgtJUAH09BTSDgtIXg
tLLgtY3gtLLgtYbgtJngtY3gtJXgtL/gtb0gUE0g4LSk4LS/4LSw4LSe4LWN4LSe4LWG4LSf4LWB
4LSV4LWN4LSV4LWB4LSVABxQ4LSF4LSf4LWB4LSk4LWN4LSkIOC0ruC0vuC0uOC0pOC1jeC0pOC0
v+C0suC1h+C0leC1jeC0leC1jSDgtK7gtL7gtLHgtY3gtLHgtYHgtJUAEzfgtIXgtLXgtLjgtL7g
tKjgtL/gtJXgtY3gtJXgtYHgtKjgtY3gtKgg4LSk4LWA4LSv4LSk4LS/ABQ64LSG4LSq4LWN4LSq
4LWNIOC0pOC0v+C0sOC0nuC1jeC0nuC1huC0n+C1geC0leC1jeC0leC1geC0lQASNOC0huC0sOC0
guC0reC0v+C0leC1jeC0leC1geC0qOC1jeC0qCDgtKTgtYDgtK/gtKTgtL8AG0/gtIfgtKjgtL/g
tKrgtY3gtKrgtLHgtK/gtYHgtKjgtY3gtKjgtKTgtYHgtK7gtL7gtK/gtL8g4LSq4LSZ4LWN4LSV
4LS/4LSf4LWB4LSVAAUP4LSH4LSo4LWN4LSo4LWNAAwk4LSH4LSy4LWN4LSy4LS+4LSk4LS+4LSV
4LWN4LSV4LWB4LSVAAwi4LSH4LW74LSV4LSu4LS/4LSC4LSX4LWNIOC0leC1i+C1vgAgWuC0h+C1
u+C0leC0ruC0v+C0guC0l+C1jSDgtJXgtYvgtb4g4LS44LWN4oCM4LSV4LWN4LSw4LWA4LW7IOC0
muC1huC0r+C1jeC0r+C1geC0qOC1jeC0qOC1gQASNOC0h+C1u+C0quC1geC0n+C1jeC0n+C1jSDg
tIXgtLjgtL7gtKfgtYHgtLXgtL7gtKPgtY0ADCLgtI7gtLLgtY3gtLLgtL7gtIIg4LSV4LS+4LSj
4LWB4LSVAAoe4LSS4LSo4LWN4LSo4LWB4LSu4LS/4LSy4LWN4LSyAAUP4LST4LSj4LS+4LSj4LWN
AAUP4LST4LSr4LS+4LSj4LWNAAMJ4LST4LSr4LWNAAIG4LST4LW6ACBa4LSV4LSy4LSj4LWN4LSf
4LW8IOC0h+C1u+C0quC1geC0n+C1jeC0n+C1jSDgtK7gtYvgtKHgtL/gtLLgtYfgtJXgtY3gtJXg
tY0g4LSu4LS+4LSx4LWB4LSVAA8r4LSV4LWC4LSf4LWB4LSk4LW9IOC0k+C0quC1jeC0t+C0qOC1
geC0leC1vgAMIuC0leC1i+C1viDgtKjgtL/gtbzgtKTgtY3gtKTgtYHgtJUACyHgtJrgtYHgtLDg
tYHgtJXgtY3gtJXgtL/gtK/gtKTgtY0ACRvgtJrgtYHgtLDgtYHgtJXgtY3gtJXgtYHgtJUADSXg
tJrgtYvgtKbgtY3gtK/gtIIg4LSk4LS/4LSw4LSv4LWB4LSVABEx4LSa4LWL4LSm4LWN4LSv4LSC
IOC0ruC0vuC0r+C1jeKAjOC0leC1jeC0leC1geC0lQATN+C0muC1i+C0puC1jeC0r+C0giDgtLjg
tK7gtbzgtKrgtY3gtKrgtL/gtJXgtY3gtJXgtYHgtJUABAzgtJ/gtL7gtKzgtY0ACRvgtJ/gtYLg
tb7gtJ/gtL/gtKrgtY3gtKrgtY0AEzfgtJ/gtYLgtb7gtJ/gtL/gtKrgtY3gtKrgtY0g4LSV4LS+
4LSj4LS/4LSV4LWN4LSV4LWB4LSVACZs4LSf4LWG4LSV4LWN4oCM4LS44LWN4oCM4LSx4LWN4LSx
4LWNIOC0h+C1u+C0quC1geC0n+C1jeC0n+C1jSDgtK7gtYvgtKHgtL/gtLLgtYfgtJXgtY3gtJXg
tY0g4LSu4LS+4LSx4LWB4LSVAAYS4LSh4LSv4LSy4LWL4LSX4LWNABEx4LSh4LS/4LS44LWN4oCM
4LSu4LS/4LS44LWNIOC0muC1huC0r+C1jeC0r+C1geC0lQARMeC0oeC1jeC0sOC1i+C0quC1jeC0
quC1jeKAjOC0oeC1l+C1uiDgtK7gtYbgtKjgtYEAEjTgtKTgtL/gtLDgtJ7gtY3gtJ7gtYbgtJ/g
tYHgtKTgtY3gtKQg4LSk4LWA4LSv4LSk4LS/ABAw4LSk4LS/4LSw4LSe4LWN4LSe4LWG4LSf4LWB
4LSk4LWN4LSk4LS/4LSy4LWN4LSyAA0n4LSk4LS/4LSw4LSe4LWN4LSe4LWG4LSf4LWB4LSk4LWN
4LSk4LWBAAYS4LSk4LS/4LSw4LSv4LWB4LSVAAcV4LSk4LS/4LSw4LSv4LWB4LSV4oCmAAUP4LSk
4LWA4LSv4LSk4LS/ABg64LSk4LWA4LSv4LSk4LS/IOC0heC0qOC1geC0teC0puC0qOC1gOC0r+C0
ruC0suC1jeC0sjogJTEkcwAUOuC0pOC1gOC0r+C0pOC0vyDgtKTgtL/gtLDgtJ7gtY3gtJ7gtYbg
tJ/gtYHgtJXgtY3gtJXgtYHgtJUAH1fgtKTgtYDgtK/gtKTgtL8g4LS24LWN4LSw4LWH4LSj4LS/
IOC0h+C1u+C0quC1geC0n+C1jeC0n+C1jSDgtIXgtLjgtL7gtKfgtYHgtLXgtL7gtKPgtY0AFkDg
tKTgtYDgtK/gtKTgtL/gtJXgtb4g4LSk4LS/4LSw4LSe4LWN4LSe4LWG4LSf4LWB4LSV4LWN4LSV
4LWB4LSVAA0l4LSk4LWA4LSv4LSk4LS/4LSV4LW+IOC0qOC1veC0leC1geC0lQANJeC0qOC0vuC0
teC0v+C0l+C1h+C0t+C1uyDgtK7gtYbgtKjgtYEAGETgtKjgtL7gtLXgtL/gtJfgtYfgtLfgtbsg
4LSu4LWG4LSo4LWBIOC0heC0n+C0r+C1jeKAjOC0leC1jeC0leC1geC0lQAXQ+C0qOC0v+C0puC1
jeC0puC1h+C0tuC0meC1jeC0meC1viDgtJrgtYHgtLXgtJ/gtYbgtK/gtYHgtKPgtY3gtJ/gtY0A
Ch7gtKjgtL/gtLDgtLjgtL/gtJXgtY3gtJXgtYHgtJUAG0PgtKjgtL/gtLLgtLXgtL/gtLLgtYYg
4LSk4LS/4LSw4LSe4LWN4LSe4LWG4LSf4LWB4LSq4LWN4LSq4LWNOiAlMSRzAAsf4LSo4LW94LSV
4LS/4LSvIOC0pOC1gOC0r+C0pOC0vwARJeC0qOC1veC0leC0v+C0ryDgtKTgtYDgtK/gtKTgtL86
ICUxJHMACBjgtKrgtLDgtL/gtKfgtL/gtK/gtL/gtb0ALX/gtKrgtL/gtKjgtY3gtKjgtYDgtJ/g
tYHgtLPgtY3gtLMg4LS14LW84LS34LSZ4LWN4LSZ4LW+IOC0leC0vuC0o+C0v+C0leC1jeC0leC0
vuC1uyDgtLjgtY3gtJXgtY3gtLDgtYvgtb4g4LSa4LWG4LSv4LWN4LSv4LWB4LSVAA8t4LSq4LWB
4LSw4LWL4LSX4LSu4LS/4LSV4LWN4LSV4LWB4LSo4LWN4LSo4LWBAAsh4LSq4LWC4LW84LSk4LWN
4LSk4LS/4LSv4LS+4LSv4LS/ABIy4LSq4LWL4LSq4LWN4LSq4LWNLeC0heC0quC1jeC0quC1jSDg
tLXgtL/gtbvgtKHgtYsAQICg4LSq4LWN4LSw4LSk4LWA4LSV4LWN4LS34LS/4LSV4LWN4LSV4LWB
4LSo4LWN4LSoIOC0leC0vuC0suC0r+C0s+C0teC0v+C0suC1hiDgtLXgtbzgtLfgtK7gtLLgtY3g
tLIg4LSo4LW94LSV4LS/4LSvIOC0pOC1gOC0r+C0pOC0v+C0r+C1geC0n+C1h+C0pOC1jSAlMSRz
IC0gJTIkcwA6gJzgtKrgtY3gtLDgtKTgtYDgtJXgtY3gtLfgtL/gtJrgtY3gtJog4LSq4LS+4LSx
4LWN4LSx4LWH4LSj4LWB4LSu4LS+4LSv4LS/IOC0pOC1gOC0r+C0pOC0vyDgtKrgtYrgtLDgtYHg
tKTgtY3gtKTgtKrgtY3gtKrgtYbgtJ/gtYHgtKjgtY3gtKjgtL/gtLLgtY3gtLI6ICUxJHMACRng
tKvgtILgtJfgtY3gtLfgtKjgtY3igI0rABdB4LSs4LWL4LSf4LWN4LSf4LSCIOC0t+C1gOC0seC1
jeC0seC1jSDgtJrgtYHgtLDgtYHgtJXgtY3gtJXgtYHgtJUAHlTgtKzgtYvgtJ/gtY3gtJ/gtIIg
4LS34LWA4LSx4LWN4LSx4LWNIOC0oeC0v+C0uOC1jeC0ruC0v+C0uOC1jSDgtJrgtYbgtK/gtY3g
tK/gtYHgtJUAHFDgtKzgtYvgtJ/gtY3gtJ/gtIIg4LS34LWA4LSx4LWN4LSx4LWNIOC0teC0v+C0
leC0uOC0v+C0quC1jeC0quC0v+C0leC1jeC0leC1geC0lQAcUOC0reC0vuC0l+C0v+C0leC0ruC0
vuC0r+C0vyDgtJrgtYbgtJXgtY3gtJXgtY0g4LSu4LS+4LW84LSV4LWN4LSV4LS/4LSf4LWN4LSf
4LWBAAgY4LSu4LSj4LS/4LSV4LWN4LSV4LWC4LW8ABdD4LSu4LSj4LS/4LSV4LWN4LSV4LWC4LW8
IOC0pOC0v+C0sOC0nuC1jeC0nuC1huC0n+C1geC0leC1jeC0leC1geC0lQAUOuC0ruC0o+C0v+C0
leC1jeC0leC1guC1vCDgtKjgtYfgtLDgtKTgtY3gtKTgtYfgtJXgtY3gtJXgtY0ADCLgtK7gtLHg
tYHgtKrgtJ/gtL8g4LSo4LW94LSV4LWB4LSVAAUP4LSu4LS+4LSx4LWB4LSVAAgY4LSu4LS/4LSo
4LS/4LSx4LWN4LSx4LWNABdD4LSu4LS/4LSo4LS/4LSx4LWN4LSx4LWNIOC0pOC0v+C0sOC0nuC1
jeC0nuC1huC0n+C1geC0leC1jeC0leC1geC0lQAUOuC0ruC0v+C0qOC0v+C0seC1jeC0seC1jSDg
tKjgtYfgtLDgtKTgtY3gtKTgtYfgtJXgtY3gtJXgtY0AETHgtK7gtYHgtJXgtLPgtL/gtLLgtYfg
tJXgtY3gtJXgtY0g4LSq4LWL4LS14LWB4LSVAChw4LSu4LWB4LSu4LWN4LSq4LSk4LWN4LSk4LWG
IOC0ruC0vuC0uOC0giDgtJXgtL7gtKPgtL/gtJXgtY3gtJXgtL7gtbsg4LS44LWN4LSV4LWN4LSw
4LWL4LW+IOC0muC1huC0r+C1jeC0r+C1geC0lQAfWeC0ruC1geC0ruC1jeC0quC0pOC1jeC0pOC1
hiDgtK7gtL7gtLjgtKTgtY3gtKTgtL/gtLLgtYfgtJXgtY3gtJXgtY0g4LSu4LS+4LSx4LWN4LSx
4LWB4LSVACVn4LSu4LWB4LW7IOC0teC1vOC0t+C0meC1jeC0meC1viDgtJXgtL7gtKPgtL/gtJXg
tY3gtJXgtL7gtbsg4LS44LWN4LSV4LWN4LSw4LWL4LW+IOC0muC1huC0r+C1jeC0r+C1geC0lQAF
DeC0ruC1huC0qOC1gSsABhDgtK7gtYbgtLHgtY3gtLErABpM4LS14LSy4LS/4LSa4LWN4LSa4LS/
4LSf4LWB4LSo4LWN4LSo4LSk4LS/4LSo4LWB4LSz4LWN4LSzIOC0ueC0vuC1u+C0oeC0v+C1vQAO
KuC0teC0v+C0quC1geC0suC1gOC0leC0sOC0v+C0muC1jeC0muC0pOC1jQAGEuC0teC1gOC0oeC0
v+C0r+C1iwAUOOC0teC1vOC0tyDgtKrgtL/gtJXgtY3gtJXgtbwg4LSm4LWD4LS24LWN4LSv4LSu
4LS+4LSj4LWNAGqBKuC0teC1vOC0t+C0giDgtKTgtL/gtLDgtJ7gtY3gtJ7gtYbgtJ/gtYHgtJXg
tY3gtJXgtL7gtbsg4LS44LWN4LS14LWI4LSq4LWN4LSq4LWNIOC0muC1huC0r+C1jeC0r+C1geC0
lSDgtIXgtLLgtY3gtLLgtYbgtJngtY3gtJXgtL/gtb0g4LSm4LS/4LS14LS44LSCIOC0pOC0v+C0
sOC0nuC1jeC0nuC1huC0n+C1geC0leC1jeC0leC1geC0qOC1jeC0qOC0pOC0v+C0suC1h+C0leC1
jeC0leC1jSDgtKTgtL/gtLDgtL/gtJXgtYYg4LSq4LWL4LSV4LS+4LW7IOC0n+C0vuC0quC1jeC0
quC1jSDgtJrgtYbgtK/gtY3gtK/gtYHgtJUAI2XgtLXgtbzgtLfgtIIg4LSk4LS/4LSw4LSe4LWN
4LSe4LWG4LSf4LWB4LSV4LWN4LSV4LWB4LSo4LWN4LSo4LSk4LS/4LSy4LWH4LSV4LWN4LSV4LWN
IOC0ruC0vuC0seC1geC0lQARMeC0tuC1jeC0sOC1h+C0o+C0v+C0r+C1geC0n+C1hiDgtIXgtLXg
tLjgtL7gtKjgtIIAEC7gtLbgtY3gtLDgtYfgtKPgtL/gtK/gtYHgtJ/gtYYg4LSG4LSw4LSC4LSt
4LSCABAu4LS34LWA4LSx4LWN4LSx4LWNIOC0heC0n+C0r+C1jeC0leC1jeC0leC1geC0lQAUOuC0
uOC0guC0uOC0vuC0sOC0pOC1jeC0pOC0v+C0suC1guC0n+C1hiDgtKTgtL/gtLDgtK/gtYHgtJUA
Cx/gtLjgtJzgtYDgtLXgtK7gtL7gtK8g4LSV4LWL4LW+AAoe4LS44LWN4oCM4LSq4LWG4LSv4LWN
4oCM4LS44LWNABAu4LS54LWL4LSu4LS/4LSy4LWH4LSV4LWN4LSV4LWNIOC0quC1i+C0teC1geC0
lQAMDCUxJGQgbWludXRlbgAICCUxJGQgdXVyABMTQU0gb2YgUE0gc2VsZWN0ZXJlbgAODkFjdGll
ZiBnZXNwcmVrAA8PQWxsZXMgd2VlcmdldmVuAAwMQmVhbnR3b29yZGVuAAUFQmV6aWcADQ1CaW5u
ZW4gYmVyZWlrABkZQmxhZCBvbmRlcmFhbiBzYW1lbnZvdXdlbgAVFUJsYWQgb25kZXJhYW4gc2x1
aXRlbgAXF0JsYWQgb25kZXJhYW4gdWl0dm91d2VuAAwMQmxhZCBzbHVpdGVuADExRGF0dW0gYnVp
dGVuIGhldCB2ZXJ3YWNodGUgamFhcmJlcmVpayAlMSRzIC0gJTIkcwAbG0RhdHVtIG5pZXQgdG9l
Z2VzdGFhbjogJTEkcwAQEERhdHVtIHNlbGVjdGVyZW4ADg5EYXR1bXMgb3BnZXZlbgAREURhdHVt
cyBzZWxlY3RlcmVuADo6RGUgZGF0dW0ga29tdCBuaWV0IG92ZXJlZW4gbWV0IGhldCB2ZXJ3YWNo
dGUgcGF0cm9vbjogJTEkcwAJCURlbGVuIG1ldAAMDERlbGVuIG1ldCAlcwAODkRpYWxvb2d2ZW5z
dGVyAAwMRHJvcGRvd25tZW51ABISRWVuIGFwcCBzZWxlY3RlcmVuAB0dRWVuIGlua29tZW5kIGdl
c3ByZWsgc2NyZWVuZW4ADAxFaW5kZSBiZXJlaWsACQlGdW5jdGllICsAERFHYSBuYWFyIGphYXIg
JTEkcwAXF0dlZGVlbHRlbGlqayBhYW5nZXZpbmt0AAwMR2VzZWxlY3RlZXJkABMTR2VzZWxlY3Rl
ZXJkZSBkYXR1bQAWFkdlc3Byb2tlbiB6b2Vrb3BkcmFjaHQAFRVIYW5kZ3JlZXAgdm9vciBzbGVw
ZW4AFhZIdWlkaWdlIHNlbGVjdGllOiAlMSRzABAQSW5rb21lbmQgZ2VzcHJlawAWFkphYXJzZWxl
Y3RpZSB6aWNodGJhYXIACwtNZWVyIG9wdGllcwAGBk1lbnUgKwASEk1pbnV0ZW4gc2VsZWN0ZXJl
bgAYGE5hYXIgdm9sZ2VuZGUgbWFhbmQgZ2FhbgAWFk5hYXIgdm9yaWdlIG1hYW5kIGdhYW4ADQ1O
YXZpZ2F0aWVtZW51ABUVTmF2aWdhdGllbWVudSBzbHVpdGVuABsbTmF2aWdlcmVuIG5hYXIgc3Rh
cnRwb3NpdGllABERTmlldCBnZXNlbGVjdGVlcmQAEBBPbWhvb2cgbmF2aWdlcmVuAB0dT25nZWxk
aWdlIGludm9lciB2b29yIHBlcmlvZGUADw9PcGdlZ2V2ZW4gZGF0dW0AFRVPcGdlZ2V2ZW4gZGF0
dW06ICUxJHMACAhPcGhhbmdlbgANDU92ZXJzY2hha2VsZW4AJSVPdmVyc2NoYWtlbGVuIG5hYXIg
YWdlbmRhLWludm9lcm1vZHVzACMjT3ZlcnNjaGFrZWxlbiBuYWFyIHRla3N0aW52b2VybW9kdXMA
DQ1Qb3AtdXB2ZW5zdGVyAA0NU2FtZW5nZXZvdXdlbgALC1NhbWVudm91d2VuACQkU2NoYWtlbGFh
ciBvbSBlZW4gamFhciB0ZSBzZWxlY3RlcmVuACQkU2Nyb2xsIG9tIGRlIHZvbGdlbmRlIG1hYW5k
IHRlIHRvbmVuACIiU2Nyb2xsIG9tIGRlIHZvcmlnZSBtYWFuZCB0ZSB0b25lbgAgIFNjcm9sbCBv
bSBlZXJkZXJlIGphcmVuIHRlIHRvbmVuAB8fU2Nyb2xsIG9tIGxhdGVyZSBqYXJlbiB0ZSB0b25l
bgAHB1NoaWZ0ICsABwdTbHVpdGVuAAwMU3RhcnQgYmVyZWlrABQUU3VnZ2VzdGllcyBoaWVyb25k
ZXIAUFBTd2lwZSBvbSBlZW4gamFhciB0ZSBzZWxlY3RlcmVuIG9mIHRpayBvbSB0ZXJ1ZyB0ZSBn
YWFuIGVuIGVlbiBkYWcgdGUgc2VsZWN0ZXJlbgAHB1RhYmJsYWQADQ1Ub29sdGlwIHRvbmVuAAMD
VUlUAAMDVWl0AAsLVWl0Z2V2b3V3ZW4ADg5VdXIgc2VsZWN0ZXJlbgAHB1ZhbmRhYWcACAhXZWln
ZXJlbgAGBlpvZWtlbgAHCVpvZWtlbuKApgAMDFpvZWtvcGRyYWNodAAWFlpvZWtvcGRyYWNodCB2
ZXJ6ZW5kZW4AExNab2Vrb3BkcmFjaHQgd2lzc2VuAAYGc3BhdGllAAwMdm9vciBtaW51dGVuAAgI
dm9vciB1dXIADA0lMSRkwqBnb2R6aW55AA0OJTEkZMKgcHJvY2VudC4ABARCcmFrABQWQ3rEmcWb
Y2lvd28gemF6bmFjem9uZQAMDURhdGEga2/FhGNvd2EALCxEYXRhIG5pZSBwYXN1amUgZG8gb2N6
ZWtpd2FuZWdvIHd6b3JjYTogJTEkcwAXF0RhdGEgbmllZG96d29sb25hOiAlMSRzAA8QRGF0YSBw
b2N6xIV0a293YQAsLkRhdGEgcG96YSBvY3pla2l3YW55bSB6YWtyZXNlbSBsYXQgJTEkc+KAkyUy
JHMABwdEemlzaWFqAAkJRXR5a2lldGthACAkRmlsdHJ1asSZIHBvxYLEhWN6ZW5pZSBwcnp5Y2hv
ZHrEhWNlAAoKRnVua2N5am55KwAHB0dvZHppbmEABgZHb3Rvd2UADg5Lb25pZWMgemFrcmVzdQAE
BE1lbnUAEBBNZW51IG5hd2lnYWN5am5lAAsLTmllIHd5YnJhbm8AHB5OaWVwcmF3aWTFgm93ZSBk
YW5lIHdlasWbY2lvd2UAGBlOaWVwcmF3aWTFgm93eSB6YWtyZXMgZGF0ABUVT2JlY25pZSB3eWJy
YW5lOiAlMSRzAAcHT2RiaWVyegAGB09kcnp1xIcAEBFQb2N6xIV0ZWsgemFrcmVzdQAPEVBva2HF
vCBldHlraWV0a8SZAA4PUG9rYcW8IHdzenlzdGtvABcaUG/FgsSFY3plbmllIHByenljaG9kesSF
Y2UAHR5Qcm9wb3p5Y2plIHpuYWpkemllc3ogcG9uacW8ZWoAFBVQcnplamTFuiBkbyByb2t1ICUx
JHMAGB1QcnplamTFuiBuYSBzdHJvbsSZIGfFgsOzd27EhQAND1ByemVqZMW6IHd5xbxlagBHTVBy
emVzdcWELCBhYnkgd3licmHEhyByb2ssIGx1YiB3csOzxIcgZG8gcG9wcnplZG5pZWogc2VrY2pp
IGnCoHd5YmllcnogZHppZcWEACcrUHJ6ZXdpxYQsIGFieSB3ecWbd2lldGxpxIcga29sZWpueSBt
aWVzacSFYwApLVByemV3acWELCBhYnkgd3nFm3dpZXRsacSHIHBvcHJ6ZWRuaSBtaWVzacSFYwAn
LFByemV3acWELCBhYnkgd3nFm3dpZXRsacSHIHDDs8W6bmllanN6ZSBsYXRhACktUHJ6ZXdpxYQs
IGFieSB3ecWbd2lldGxpxIcgd2N6ZcWbbmllanN6ZSBsYXRhABYZUHJ6ZcWCxIVjeiBuYSB3eWLD
s3Igcm9rdQALDVByemXFgsSFY3puaWsACgtSb3p3aW5pxJl0ZQAUF1JvendpxYQgcGxhbnN6xJkg
ZG9sbsSFAAcJUm96xYLEhWN6AAYGU3p1a2FqAAcJU3p1a2Fq4oCmAA8RVHJ3YSBwb8WCxIVjemVu
aWUAFhdVY2h3eXQgZG8gcHJ6ZWNpxIVnYW5pYQARElVkb3N0xJlwbmlqIHByemV6OgAUFVVkb3N0
xJlwbmlqIHByemV6OiAlcwAEBVdZxYEuAAUFV2lkZW8AFhZXaWRvY3pueSBzZWxla3RvciByb2t1
AAwNV2nEmWNlaiBvcGNqaQAQEVdwcm93YWR6b25vIGRhdMSZABYXV3Byb3dhZHpvbm8gZGF0xJk6
ICUxJHMADQ5XcHJvd2FkxbogZGF0eQAREVd5YmllcnogQU0gbHViIFBNABESV3liaWVyeiBhcGxp
a2FjasSZAAwMV3liaWVyeiBkYXR5AAwNV3liaWVyeiBkYXTEmQAPEFd5YmllcnogZ29kemluxJkA
Dg5XeWJpZXJ6IG1pbnV0eQAMDFd5YnJhbmEgZGF0YQAHB1d5YnJhbm8AERNXeWN6ecWbxIcgemFw
eXRhbmllABMUV3lza2FrdWrEhWNlIG9raWVua28ADAxXeXN6dWtpd2FuaWUAFBVXeXN6dWtpd2Fu
aWUgZ8WCb3Nvd2UACQtXecWCxIVjem9ubwAQEVd5xZtsaWogemFweXRhbmllAAYHV8KgdG9rdQAJ
C1fCoHphc2nEmWd1AAMEV8WBLgAtL1fFgsSFY3ogdHJ5YiB3cHJvd2FkemFuaWEgZGFueWNoIGth
bGVuZGFyem93eWNoAB4gV8WCxIVjeiB0cnliIHdwcm93YWR6YW5pYSB0ZWtzdHUACApXxYLEhWN6
b25vAAcHWmFta25pagAODlphbWtuaWogYXJrdXN6ABgYWmFta25paiBtZW51IG5hd2lnYWN5am5l
ABUXWmFta25paiBwbGFuc3rEmSBkb2xuxIUACQlaYXB5dGFuaWUAGRxabWllxYQgbmEgbmFzdMSZ
cG55IG1pZXNpxIVjABocWm1pZcWEIG5hIHBvcHJ6ZWRuaSBtaWVzacSFYwAICVp3aW5pxJl0ZQAE
BVp3acWEABIVWndpxYQgcGxhbnN6xJkgZG9sbsSFAAoLbmEgZ29kemluxJkACQluYSBtaW51dHkA
BgZzcGFjamEADg4lMSRkIG9kc3RvdGtvdgAMDEFrdGl2bmkga2xpYwAEBEJyZXoABQVEYW5lcwAy
NURhdHVtIGplIHp1bmFqIHByacSNYWtvdmFuZWdhIHJhenBvbmEgbGV0ICUxJHPigJMlMiRzAC4v
RGF0dW0gc2UgbmUgdWplbWEgcyBwcmnEjWFrb3ZhbmltIHZ6b3JjZW06ICUxJHMADg5EZWxubyBw
b3RyamVubwAMDERvaG9kbmkga2xpYwAEBEZuICsAEBBHbGFzb3ZubyBpc2thbmplAAYGSVpLTE9Q
ABERSXNrYWxuYSBwb2l6dmVkYmEABwdJc2thbmplAAkLSXNrYW5qZSDigKYADw9JemJlcml0ZSBk
YXR1bWUAKSpJemJlcml0ZSBkb3BvbGRhbnNraSBhbGkgcG9wb2xkYW5za2kgxI1hcy4AERFJemJp
cmEgYXBsaWthY2lqZQANDUl6YmlyYSBkYXR1bWEADAxJemJpcmEgbWludXQACgpJemJpcmEgdXJl
ABYWSXpiaXJuaWsgbGV0YSBqZSB2aWRlbgANDUl6YnJhbmkgZGF0dW0ABwdJemJyYW5vABAQSXpi
cmlzIHBvaXp2ZWRiZQALC0l6a2xvcGxqZW5vAA0NS29uZWMgcmF6cG9uYQAHCEtvbsSNYW5vAAwN
S29uxI1uaSBkYXR1bQAVFktybWFyamVuamUgbmEgemHEjWV0ZWsABgZNZW5pICsAEhJNZW5pIHph
IGtybWFyamVuamUADw9OZXZlbGphdmVuIHZub3MAGBhOZXZlbGphdmVuIHZub3Mgb2Jkb2JqYS4A
CgpOaSBpemJyYW5vACAgT2JsaWthIGRhdHVtYSBuaSBkb3ZvbGplbmE6ICUxJHMACwtPcGlzIG9y
b2RqYQAGBk9wdXN0aQAhIU9wdXN0aXRldiByYXpkZWxrYSBuYSBkbnUgemFzbG9uYQAODlBvZ292
b3JubyBva25vAAwMUG9qYXZubyBva25vABITUG9rYcW+aSBvcGlzIG9yb2RqYQAKC1Bva2HFvmkg
dnNlACoqUG9tYWtuaXRlIHNlIHphIHByaWtheiBuYXNsZWRuamVnYSBtZXNlY2EuACUmUG9tYWtu
aXRlIHNlIHphIHByaWtheiBwb3puZWrFoWloIGxldC4AKSpQb21ha25pdGUgc2UgemEgcHJpa2F6
IHByZWrFoW5qZWdhIG1lc2VjYS4AJidQb21ha25pdGUgc2UgemEgcHJpa2F6IHpnb2RuZWrFoWlo
IGxldC4AEhJQb21payBuYSBsZXRvICUxJHMADQ1Qb21payBuYXZ6Z29yAAYGUG90ZWthAFZWUG92
bGVjaXRlLCBkYSBpemJlcmV0ZSBsZXRvLCBhbGkgc2UgZG90YWtuaXRlLCBkYSBwcmVrbG9waXRl
IG5hemFqIG5hIGl6YmlyYW5qZSBkbmV2YS4AFBVQb8WhaWxqYW5qZSBwb2l6dmVkYmUAEhJQcmVk
bG9naSBzbyBzcG9kYWoADAxQcmVraW5pIGtsaWMAHyBQcmVrbG9wIG5hIG5hxI1pbiB2bm9zYSBi
ZXNlZGlsYQAgIVByZWtsb3AgbmEgbmHEjWluIHZub3NhIHYga29sZWRhcgAXF1ByZWtsb3BpIG5h
IGl6YmlybyBsZXRhABsbUHJldmVyamFuamUgZG9ob2RuZWdhIGtsaWNhACIjUmF6xaFpcml0ZXYg
cmF6ZGVsa2EgbmEgZG51IHphc2xvbmEACgtSYXrFoWlyamVubwASFFJvxI1pY2EgemEgdmxlxI1l
bmplACgoU2t1cG5hIHJhYmEgeiBkcnVnaW1pIHByZWsgYXBsaWthY2lqZSAlcwAODlNrdXBuYSBy
YWJhIHo6AAcHU3ByZWptaQAbG1NwcmVtZW5pIG5hIG5hc2xlZG5qaSBtZXNlYwAaG1NwcmVtZW5p
IG5hIHByZWrFoW5qaSBtZXNlYwAMDFNwdXN0bmkgbWVuaQAHB1N0aWthbG8ACAhTdHJuaXRldgAg
IFN0cm5pdGV2IHJhemRlbGthIG5hIGRudSB6YXNsb25hAAgIU3Rybmplbm8AFRVUcmVudXRuYSBp
emJpcmE6ICUxJHMAAwNVcmEABQVWS0xPUAAMDlZlxI0gbW/Fvm5vc3RpAAoKVmtsb3BsamVubwAN
DVZuZXNlbmkgZGF0dW0AExNWbmVzZW5pIGRhdHVtOiAlMSRzAA4OVm5lc2l0ZSBkYXR1bWUACgpa
YXByaSBsaXN0ABgYWmFwcmkgbWVuaSB6YSBrcm1hcmplbmplAAcHWmF2aWhlawAGBlphdnJuaQAP
EFphxI1ldGVrIHJhenBvbmEADQ5aYcSNZXRuaSBkYXR1bQAPD1pub3RyYWogb2Jkb2JqYQAEBGRv
cC4ABARwb3AuAAsLcHJlc2xlZG5pY2EABgZ6YSB1cm8AEBAlMSRkIChuYSkgbWludXRvABQUJTEk
ZCAobmEpIHBvcnN5ZW50by4ACQklMSRkIG9yYXMAExNCYWhhZ3lhbmcgbWF5IGNoZWNrABERRHJv
cC1kb3duIG5hIG1lbnUAEhJIYW5kbGUgc2EgcGFnLWRyYWcAERFIaWdpdCBwYW5nIG9wc3lvbgAM
DEhpbmRpIG5hcGlsaQAhIUhpbmRpIHBpbmFwYXlhZ2FuIGFuZyBwZXRzYTogJTEkcwA1NUhpbmRp
IHR1bXV0dWdtYSBhbmcgcGV0c2Egc2EgaW5hYXNhaGFuZyBwYXR0ZXJuOiAlMSRzAAUFSS1PRkYA
BARJLU9OABERSS1jbGVhciBhbmcgcXVlcnkACgpJLWNvbGxhcHNlABsbSS1jb2xsYXBzZSBhbmcg
Ym90dG9tIHNoZWV0AAkJSS1kaXNtaXNzABoaSS1kaXNtaXNzIGFuZyBib3R0b20gc2hlZXQABQVJ
YmFiYQAUFEliYWhhZ2kgZ2FtaXQgYW5nICVzAA4OSWJhaGFnaSBzYS9rYXkAERFJbmlsYWdheSBu
YSBwZXRzYQAXF0luaWxhZ2F5IG5hIHBldHNhOiAlMSRzACMjSW52YWxpZCBhbmcgaW5wdXQgbmEg
aGFuYXkgbmcgcGV0c2EAEBBJbnZhbGlkIG5hIGlucHV0ABMTSXBha2l0YSBhbmcgdG9vbHRpcAAc
HElzYXJhIGFuZyBtZW51IG5nIG5hdmlnYXRpb24ADw9Jc2FyYSBhbmcgc2hlZXQACwtJc2luYXNh
Z2F3YQAREUlzdW1pdGUgYW5nIHF1ZXJ5ABkZS2FzYWx1a3V5YW5nIG5hcGlsaTogJTEkcwASEkth
c2FsdWt1eWFuZyB0YXdhZwASEkthdGFwdXNhbiBuZyByYW5nZQAHB0x1bWlwYXQAGhpMdW1pcGF0
IHNhIG5ha2FyYWFuZyBidXdhbgAaGkx1bWlwYXQgc2EgcGFncGlsaSBuZyB0YW9uADAwTHVtaXBh
dCBzYSBwYW1hbWFyYWFuIG5nIHBhZy1pbnB1dCBuZyBrYWxlbmRhcnlvACoqTHVtaXBhdCBzYSBw
YW1hbWFyYWFuIG5nIHBhZy1pbnB1dCBuZyB0ZXh0ABsbTHVtaXBhdCBzYSBzdXN1bm9kIG5hIGJ1
d2FuACIiTWFnLW5hdmlnYXRlIHBhcHVudGEgc2EgdGFvbmcgJTEkcwATE01hZy1uYXZpZ2F0ZSBw
YXRhYXMAFBRNYWctbmF2aWdhdGUgc2EgaG9tZQAwME1hZy1zY3JvbGwgcGFyYSBpcGFraXRhIGFu
ZyBtZ2EgbWFzIG5hdW5hbmcgdGFvbgArK01hZy1zY3JvbGwgcGFyYSBpcGFraXRhIGFuZyBuYWth
cmFhbmcgYnV3YW4ALCxNYWctc2Nyb2xsIHBhcmEgaXBha2l0YSBhbmcgc3VzdW5vZCBuYSBidXdh
bgAzM01hZy1zY3JvbGwgcGFyYSBtYWtpdGEgYW5nIG1nYSBtYXMga2FtYWthaWxhbmcgdGFvbgBI
SE1hZy1zd2lwZSBwYXJhIHB1bWlsaSBuZyB0YW9uLCBvIG1hZy10YXAgcGFyYSBidW1hbGlrIHNh
IHBhZ3BpbGkgbmcgYXJhdwAICE1hZ2hhbmFwAAkLTWFnaGFuYXDigKYAFRVNYWdsYWdheSBuZyBt
Z2EgcGV0c2EACgpNYXkgc2lnbmFsABISTWVudSBuZyBuYXZpZ2F0aW9uABYWTWdhIHN1aGVzdHlv
biBzYSBpYmFiYQAgIE5hZ3NpLXNjcmVlbiBuZyBwYXBhc29rIG5hIHRhd2FnAA0NTmFrYS1jb2xs
YXBzZQALC05ha2EtZXhwYW5kAAgITmFrYS1vZmYABwdOYWthLW9uABsbTmFraWtpdGEgYW5nIHBp
Y2tlciBuZyB0YW9uAAYGTmFwaWxpAAYGTmdheW9uAAQET3JhcwAaGlBhZ2hhaGFuYXAgZ2FtaXQg
YW5nIGJvc2VzABoaUGFsYXdha2luIGFuZyBib3R0b20gc2hlZXQAEBBQYXBhc29rIG5hIHRhd2Fn
AAUFUGV0c2EAFBRQZXRzYSBuZyBwYWdzaXNpbXVsYQATE1BldHNhIG5nIHBhZ3RhdGFwb3MAEhJQ
aWxpaW4gYW5nIEFNIG8gUE0ADg5QaW5pbGluZyBwZXRzYQANDVB1bWlsaSBuZyBhcHAAFBRQdW1p
bGkgbmcgbWdhIG1pbnV0bwATE1B1bWlsaSBuZyBtZ2EgcGV0c2EADg5QdW1pbGkgbmcgb3JhcwAP
D1B1bWlsaSBuZyBwZXRzYQATE1F1ZXJ5IHNhIHBhZ2hhaGFuYXAABwdTYWd1dGluAA8PU2ltdWxh
IG5nIHJhbmdlAAkJVGFuZ2dpaGFuAAgIVGFwb3MgbmEADQ1UaW5nbmFuIGxhaGF0AAQEV2FsYQA5
OVdhbGEgYW5nIHBldHNhIHNhIGluYWFzYWhhbmcgaGFuYXkgbmcgdGFvbiBuYSAlMSRzIC0gJTIk
cwAQEFdpbmRvdyBuZyBQb3AtVXAAERFuYW5nIGlsYW5nIG1pbnV0bwAPD25hbmcgaWxhbmcgb3Jh
cwAJESUxJGQg4Yiw4YuT4Ymz4Ym1AAgOJTEkZCDhiLDhi5PhibUACRElMSRkIOGJoOGImOGJtuGN
ogAKFCUxJGQg4Yuw4YmC4YmD4YuO4Ym9AAkJRnVuY3Rpb24rAAUFTWVudSsABARTeW0rAAoc4YiB
4YiJ4YqV4YidIOGLreGImOGIjeGKqOGJsQAHD+GIiCVzIOGKoOGMi+GIqwAEDOGIiOGIsOGLk+GJ
tQAGEuGIiOGLsOGJguGJg+GLjuGJvQAGEOGIieGIheGKlSDhi53hjIsAEzHhiI3hiq0g4Yur4YiN
4YiG4YqQIOGLqOGJgOGKlSDhiq3hiI3hiI0g4YyN4Ymk4Ym1AAsd4YiN4YqtIOGLq+GIjeGIhuGK
kCDhjI3hiaThibUAAwnhiJjhiI3hiLUADSPhiJjhiKPhiKrhi6sg4Yyl4YmG4Yib4YqVIOGKoOGI
s+GLrQAHE+GImOGKkOGIuyDhi7PhiLXhiLUACBbhiJjhi6vhi6Mg4Yut4YyO4Ym14YmxAAQM4YiY
4YyI4YqT4YqbAAkZ4YiY4Yyg4Yut4YmFIOGKoOGIteGMiOGJowAIFuGImOGMoOGLreGJhSDhiqDh
jL3hi7MACRnhiJvhiaXhiKrhi6sv4Yib4Yyl4Y2K4YurAAMJ4Yid4YqV4YidAAMJ4Yiw4Yit4Yud
AAQM4Yiw4Yml4Yi14YmlAAMJ4Yiw4YuT4Ym1AAcT4Yiw4YuT4Ym1IOGIneGIqOGMpQAHE+GIteGI
jeGKqeGKlSDhi53hjIsAIlLhiYDhipEg4Yqo4Ymw4Yyg4Ymg4YmA4YuNIOGIteGIreGLk+GJsCDh
jKXhiIjhibUg4YyL4YitIOGKoOGLreGLm+GImOGLteGIneGNpiAlMSRzAAkZ4YmA4YqT4Ym14YqV
IOGLq+GIteGMiOGJoQAJGeGJgOGKk+GJteGKlSDhi63hiJ3hiKjhjKEAAgbhiYDhipUAECThiYDh
ipUg4Yqg4YiN4Ymw4Y2I4YmA4Yuw4Yid4Y2mICUxJHMAJErhiYDhipUg4Yqo4Ymw4Yyg4Ymg4YmA
4YuNIOGLqOGLk+GImOGJtSDhiq3hiI3hiI0g4YuN4YyqIOGKkOGLjSAlMSRzIC0gJTIkcwAHE+GJ
gOGKlSDhi63hiJ3hiKjhjKEAGEDhiYDhi7DhiJ0g4Yur4YiJIOGLk+GImOGJs+GJteGKlSDhiIjh
iJvhiLPhi6jhibUg4Yut4Yi44Yml4YiN4YiJABQ24YmA4Yuz4Yia4YuN4YqVIOGLiOGIrSDhiIjh
iJvhiLPhi6jhibUg4Yut4Yi44Yml4YiN4YiJABMz4YmA4Yyj4Yup4YqVIOGLiOGIrSDhiIjhiJvh
iLPhi6jhibUg4Yut4Yi44Yml4YiN4YiJAAcT4Ymg4YiC4Yuw4Ym1IOGIi+GLrQAEDOGJoOGIreGJ
t+GIjQAKHOGJoOGKqOGNiuGIjSDhi6jhibDhjYjhibDhiLgACBbhiaDhiq3hiI3hiI0g4YuN4Yi1
4YylAAoa4Yml4YmFLeGJo+GLrSDhiJjhiLXhiq7hibUAAwnhiarhi7Lhi64ABQ/hibDhiJjhiK3h
jKfhiI0ABhLhibDhiLDhiaXhiLXhiafhiI0ACRnhibDhiYbhiI3hiYvhi60g4Yid4YqT4YiMAAYS
4Ymw4Yqo4YqT4YuN4YqX4YiNAAYS4Ymw4YuY4Yit4YyN4Ym34YiNAAoc4Ymw4Yyo4Yib4YiqIOGK
oOGIm+GIq+GMruGJvQACBuGJteGIrQAFD+GKoOGIsOGKk+GJpeGJtQADCeGKoOGJpeGIqwAFD+GK
oOGJteGJgOGJoOGIjQAPKeGKoOGKleGLtSDhiJjhibDhjI3hiaDhiKrhi6sg4Yut4Yid4Yio4Yyh
AAUN4Yqg4YyL4YirIOGJoAADCeGKoOGMpeGNiwAMIOGKpeGLqOGJsOGKq+GIhOGLsCDhi6vhiIgg
4Yyl4YiqAAQM4Yqo4Yiw4YuT4Ym1ABxK4Yqo4Yua4YiFIOGJoOGKi+GIiyDhi6vhiIkg4YuT4YiY
4Ymz4Ym14YqVIOGIiOGIm+GIs+GLqOGJtSDhi63hiLjhiaXhiI3hiIkABAzhiq3hjY3hibDhibUA
CRfhi4jhi7Ag4YiL4YutIOGLq+GIteGIsQAOJOGLiOGLsCDhiYDhi7PhiJrhi40g4YuI4YitIOGJ
gOGLreGIrQAPH+GLiOGLsCDhi5PhiJjhibUgJTEkcyDhi6vhiLXhiLEADyfhi4jhi7Ag4YuT4YiY
4Ym1IOGImOGIneGIqOGMpSDhiYDhi63hiK0AECrhi4jhi7Ag4Yuo4Yia4YmA4Yyl4YiI4YuNIOGL
iOGIrSDhiYDhi63hiK0AGD7hi4jhi7Ag4Yuo4YmA4YqVIOGImOGJgeGMoOGIquGLqyDhjI3hiaTh
ibUg4YiB4YqQ4YmzIOGJgOGLreGIrQATMeGLiOGLsCDhi6jhjL3hiIHhjY0g4YyN4Ymk4Ym1IOGI
geGKkOGJsyDhiYDhi63hiK0AMoCC4YuT4YiY4Ym1IOGIiOGImOGIneGIqOGMpSDhi6vhipXhiLjh
iKvhibXhibEg4YuI4Yut4YidIOGLiOGLsCDhiYDhipXhipUg4YiY4Yid4Yio4YylIOGImOGIjeGI
tiDhiIjhiJjhiYDhi6jhiK0g4YiY4YmzIOGLq+GLteGIreGMiQAMIOGLk+GImOGJtSDhiJjhiKvh
jK0g4Yut4Ymz4Yur4YiNAAIG4Yub4YisAAkZ4Yuo4YiY4Yij4Yiq4YurIOGMpeGJhuGImwAJGeGL
qOGImOGMgOGImOGIquGLqyDhiYDhipUACBbhi6jhiJvhiaXhiYLhi6sg4YmA4YqVAAkZ4Yuo4Ymw
4YiY4Yio4Yyg4YuNIOGJgOGKlQAOHuGLqOGKoOGIgeGKlSDhiJ3hiK3hjKvhjaYgJTEkcwARL+GL
qOGKoOGIteGJsOGLq+GLqOGJtSDhjKXhiYbhiJvhi47hib0g4Yqo4Ymz4Ym9AAoc4Yuo4Yqt4YiN
4YiNIOGImOGMgOGImOGIquGLqwAJGeGLqOGKreGIjeGIjSDhiJjhjKjhiKjhiLsACBbhi6jhi7Ph
iLDhiLMg4Yid4YqT4YiMAAwg4Yuo4Yuz4Yiw4YizIOGIneGKk+GIjOGKlSDhi53hjIsACBbhi6jh
i7XhiJ3hjL0g4Y2N4YiI4YyLAAcT4Yuo4YyI4Ymj4YuNIOGJgOGKlQANG+GLqOGMiOGJo+GLjSDh
iYDhipXhjaYgJTEkcwAMIOGLqOGMjeGIreGMjCDhiInhiIUg4Yut4YuY4Yit4YyJAA4m4Yuo4YyN
4Yit4YyMIOGIieGIheGKlSDhi63hiLDhiaXhiLXhiaEACRnhi6jhjY3hiIjhjIsg4YiY4Yyg4Yut
4YmFAAYS4Yur4YiN4Ymw4YiY4Yio4YyhAAUP4Yut4Y2I4YiN4YyJ4oCmAAMJ4Yuw4YmC4YmDAAkZ
4Yuw4YmC4YmD4YuO4Ym9IOGIneGIqOGMpQAFDeGMiOGJoiDhjKXhiKoAChrhjIjhiaIg4Yyl4Yiq
IOGIm+GMo+GIq+GJtQADCeGMoOGLi+GJtQASMOGMoOGLi+GJtSDhi4jhi63hiJ0g4Yqo4Yiw4YuT
4Ym14YqVIOGLreGIneGIqOGMoQAEDOGMoOGNjeGJt+GIjQADCeGNjeGIiOGMiwAJESUxJGQg4Z6T
4Z624Z6R4Z64AAsXJTEkZCDhnpfhnrbhnoLhnprhnpnhn5QACRElMSRkIOGemOGfieGfhOGehAAc
SuGegOGetuGemuGeh+GfkuGemuGevuGen+GemuGevuGen+GelOGeheGfkuGeheGeu+GelOGfkuGe
lOGek+GfkuGek+GfliAlMSRzABAw4Z6A4Z624Z6a4Z6O4Z+C4Z6T4Z624Z+G4Z6B4Z624Z6E4Z6A
4Z+S4Z6a4Z+E4Z6YACd14Z6A4Z624Z6a4Z6U4Z6J4Z+S4Z6F4Z684Z6b4Z6F4Z6T4Z+S4Z6b4Z+E
4Z+H4Z6A4Z624Z6b4Z6U4Z6a4Z634Z6F4Z+S4Z6G4Z+B4Z6R4Z6Y4Z634Z6T4Z6P4Z+S4Z6a4Z65
4Z6Y4Z6P4Z+S4Z6a4Z684Z6cABdF4Z6A4Z624Z6a4Z6U4Z6J4Z+S4Z6F4Z684Z6b4oCL4Z6Y4Z63
4Z6T4Z6P4Z+S4Z6a4Z654Z6Y4Z6P4Z+S4Z6a4Z684Z6cABZC4Z6A4Z624Z6a4oCL4Z6g4Z+F4Z6K
4Z+C4Z6b4Z6A4Z+G4Z6W4Z674Z6E4Z6K4Z+G4Z6O4Z6+4Z6a4Z6A4Z624Z6aAAoe4Z6A4Z624Z6a
4oCL4Z6g4Z+F4oCL4Z6F4Z684Z6bAAsh4Z6A4Z624Z6b4Z6U4Z6a4Z634Z6F4Z+S4Z6G4Z+B4Z6R
ABdF4Z6A4Z624Z6b4Z6U4Z6a4Z634Z6F4Z+S4Z6G4Z+B4Z6R4Z6K4Z+C4Z6b4Z6U4Z624Z6T4Z6U
4Z6J4Z+S4Z6F4Z684Z6bAB1N4Z6A4Z624Z6b4Z6U4Z6a4Z634Z6F4Z+S4Z6G4Z+B4Z6R4Z6K4Z+C
4Z6b4Z6U4Z624Z6T4Z6U4Z6J4Z+S4Z6F4Z684Z6b4Z+WICUxJHMAGk7hnoDhnrbhnpvhnpThnprh
nrfhnoXhn5Lhnobhn4HhnpHhnorhn4LhnpvhnpThnrbhnpPigIvhnofhn5Lhnprhnr7hnp/hnprh
nr7hnp8AIlzhnoDhnrbhnpvhnpThnprhnrfhnoXhn5Lhnobhn4HhnpHhnorhn4Lhnpvhnpjhnrfh
npPhnpThnrbhnpPhnqLhnpPhnrvhnonhn5Lhnonhnrbhno/hn5YgJTEkcwA7gJnhnoDhnrbhnpvh
npThnprhnrfhnoXhn5Lhnobhn4HhnpHhnorhn4Lhnpvhnp/hn5LhnpDhnrfhno/hnpPhn4XhnoDh
n5Lhnprhn4XhnoXhnpPhn5Lhnpvhn4Thn4fhnobhn5LhnpPhnrbhn4bhnorhn4Lhnpvhnprhn4bh
npbhnrnhnoThnpHhnrvhnoAgJTEkcyAtICUyJHMAMoCM4Z6A4Z624Z6b4Z6U4Z6a4Z634Z6F4Z+S
4Z6G4Z+B4Z6R4Z6Y4Z634Z6T4Z6P4Z+S4Z6a4Z684Z6c4Z6C4Z+S4Z6T4Z624Z6T4Z654Z6E4Z6b
4Z+G4Z6T4Z624Z+G4Z6K4Z+C4Z6b4Z6a4Z+G4Z6W4Z654Z6E4Z6R4Z674Z6A4Z6R4Z+B4Z+WICUx
JHMAFT/hnoDhnrbhnpvhnpThnprhnrfhnoXhn5Lhnobhn4HhnpHigIvhnoXhnrbhnpThn4vhnpXh
n5Lhnorhnr7hnpgAEjbhnoDhnrbhnpvhnpThnprhnrfhnoXhn5Lhnobhn4HhnpHigIvhnpThnonh
n5LhnoXhnpThn4sADCThnoDhn4bhno7hno/hn4vigIvhnpbhnpPhn5Lhnpnhnpvhn4sADSfhnoDh
n4bhnpbhnrvhnoThnorhn4bhno7hnr7hnprhnoDhnrbhnpoAFkLhnoDhn4bhnpbhnrvhnoThnpbh
nrfhnpPhnrfhno/hn5LhnpnhnoDhnrbhnprigIvhnqDhn4XigIvhnoXhnrzhnpsACyHhnoDhn5Lh
npPhnrvhnoThnoXhnpPhn5Lhnpvhn4Thn4cABQ/hnoLhn5LhnpjhnrbhnpMADy3hnoXhn4LhnoDh
nprhn4bhnpvhn4LhnoDigIvhnofhnrbigIvhnpjhnr3hnpkAEzPhnoXhn4LhnoDigIvhnprhn4bh
npvhn4LhnoDigIvhnofhnrbigIvhnpjhnr3hnpkgJXMADirhnoXhn4bhno7hnrvhnoXhnoXhnrbh
npThn4vhnpXhn5Lhnorhnr7hnpgACyHhnoXhn4bhno7hnrvhnoXhnpThnonhn5LhnoXhnpThn4sA
CBjhnoXhn5LhnprhnrbhnpPhnoXhn4ThnpsAF0XhnoXhn5LhnprhnrbhnpPhnoXhn4ThnpvigIvh
np/hnpPhn5LhnpvhnrnhnoDhnoHhnrbhnoThnoDhn5Lhnprhn4ThnpgABQ/hnobhn5Lhnpvhnr7h
npkADirhnofhnpjhn5Lhnprhnr7hnp/hnoXhn5Lhnprhnr7hnpPhnpHhn4Dhno8AECLhnofhn5Lh
nprhnr7hnp/hnprhnr7hnp8gQU0g4Z6sIFBNAAwk4Z6H4Z+S4Z6a4Z6+4Z6f4Z6a4Z6+4Z6f4Z6Y
4Z+J4Z+E4Z6EABM54Z6H4Z+S4Z6a4Z6+4Z6f4Z6a4Z6+4Z6f4oCL4Z6A4Z6Y4Z+S4Z6Y4Z6c4Z63
4Z6S4Z644oCL4oCLABQ84Z6H4Z+S4Z6a4Z6+4Z6f4Z6a4Z6+4Z6f4oCL4Z6A4Z624Z6b4Z6U4Z6a
4Z634Z6F4Z+S4Z6G4Z+B4Z6RABU/4Z6H4Z+S4Z6a4Z6+4Z6f4Z6a4Z6+4Z6f4oCL4Z6A4Z624Z6b
4oCL4Z6U4Z6a4Z634Z6F4Z+S4Z6G4Z+B4Z6RAAoe4Z6H4Z+S4Z6a4Z6+4Z6f4oCL4Z6T4Z624Z6R
4Z64AAYS4Z6K4Z6E4oCL4Z6i4Z684Z6fABAw4Z6K4Z624Z6A4Z+L4Z6U4Z6J4Z+S4Z6H4Z684Z6T
4oCL4Z6f4Z+G4Z6O4Z694Z6aAAgY4Z6K4Z624Z6A4Z+L4oCL4Z6F4Z674Z+HAAcV4Z6Q4Z+S4Z6E
4Z+D4Z6T4Z+B4Z+HAAUP4Z6T4Z624Z6R4Z644oCLAAYS4Z6U4Z6E4Z+S4Z6a4Z694Z6YABU/4Z6U
4Z6E4Z+S4Z6a4Z694Z6Y4oCL4Z6f4Z6T4Z+S4Z6b4Z654Z6A4Z6B4Z624Z6E4Z6A4Z+S4Z6a4Z+E
4Z6YABM54Z6U4Z6E4Z+S4Z6g4Z624Z6J4oCL4Z6A4Z+G4Z6O4Z6P4Z+L4oCL4Z6W4Z6T4Z+S4Z6Z
4Z6b4Z+LABI24Z6U4Z6J4Z+S4Z6F4Z684Z6b4oCL4Z6A4Z624Z6b4Z6U4Z6a4Z634Z6F4Z+S4Z6G
4Z+B4Z6RAAYS4Z6U4Z6K4Z634Z6f4Z+B4Z6SAAsh4Z6U4Z624Z6T4Z6H4Z+S4Z6a4Z6+4Z6f4Z6a
4Z6+4Z6fAAoe4Z6U4Z624Z6T4Z6S4Z644Z6A4Z6B4Z+S4Z6b4Z+HAAoe4Z6U4Z624Z6T4oCL4Z6U
4Z6E4Z+S4Z6a4Z694Z6YAAoe4Z6U4Z624Z6T4oCL4Z6W4Z6E4Z+S4Z6a4Z644Z6AAAMJ4Z6U4Z63
4Z6RAA4q4Z6U4Z634Z6R4Z6Y4Z+J4Z664Z6T4Z674Z6Z4Z6a4Z674Z6A4Z6a4Z6AAAkb4Z6U4Z63
4Z6R4Z6f4Z6T4Z+S4Z6b4Z654Z6AAAMJ4Z6U4Z6+4Z6AAA0n4Z6U4Z+K4Z684Z6P4Z674Z6E4oCL
4Z6U4Z634Z6R4Z6U4Z6+4Z6AABhI4Z6U4Z+S4Z6K4Z684Z6a4Z6R4Z+F4oCL4Z6A4Z624Z6a4Z6H
4Z+S4Z6a4Z6+4Z6f4Z6a4Z6+4Z6f4Z6G4Z+S4Z6T4Z624Z+GAB1X4Z6U4Z+S4Z6K4Z684Z6a4Z6R
4Z+F4oCL4Z6Y4Z674Z6B4Z6E4Z624Z6a4Z6U4Z6J4Z+S4Z6F4Z684Z6b4oCL4Z6U4Z+S4Z6a4Z6P
4Z634Z6R4Z634Z6TABpO4Z6U4Z+S4Z6K4Z684Z6a4Z6R4Z+F4oCL4Z6Y4Z674Z6B4Z6E4Z624Z6a
4Z6U4Z6J4Z+S4Z6F4Z684Z6b4oCL4Z6i4Z6A4Z+S4Z6f4Z6aABI24Z6U4Z+S4Z6K4Z684Z6a4oCL
4Z6R4Z+F4oCL4Z6B4Z+C4Z6U4Z6T4Z+S4Z6R4Z624Z6U4Z+LAA4q4Z6U4Z+S4Z6K4Z684Z6a4oCL
4Z6R4Z+F4oCL4Z6B4Z+C4Z6Y4Z674Z6TAAYS4Z6U4Z+S4Z6a4Z6i4Z6U4Z+LABU/4Z6W4Z6E4Z+S
4Z6a4Z644Z6A4oCL4Z6f4Z6T4Z+S4Z6b4Z654Z6A4Z6B4Z624Z6E4Z6A4Z+S4Z6a4Z+E4Z6YAA8t
4Z6Y4Z634Z6T4Z6U4Z624Z6T4oCL4Z6H4Z+S4Z6a4Z6+4Z6f4Z6a4Z6+4Z6fAAoe4Z6Y4Z6+4Z6b
4Z6R4Z624Z+G4Z6E4Z6i4Z6f4Z+LAA8t4Z6Y4Z+J4Z664Z6T4Z674Z6Z4Z6S4Z+S4Z6b4Z624Z6A
4Z+L4Z6F4Z674Z+HAAsh4Z6Y4Z+J4Z664Z6T4Z674Z6Z4Z6a4Z674Z6A4Z6a4Z6AAAQM4Z6Y4Z+J
4Z+E4Z6EAAkR4Z6Y4Z+J4Z+E4Z6EICUxJGQAEjbhnprhnpnhn4jhnpbhn4HhnpvhnpThn4nhnrvh
npPhn5LhnpjhnrbhnpPhnpPhnrbhnpHhnrgAEjbhnprhnpnhn4jhnpbhn4HhnpvhnpThn4nhnrvh
npPhn5LhnpjhnrbhnpPhnpjhn4nhn4ThnoQAFTXhnprhnrvhnoDhnprhnoDhnpHhn4XhnoDhnrbh
npPhn4vhnobhn5LhnpPhnrbhn4YgJTEkcwAHFeGemuGeveGeheGemuGetuGem+GfiwAYSOGemuGf
huGegOGet+Gem+GeiuGevuGemOGfkuGelOGeuOGelOGehOGfkuGeoOGetuGeieGegeGfguGegOGf
kuGemuGfhOGemQAWQuGemuGfhuGegOGet+Gem+GeiuGevuGemOGfkuGelOGeuOGelOGehOGfkuGe
oOGetuGeieGegeGfguGemOGeu+GekwAdV+GemuGfhuGegOGet+Gem+GeiuGevuGemOGfkuGelOGe
uOKAi+GelOGehOGfkuGeoOGetuGeieGehuGfkuGek+GetuGfhuGegOGfkuGemuGfhOGemeGflwAb
UeGemuGfhuGegOGet+Gem+GeiuGevuGemOGfkuGelOGeuOKAi+GelOGehOGfkuGeoOGetuGeieGe
huGfkuGek+GetuGfhuGemOGeu+Gek+GflwAKHuGemuGfhuGegOGet+Gem+GeoeGevuGehOGem+Ge
vgADCeGem+Geu+GelAAMJOGenOGet+Gek+GeiuGevOKAi+Gem+GfhOGej+GeoeGevuGehAAGEuGe
nOGeuOGeiuGfgeGeouGevAAMJOGen+GemOGfkuGeouGetuGej+KAi+Gen+GfhuGejuGeveGemgAH
FeGen+GfkuGenOGfguGehOGemuGegAANJ+Gen+GfkuGenOGfguGehOGemuGegOGen+GfhuGejuGe
veGemuKAiwARM+Gen+GfkuGenOGfguGehOGemuGegOKAi+Gej+GetuGemOKAi+Gen+GfhuGeoeGf
geGehAAIGOGen+GfkuGenOGfguGehOGemuGegOKApgAcVOGeouGetuGeheGemOGevuGem+Geg+Ge
vuGeieGeleGfkuGekeGetuGfhuGehOGeh+GfkuGemuGevuGen+GemuGevuGen+GehuGfkuGek+Ge
tuGfhgBAgL7hnqLhnrzhnp/hnorhnr7hnpjhn5LhnpThnrjhnofhn5Lhnprhnr7hnp/hnprhnr7h
np/hnobhn5LhnpPhnrbhn4Yg4Z6s4Z6F4Z674Z6F4Z6K4Z6+4Z6Y4Z+S4Z6U4Z644Z6U4Z+S4Z6K
4Z684Z6a4Z6P4Z+S4Z6a4Z6h4Z6U4Z+L4Z6R4Z+F4Z6A4Z624Z6a4Z6H4Z+S4Z6a4Z6+4Z6f4Z6a
4Z6+4Z6f4Z6Q4Z+S4Z6E4Z+D4Z6c4Z634Z6JAAsh4oCL4Z6R4Z+F4Z6R4Z+G4Z6W4Z+Q4Z6a4Z6K
4Z6+4Z6YAAoUJTEkZCDgppjgpqPgp43gpp/gpr4ABwslMSRkIOCmn+CmvgAKFCUxJGQg4Kau4Ka/
4Kao4Ka/4KafABY2JXMt4KaP4KawIOCmuOCmvuCmpeCnhyDgprbgp4fgpq/gprzgpr7gprAg4KaV
4Kaw4KeB4KaoACFXJ+CmleCnjeCmr+CmvuCmsuCnh+CmqOCnjeCmoeCmvuCmsCDgpofgpqjgpqrg
p4Hgpp8nIOCmruCni+CmoeCnhyDgpqzgpqbgprIg4KaV4Kaw4KeB4KaoABxIJ+Cmn+Cnh+CmleCn
jeCmuOCmnyDgpofgpqjgpqrgp4Hgpp8nIOCmruCni+CmoeCnhyDgpqzgpqbgprIg4KaV4Kaw4KeB
4KaoABEjQU0g4Kas4Ka+IFBNIOCmrOCnh+Cmm+CnhyDgpqjgpr/gpqgAGELgpobgppfgpr7gpq7g
p4Ag4Kau4Ka+4Ka44KeHIOCmquCmsOCmv+CmrOCmsOCnjeCmpOCmqCDgppXgprDgp4HgpqgAGkbg
pobgppfgp4fgprAg4Kas4Kab4KawIOCmpuCnh+CmluCmpOCnhyDgprjgp43gppXgp43gprDgprIg
4KaV4Kaw4KeB4KaoABpG4KaG4KaX4KeH4KawIOCmruCmvuCmuCDgpqbgp4fgppbgpqTgp4cg4Ka4
4KeN4KaV4KeN4Kaw4KayIOCmleCmsOCngeCmqAAXP+CmhuCml+Cnh+CmsCDgpq7gpr7gprjgp4cg
4Kaq4Kaw4Ka/4Kas4Kaw4KeN4Kak4KaoIOCmleCmsOCngeCmqAACBuCmhuCmnAAQLOCmhuCmoeCm
vOCmvuCmsiDgppXgprDgpr4g4Ka54Kav4Ka84KeH4Kab4KeHAAoc4KaG4Kaw4KaTIOCmrOCmv+Cm
leCmsuCnjeCmqgAKHOCmh+CmqOCmleCmvuCmruCmv+CmgiDgppXgprIAHlLgpofgpqjgppXgpr7g
pq7gpr/gpoIg4KaV4KayIOCmuOCnjeCmleCnjeCmsOCmv+CmqOCmv+CmgiDgppXgprDgpr4g4Ka5
4Kaa4KeN4Kab4KeHAAkZ4KaJ4Kak4KeN4Kak4KawIOCmpuCmv+CmqAARL+CmieCmquCmsOCnhyDg
pqjgp4fgpq3gpr/gppfgp4fgpp8g4KaV4Kaw4KeB4KaoABAs4KaJ4Kay4KeN4Kay4KeH4KaWIOCm
leCmsOCmviDgpqTgpr7gprDgpr/gppYAFjLgpongprLgp43gprLgp4fgppYg4KaV4Kaw4Ka+IOCm
pOCmvuCmsOCmv+CmljogJTEkcwAbPeCmj+CmhyDgpqTgpr7gprDgpr/gppYg4Kay4KeH4KaW4Ka+
IOCmr+CmvuCmrOCnhyDgpqjgpr46ICUxJHMAEzPgpo/gppXgpp/gpr8g4KaF4KeN4Kav4Ka+4Kaq
IOCmrOCnh+Cmm+CnhyDgpqjgpr/gpqgAVIDe4KaP4KaV4Kaf4Ka/IOCmrOCmm+CmsCDgpqzgp4fg
ppvgp4cg4Kao4Ka/4Kak4KeHIOCmuOCni+Cmr+CmvOCmvuCmh+CmqiDgppXgprDgp4Hgpqgg4KaF
4Kal4Kas4Ka+IOCmleCni+CmqOCmkyDgpo/gppXgpp/gpr8g4Kam4Ka/4KaoIOCmrOCmvuCmm+Cm
pOCnhyDgpqvgpr/gprDgp4cg4KaX4Ka/4Kav4Ka84KeHIOCmuOCngeCmh+CmmuCnhyDgpp/gp43g
pq/gpr7gpqog4KaV4Kaw4KeB4KaoAA4m4KaP4KakIOCmmOCmo+CnjeCmn+CmvuCmsCDgppzgpqjg
p43gpq8ADyngpo/gpqQg4Kau4Ka/4Kao4Ka/4Kaf4KeH4KawIOCmnOCmqOCnjeCmrwAhW+CmleCm
r+CmvOCnh+CmleCmn+CmvyDgpqzgpr/gppXgprLgp43gpqog4Kas4KeH4Kab4KeHIOCmqOCnh+Cm
k+Cmr+CmvOCmviDgprngpq/gprzgp4fgppvgp4cACx3gppXgprIg4KaV4KeH4Kaf4KeHIOCmpuCm
v+CmqAAIFuCmleCmvuCmnCDgpprgprLgppvgp4cAIlrgppXgp4vgpqjgppMg4KaP4KaV4Kaf4Ka/
IOCmrOCmm+CmsCDgpqzgp4fgppvgp4cg4Kao4Ka/4Kak4KeHIOCmquCmvuCmsuCnjeCmn+CnhyDg
pqjgpr/gpqgACx/gppXgp4vgpqjgppPgpp/gpr/gpocg4Kao4Kav4Ka8AA8p4KaV4KeL4Kav4Ka8
4KeH4Kaw4Ka/IOCmnOCmruCmviDgpqbgpr/gpqgAEjLgppXgp4vgpq/gprzgp4fgprDgpr8g4Kau
4KeB4Kab4KeHIOCmq+Cnh+CmsuCngeCmqAAOJuCmmOCmo+CnjeCmn+CmviDgpqzgp4fgppvgp4cg
4Kao4Ka/4KaoAAgW4Kaa4Ka+4Kay4KeBIOCmhuCmm+CnhwAJGeCmmuCmvuCmsuCngSDgppXgprDg
p4HgpqgADCDgpprgpr7gprLgp4Eg4Kal4Ka+4KaV4Ka+IOCmleCmsgAMIuCmn+CngeCmsuCmn+Cm
v+CmqiDgpqbgp4fgppbgpr7gpqgAEzXgpp/gp4fgpqjgp4cg4KaG4Kao4Ka+4KawIOCmueCnjeCm
r+CmvuCmqOCnjeCmoeCnh+CmsgAFD+Cmn+CnjeCmr+CmvuCmrAAMIuCmoeCmvuCmr+CmvOCmvuCm
suCmlyDgpqzgppXgp43gprgADSXgpqHgp43gprDgpqrgpqHgpr7gpongpqgg4Kau4KeH4Kao4KeB
AAUP4Kak4Ka+4Kaw4Ka/4KaWAA4m4Kak4Ka+4Kaw4Ka/4KaWIOCmrOCnh+Cmm+CnhyDgpqjgpr/g
pqgACx/gpqTgpr7gprDgpr/gppYg4Kay4Ka/4KaW4KeB4KaoAC+AgeCmpOCmvuCmsOCmv+CmluCn
h+CmsCDgpqzgp43gpq/gpr7gpqrgp43gpqTgpr8g4Ka44Kau4KeN4Kaq4Kaw4KeN4KaV4Ka/4Kak
IOCmh+CmqOCmquCngeCmnyDgpq3gp4HgprIg4Kam4KeH4KaT4Kav4Ka84Ka+IOCmhuCmm+CnhwAS
MuCmqOCmv+CmmuCnhyDgpqbgp4fgppPgpq/gprzgpr4g4Ka44Ka+4Kac4KeH4Ka24KaoABk74Kao
4KeH4Kat4Ka/4KaX4KeH4KafIOCmleCmsOCnhyAlMSRzIOCmrOCmm+CmsOCnhyDgpq/gpr7gpqgA
DSXgpqjgp4fgpq3gpr/gppfgp4fgprbgpqgg4Kau4KeH4Kao4KeBABc/4Kao4KeH4Kat4Ka/4KaX
4KeH4Ka24KaoIOCmruCnh+CmqOCngSDgpqzgpqjgp43gpqcg4KaV4Kaw4KeB4KaoAAwg4Kaq4Kaq
LeCmhuCmqiDgpongpofgpqjgp43gpqHgp4sAGkbgpqrgprDgp4fgprAg4Kas4Kab4KawIOCmpuCn
h+CmluCmpOCnhyDgprjgp43gppXgp43gprDgprIg4KaV4Kaw4KeB4KaoABpG4Kaq4Kaw4KeH4Kaw
IOCmruCmvuCmuCDgpqbgp4fgppbgpqTgp4cg4Ka44KeN4KaV4KeN4Kaw4KayIOCmleCmsOCngeCm
qAAweuCmquCnjeCmsOCmpOCnjeCmr+CmvuCmtuCmv+CmpCDgpqrgp43gpq/gpr7gpp/gpr7gprDg
p43gpqjgp4fgprAg4Ka44Ka+4Kal4KeHIOCmpOCmvuCmsOCmv+CmliDgpq7gpr/gprLgppvgp4cg
4Kao4Ka+OiAlMSRzADFz4Kaq4KeN4Kaw4Kak4KeN4Kav4Ka+4Ka24Ka/4KakIOCmrOCmm+CmsOCn
h+CmsCDgprDgp4fgpp7gp43gppzgp4fgprAg4Kas4Ka+4KaH4Kaw4KeH4KawIOCmpOCmvuCmsOCm
v+CmliAlMSRzIC0gJTIkcwAjX+CmrOCmm+CmsCDgpqzgp4fgppvgp4cg4Kao4KeH4KaT4Kav4Ka8
4Ka+4KawIOCmpOCmvuCmsuCmv+CmleCmviDgpqbgp4fgppbgpr4g4Kav4Ka+4Kaa4KeN4Kab4KeH
AA4m4Kas4Kah4Ka8IOCmleCmsOCmviDgprngpq/gprzgp4fgppvgp4cACBbgpqzgpqjgp43gpqcg
4KaG4Kab4KeHACFR4Kas4Kaw4KeN4Kak4Kau4Ka+4Kao4KeHIOCmrOCnh+Cmm+CnhyDgpqjgp4fg
ppPgpq/gprzgpr4g4Ka54Kav4Ka84KeH4Kab4KeHOiAlMSRzAAoc4Kas4Ka+4Kak4Ka/4KayIOCm
leCmsOCngeCmqAARL+CmrOCnh+Cmm+CnhyDgpqjgp4fgppPgpq/gprzgpr4g4Kak4Ka+4Kaw4Ka/
4KaWABEv4Kas4KeH4Kab4KeHIOCmqOCnh+Cmk+Cmr+CmvOCmviDgprngpq/gprzgpqjgpr8AEjLg
pqzgp4fgppvgp4cg4Kao4KeH4KaT4Kav4Ka84Ka+IOCmueCmr+CmvOCnh+Cmm+CnhwAQLOCmreCm
r+CmvOCnh+CmuCDgprjgpr7gprDgp43gppog4KaV4Kaw4KeB4KaoAAUP4Kat4Ka/4Kah4Ka/4KaT
AAkZ4Kat4KeB4KayIOCmh+CmqOCmquCngeCmnwAOJuCmruCmv+CmqOCmv+CmnyDgpqzgp4fgppvg
p4cg4Kao4Ka/4KaoAAUP4Kau4KeB4Kab4KeB4KaoAAoc4Kaw4KeH4Kae4KeN4KacIOCmtuCngeCm
sOCngQAJGeCmsOCnh+CmnuCnjeCmnCDgprbgp4fgprcADSPgprbgpr/gpp8g4Kas4Kao4KeN4Kan
IOCmleCmsOCngeCmqAARL+CmtuCngeCmsOCngSDgprngppPgpq/gprzgpr7gprAg4Kak4Ka+4Kaw
4Ka/4KaWAAsf4Ka24KeH4Kav4Ka84Ka+4KawIOCmleCmsOCngeCmqAAQLOCmtuCnh+CmtyDgprng
ppPgpq/gprzgpr7gprAg4Kak4Ka+4Kaw4Ka/4KaWAA0l4Ka44KaZ4KeN4KaV4KeB4Kaa4Ka/4Kak
IOCmleCmsOCngeCmqAAMIuCmuOCmrOCml+CngeCmsuCmvyDgpqbgp4fgppbgp4HgpqgAChzgprjg
pr7gprDgp43gppog4KaV4Kaw4KeB4KaoAAsf4Ka44Ka+4Kaw4KeN4KaaIOCmleCmsOCngeCmqOKA
pgANJeCmuOCmvuCmsOCnjeCmmiDgppXgp4vgpq/gprzgp4fgprDgpr8ACx/gprjgp4Dgpq7gpr7g
prAg4Kau4Kan4KeN4Kav4KeHAAQM4Ka44KeB4KaH4KaaAClv4Ka44KeN4KaV4KeN4Kaw4Ka/4Kao
4KeH4KawIOCmqOCmv+CmmuCnhyDgpoXgp43gpq/gpr7gpp/gpr7gppog4KaV4Kaw4Ka+IOCmtuCm
v+CmnyDgpobgpqHgprzgpr7gprIg4KaV4Kaw4KeB4KaoACdp4Ka44KeN4KaV4KeN4Kaw4Ka/4Kao
4KeH4KawIOCmqOCmv+CmmuCnhyDgpoXgp43gpq/gpr7gpp/gpr7gppog4KaV4Kaw4Ka+IOCmtuCm
v+CmnyDgpqzgpqHgprwg4KaV4Kaw4KeB4KaoAClv4Ka44KeN4KaV4KeN4Kaw4Ka/4Kao4KeH4Kaw
IOCmqOCmv+CmmuCnhyDgpoXgp43gpq/gpr7gpp/gpr7gppog4KaV4Kaw4Ka+IOCmtuCmv+CmnyDg
pqzgpr7gpqTgpr/gprIg4KaV4Kaw4KeB4KaoAAkZ4Ka54Kav4Ka84KeHIOCml+Cnh+Cmm+CnhwAR
L+CmueCni+CmruCnhyDgpqjgp4fgpq3gpr/gppfgp4fgpp8g4KaV4Kaw4KeB4KaoAAgIJTEkZCBq
YW0ACgolMSRkIG1lbml0AAwMJTEkZCBwZXJzZW4uAAUFQUtUSUYABQVBa3RpZgAHB0FsaWhrYW4A
Dg5CYWdpa2FuIGRlbmdhbgAREUJhZ2lrYW4gZGVuZ2FuICVzABgYQmVyYWxpaCBrZSBtZW1pbGlo
IHRhaHVuAB4eQmVyYWxpaCBrZSBtb2RlIGlucHV0IGthbGVuZGVyABoaQmVyYWxpaCBrZSBtb2Rl
IGlucHV0IHRla3MABwdDaXV0a2FuAAwMRGFsYW0gcHJvc2VzAA0NRGFsYW0gcmVudGFuZwAJCURp
Y2l1dGthbgAJCURpbHVhc2thbgASEkRpcGVyaWtzYSBzZWJhZ2lhbgAHB0RpcGlsaWgAUFBHZXNl
ciB1bnR1ayBtZW1pbGloIHRhaHVuLCBhdGF1IGtldHVrIHVudHVrIGJlcmFsaWgga2VtYmFsaSBr
ZSBwZW1pbGloYW4gdGFuZ2dhbAAMDEhhbmRlbCBnZXNlcgALC0hhcHVzIGt1ZXJpAAgISGFyaSBp
bmkAISFJbnB1dCByZW50YW5nIHRhbmdnYWwgdGlkYWsgdmFsaWQAERFJbnB1dCB0aWRhayB2YWxp
ZAADA0phbQAFBUphd2FiAA4OSmVuZGVsYSBQb3AtVXAADw9LZW1iYWxpIGtlIGF0YXMACwtLaXJp
bSBrdWVyaQALC0xpaGF0IHNlbXVhABAQTWFzdWtrYW4gdGFuZ2dhbAAVFU1lbHVhc2thbiBzaGVl
dCBiYXdhaAAWFk1lbmNpdXRrYW4gc2hlZXQgYmF3YWgABQVNZW5pdAANDU1lbnUgZHJvcGRvd24A
DQ1NZW51IG5hdmlnYXNpABMTTWVudXR1cCBzaGVldCBiYXdhaAAZGU1lbnlhcmluZyBwYW5nZ2ls
YW4gbWFzdWsACAhOT05BS1RJRgAICE5vbmFrdGlmAAkJT3BzaSBsYWluAA8PUGFuZ2dpbGFuIG1h
c3VrABwcUGFuZ2dpbGFuIHNlZGFuZyBiZXJsYW5nc3VuZwAWFlBlbWlsaWggdGFodW4gdGVybGlo
YXQAERFQZW5lbHVzdXJhbiBzdWFyYQAQEFBpbGloIEFNIGF0YXUgUE0ADg5QaWxpaCBhcGxpa2Fz
aQAJCVBpbGloIGphbQALC1BpbGloIG1lbml0ABAQUGlsaWggdGFodW4gJTEkcwANDVBpbGloIHRh
bmdnYWwAFhZQaWxpaGFuIHNhYXQgaW5pOiAlMSRzAAoKUHVrdWwgJTEkZAANDVJlbnRhbmcgYWto
aXIADAxSZW50YW5nIGF3YWwADg5TYXJhbiBkaSBiYXdhaAApKVNjcm9sbCB1bnR1ayBtZW5hbXBp
bGthbiBidWxhbiBiZXJpa3V0bnlhACkpU2Nyb2xsIHVudHVrIG1lbmFtcGlsa2FuIGJ1bGFuIHNl
YmVsdW1ueWEAKSlTY3JvbGwgdW50dWsgbWVuYW1waWxrYW4gdGFodW4gYmVyaWt1dG55YQApKVNj
cm9sbCB1bnR1ayBtZW5hbXBpbGthbiB0YWh1biBzZWJlbHVtbnlhAAcHU2VsZXNhaQAREVRhbXBp
bGthbiB0b29sdGlwAAcHVGFuZ2dhbAANDVRhbmdnYWwgYWtoaXIAOTlUYW5nZ2FsIGRpIGx1YXIg
cmVudGFuZyB0YWh1biB5YW5nIGRpaGFyYXBrYW4gJTEkcyAtICUyJHMADQ1UYW5nZ2FsIG11bGFp
ADU1VGFuZ2dhbCB0aWRhayBjb2NvayBkZW5nYW4gcG9sYSB5YW5nIGRpaGFyYXBrYW46ICUxJHMA
HR1UYW5nZ2FsIHRpZGFrIGRpaXppbmthbjogJTEkcwAXF1RhbmdnYWwgeWFuZyBkaW1hc3Vra2Fu
AB0dVGFuZ2dhbCB5YW5nIGRpbWFzdWtrYW46ICUxJHMAFBRUYW5nZ2FsIHlhbmcgZGlwaWxpaAAI
CFRlbHVzdXJpAA4OVGVsdXN1cmkga3VlcmkACwtUZWx1c3VyaS4uLgAJCVRpZGFrIGFkYQANDVRp
ZGFrIGRpcGlsaWgABQVUb2xhawAYGFR1bmp1a2thbiBqYWxhbiBrZSBydW1haAAFBVR1dHVwABMT
VHV0dXAgbWVudSBuYXZpZ2FzaQALC1R1dHVwIHNoZWV0ABgYVWJhaCBrZSBidWxhbiBiZXJpa3V0
bnlhABgYVWJhaCBrZSBidWxhbiBzZWJlbHVtbnlhAAUFc3Bhc2kACQl1bnR1ayBqYW0ACwt1bnR1
ayBtZW5pdAANGyUxJGQg4LKTIOCyleCzjeCysuCyvuCyleCzjQAJESUxJGQg4LKX4LKC4LKf4LOG
AA0dJTEkZCDgsqjgsr/gsq7gsr/gsrfgspfgsrPgs4EACxUlMSRkIOCytuCzh+CyleCyoeCyvi4A
HUklMSRzIOCyteCysOCzjeCyt+CyleCzjeCyleCzhiDgsqjgs43gsq/gsr7gsrXgsr/gspfgs4fg
sp/gs40g4LKu4LK+4LKh4LK/ABU3JXMg4LKo4LOK4LKC4LKm4LK/4LKX4LOGIOCyueCyguCymuCy
v+CyleCziuCys+CzjeCys+CyvwAULkFNIOCyheCypeCyteCyviBQTSDgsobgsq/gs43gspXgs4bg
sq7gsr7gsqHgsr8ADCLgsoXgsoLgsqTgsr/gsq4g4LKm4LK/4LKo4LK+4LKC4LKVAA8r4LKF4LKu
4LK+4LKo4LON4LKvIOCyh+CyqOCzjeKAjOCyquCzgeCyn+CzjQADCeCyhuCyqOCzjQAJGeCyhuCy
qOCzjSDgsobgspfgsr/gsqbgs4YAAwngsobgsqvgs40ACRngsobgsqvgs40g4LKG4LKX4LK/4LKm
4LOGAA0l4LKG4LKv4LON4LKV4LOGIOCyruCyvuCyoeCyv+CysuCzjeCysgAOKuCyhuCyr+CzjeCy
leCzhuCyruCyvuCyoeCysuCyvuCyl+Cyv+CypuCzhgALH+CyhuCysOCyguCyrSDgsqbgsr/gsqjg
sr7gsoLgspUAGEbgsobgs43gsq/gsqrgs43igIzgsrXgs4rgsoLgsqbgsqjgs43gsqjgs4Eg4LKG
4LKv4LON4LKV4LOG4LKu4LK+4LKh4LK/AAQM4LKH4LKC4LKm4LOBABEx4LKH4LKo4LON4LKo4LK3
4LON4LKf4LOBIOCyhuCyr+CzjeCyleCzhuCyl+Cys+CzgQAUOuCyh+CyteCysOCziuCyguCypuCy
v+Cyl+CzhiDgsrngsoLgsprgsr/gspXgs4rgsrPgs43gsrPgsr8ACBjgsongsqTgs43gsqTgsrDg
sr/gsrjgsr8ADijgso7gsrLgs43gsrLgsrXgsqjgs43gsqjgs4Ig4LKo4LOL4LKh4LK/AFqA+OCy
kuCyguCypuCzgSDgsrXgsrDgs43gsrfgsrXgsqjgs43gsqjgs4Eg4LKG4LKv4LON4LKV4LOG4LKu
4LK+4LKh4LKy4LOBIOCyuOCzjeCyteCziOCyquCzjSDgsq7gsr7gsqHgsr8g4LKF4LKl4LK14LK+
IOCykuCyguCypuCzgSDgsqbgsr/gsqjgsrXgsqjgs43gsqjgs4Eg4LKG4LKv4LON4LKV4LOG4LKu
4LK+4LKh4LKy4LOBIOCyueCyv+CyguCypOCyv+CysOCzgeCyl+CysuCzgSDgsp/gs43gsq/gsr7g
sqrgs40g4LKu4LK+4LKh4LK/AAoc4LKS4LKz4LKs4LKw4LOB4LK1IOCyleCysOCzhgAmbOCykuCy
s+CyrOCysOCzgeCytSDgspXgsrDgs4bgsq/gsqjgs43gsqjgs4Eg4LK44LON4LKV4LON4LKw4LOA
4LKo4LONIOCyruCyvuCyoeCysuCyvuCyl+CzgeCypOCzjeCypOCyv+CypuCzhgAOKOCyleCysOCz
hiDgspXgs4rgsqjgs4bgspfgs4rgsrPgsr/gsrjgsr8ADSfgspXgs4Hgspfgs43gspfgsr/gsrjg
srLgsr7gspfgsr/gsqbgs4YACBjgspXgs4Hgspfgs43gspfgsr/gsrjgsr8AG0vgspXgs4bgsrPg
sq3gsr7gspfgsqYg4LK24LOA4LKf4LONIOCyheCyqOCzjeCyqOCzgSDgspXgs4Hgspfgs43gspfg
sr/gsrjgsr8AHE7gspXgs4bgsrPgsq3gsr7gspfgsqYg4LK24LOA4LKf4LONIOCyheCyqOCzjeCy
qOCzgSDgsrXgspzgsr7gspfgs4rgsrPgsr/gsrjgsr8AHE7gspXgs4bgsrPgsq3gsr7gspfgsqYg
4LK24LOA4LKf4LONIOCyheCyqOCzjeCyqOCzgSDgsrXgsr/gsrjgs43gsqTgsrDgsr/gsrjgsr8A
ImDgspXgs43gsq/gsr7gsrLgs4bgsoLgsqHgsrDgs40g4LKH4LKo4LON4oCM4LKq4LOB4LKf4LON
IOCyruCzi+CyoeCzjeKAjOCyl+CzhiDgsqzgsqbgsrLgsr/gsrjgsr8ABAzgspfgsoLgsp/gs4YA
Ch7gspfgsoLgsp/gs4bgsq/gsrXgsrDgs4bgspfgs4YAEjTgsprgsr7gsrLgs43gsqTgsr/gsq/g
srLgs43gsrLgsr/gsrDgs4HgsrUg4LKV4LKw4LOGAAkb4LKf4LOC4LKy4LON4oCM4LKf4LK/4LKq
4LONABY+4LKf4LOC4LKy4LON4oCM4LKf4LK/4LKq4LONIOCyheCyqOCzjeCyqOCzgSDgsqTgs4vg
srDgsr/gsrjgsr8ABhLgsp/gs43gsq/gsr7gsqzgs40ABhLgsqHgs4jgsrLgsr7gspfgs40AEC7g
sqHgs43gsrDgsr7gsqrgs43igIzgsqHgs4zgsqjgs40g4LKu4LOG4LKo4LOBAAYS4LKm4LK/4LKo
4LK+4LKC4LKVACZs4LKm4LK/4LKo4LK+4LKC4LKVIOCyteCzjeCyr+CyvuCyquCzjeCypOCyv+Cy
ryDgsofgsqjgs43igIzgsqrgs4Hgsp/gs40g4LKF4LKu4LK+4LKo4LON4LKv4LK14LK+4LKX4LK/
4LKm4LOGABZA4LKm4LK/4LKo4LK+4LKC4LKV4LKX4LKz4LKo4LON4LKo4LOBIOCyhuCyr+CzjeCy
leCzhuCyruCyvuCyoeCyvwAUOuCypuCyv+CyqOCyvuCyguCyleCyl+Cys+CyqOCzjeCyqOCzgSDg
sqjgsq7gs4Lgsqbgsr/gsrjgsr8AJF7gsqbgsr/gsqjgsr7gsoLgspXgsrXgsqjgs43gsqjgs4Eg
4LKF4LKo4LOB4LKu4LKk4LK/4LK44LKy4LK+4LKX4LOB4LK14LOB4LKm4LK/4LKy4LON4LKyOiAl
MSRzABpM4LKm4LK/4LKo4LK+4LKC4LKV4LK14LKo4LON4LKo4LOBIOCyhuCyr+CzjeCyleCzhuCy
ruCyvuCyoeCysuCyvuCyl+Cyv+CypuCzhgAVPeCypuCyv+CyqOCyvuCyguCyleCyteCyqOCzjeCy
qOCzgSDgsobgsq/gs43gspXgs4bgsq7gsr7gsqHgsr8AO4CR4LKm4LK/4LKo4LK+4LKC4LKV4LK1
4LOBIOCyqOCyv+CysOCzgOCyleCzjeCyt+Cyv+CyuOCyv+CypiDgsrXgsrDgs43gsrfgsqYg4LK1
4LON4LKv4LK+4LKq4LON4LKk4LK/4LKv4LKo4LON4LKo4LOBIOCyruCzgOCysOCyv+CypuCzhiAl
MSRzIC0gJTIkcwANJeCyp+CzjeCyteCyqOCyvyDgsrngs4HgsqHgs4HgspXgsr7gsp8AJmrgsqjg
soLgsqTgsrDgsqYg4LK14LKw4LON4LK34LKX4LKz4LKo4LON4LKo4LOBIOCypOCzi+CysOCyv+Cy
uOCysuCzgSDgsrjgs43gspXgs43gsrDgsr7gsrLgs40g4LKu4LK+4LKh4LK/AA8r4LKo4LKu4LOC
4LKm4LK/4LK44LK/4LKmIOCypuCyv+CyqOCyvuCyguCylQAVMeCyqOCyruCzguCypuCyv+CyuOCy
v+CypiDgsqbgsr/gsqjgsr7gsoLgspU6ICUxJHMABQ/gsqjgsr/gsq7gsr/gsrcAFT3gsqjgsr/g
sq7gsr/gsrfgspfgsrPgsqjgs43gsqjgs4Eg4LKG4LKv4LON4LKV4LOG4LKu4LK+4LKh4LK/AAwk
4LKo4LK/4LKu4LK/4LK34LKX4LKz4LK14LKw4LOG4LKX4LOGAAkb4LKo4LK/4LKw4LK+4LKV4LKw
4LK/4LK44LK/AD+Aq+CyqOCyv+CysOCzgOCyleCzjeCyt+Cyv+CyuOCyv+CypiDgsqrgs43gsq/g
sr7gsp/gsrDgs43gsqjgs43igIzgsqjgs4rgsoLgsqbgsr/gspfgs4Yg4LKm4LK/4LKo4LK+4LKC
4LKVIOCyueCziuCyguCypuCyvuCyo+Cyv+CyleCzhuCyr+CyvuCyl+CzgeCypOCzjeCypOCyv+Cy
suCzjeCysjogJTEkcwARMeCyqOCzjeCyr+CyvuCyteCyv+Cyl+Czh+CytuCyqOCzjeKAjCDgsq7g
s4bgsqjgs4EAGkrgsqjgs43gsq/gsr7gsrXgsr/gspfgs4fgsrfgsqjgs43igIwg4LKu4LOG4LKo
4LOBIOCyruCzgeCymuCzjeCymuCyv+CysOCyvwAcTuCyquCyoOCzjeCyryDgsofgsqjgs43igIzg
sqrgs4Hgsp/gs40g4LKu4LOL4LKh4LON4oCM4LKX4LOGIOCyrOCypuCysuCyv+CyuOCyvwAOJuCy
quCyvuCyquCzjS3gsoXgsqrgs40g4LK14LK/4LKC4LKh4LOLAA0n4LKq4LON4LKw4LKX4LKk4LK/
4LKv4LKy4LON4LKy4LK/4LKm4LOGABhG4LKq4LON4LKw4LK24LON4LKo4LOG4LKv4LKo4LON4LKo
4LOBIOCypOCzhuCysOCyteCzgeCyl+CziuCys+Cyv+CyuOCyvwAUOuCyquCzjeCysOCytuCzjeCy
qOCzhuCyr+CyqOCzjeCyqOCzgSDgsrjgsrLgs43gsrLgsr/gsrjgsr8AEzfgsqrgs43gsrDgsrbg
s43gsqjgs4bgsq/gsqjgs43gsqjgs4Eg4LK54LOB4LKh4LOB4LKV4LK/ABQu4LKq4LON4LKw4LK4
4LON4LKk4LOB4LKkIOCyhuCyr+CzjeCyleCzhjogJTEkcwAGEuCyrOCypuCysuCyv+CyuOCyvwAU
OuCyreCyvuCyl+CytuCygyDgsqrgsrDgs4DgspXgs43gsrfgsr/gsrjgsrLgsr7gspfgsr/gsqbg
s4YAJmrgsq7gs4HgsoLgsqbgsr/gsqgg4LKk4LK/4LKC4LKX4LKz4LKo4LON4LKo4LOBIOCypOCz
i+CysOCyv+CyuOCysuCzgSDgsrjgs43gspXgs43gsrDgsr7gsrLgs40g4LKu4LK+4LKh4LK/ABY+
4LKu4LOB4LKC4LKm4LK/4LKoIOCypOCyv+CyguCyl+Cys+Cyv+Cyl+CzhiDgsqzgsqbgsrLgsr/g
srjgsr8ACBjgsq7gs4Hgspfgsr/gsqbgsr/gsqbgs4YAF0Hgsq7gs4fgsrLgspXgs43gspXgs4Yg
4LKo4LON4LKv4LK+4LK14LK/4LKX4LOH4LKf4LONIOCyruCyvuCyoeCyvwALH+Cyr+CyvuCyteCz
geCypuCzgiDgsoXgsrLgs43gsrIACRvgsrXgspzgsr7gspfgs4rgsrPgsr/gsrjgsr8AGETgsrXg
srDgs43gsrfgsqYg4LKq4LK/4LKV4LKw4LONIOCyl+Czi+CymuCysOCyv+CyuOCzgeCypOCzjeCy
pOCypuCzhgAcTuCyteCysOCzjeCyt+CyteCyqOCzjeCyqOCzgSDgsobgsq/gs43gspXgs4Yg4LKu
4LK+4LKh4LKy4LOBIOCyrOCypuCysuCyv+CyuOCyvwAOKuCyteCyv+CyuOCzjeCypOCysOCyv+Cy
uOCysuCyvuCyl+Cyv+CypuCzhgAGEuCyteCzgOCyoeCyv+Cyr+CzigAPLeCyteCzjeCyr+CyvuCy
quCzjeCypOCyv+Cyr+CysuCzjeCysuCyv+CypuCzhgANJeCytuCzgOCyn+CzjSDgsq7gs4Hgsprg
s43gsprgsr/gsrDgsr8ADSXgsrbgs43gsrDgs4fgsqPgsr/gsq8g4LKF4LKC4LKk4LON4LKvAA8r
4LK24LON4LKw4LOH4LKj4LK/4LKvIOCyquCzjeCysOCyvuCysOCyguCyrQASNOCyuOCyruCyr+Cy
teCyqOCzjeCyqOCzgSDgsobgsq/gs43gspXgs4bgsq7gsr7gsqHgsr8AGkrgsrjgsrLgsrngs4bg
spfgsrPgsqjgs43gsqjgs4Eg4LKV4LOG4LKz4LKX4LOGIOCyqOCzgOCyoeCysuCyvuCyl+Cyv+Cy
puCzhgAnbeCyueCyv+CyguCypuCyv+CyqCDgsqTgsr/gsoLgspfgsrPgsqjgs43gsqjgs4Eg4LKk
4LOL4LKw4LK/4LK44LKy4LOBIOCyuOCzjeCyleCzjeCysOCyvuCysuCzjeKAjCDgsq7gsr7gsqHg
sr8AFj7gsrngsr/gsoLgsqbgsr/gsqgg4LKk4LK/4LKC4LKX4LKz4LK/4LKX4LOGIOCyrOCypuCy
suCyv+CyuOCyvwAocOCyueCyv+CyguCypuCyv+CyqCDgsrXgsrDgs43gsrfgspfgsrPgsqjgs43g
sqjgs4Eg4LKk4LOL4LKw4LK/4LK44LKy4LOBIOCyuOCzjeCyleCzjeCysOCyvuCysuCzjeKAjCDg
sq7gsr7gsqHgsr8ABhLgsrngs4HgsqHgs4HgspXgsr8ABxXgsrngs4HgsqHgs4HgspXgsr/igKYA
F0Hgsrngs4vgsq7gs43igIzgspfgs4Yg4LKo4LON4LKv4LK+4LK14LK/4LKX4LOH4LKf4LONIOCy
ruCyvuCyoeCyvwAWPuCyueCzjeCyr+CyvuCyguCyoeCysuCzjSDgsqHgs43gsrDgs43gsq/gsr7g
spfgs40g4LKu4LK+4LKh4LK/AAoOJTEkZCDRhdGD0LLRjC4ACAslMSRkINGG0LDQswASHSUxJHMg
0L7QvSDRgNGD0YMg0YjQuNC70LbQuNGFABAcJXMt0YLQsNC5INGF0YPQstCw0LDQu9GG0LDRhQAM
F9CQ0L/Qv9GL0LMg0YHQvtC90LPQvtGFAAkS0JDRgdCw0LDQu9GC0YLQsNC5AA8d0JDRgdGD0YPQ
u9Cz0LAg0LDRgNC40LvQs9Cw0YUADhvQkNGB0YPRg9C70LPQsCDQuNC70LPRjdGN0YUABw7QkdCw
0LnRhdCz0q/QuQAGDNCR0L7Qu9GB0L7QvQALFdCR0YPRgNGD0YMg0L7RgNC+0LvRggANGdCR0YPR
gdCw0LQg0YHQvtC90LPQvtC70YIABw7QkdGD0YPQu9Cz0LDRhQANGdCR0q/Qs9C00LjQudCzINGF
0LDRgNCw0YUAL1nQlNCw0YDQsNCw0LPQuNC50L0g0LbQuNC70q/Sr9C00LjQudCzINGF0LDRgNGD
0YPQu9Cw0YXRi9C9INGC0YPQu9C0INCz0q/QudC70LPRjdC90Y0g0q/SrwAZL9CU0LDRgNCw0LDQ
s9C40LnQvSDRgdCw0YAg0LvRg9GDINOp06nRgNGH0LvTqdGFACtR0JTQsNGA0LDQsNCz0LjQudC9
INGB0LDRgNGL0LMg0YXQsNGA0YPRg9C70LDRhdGL0L0g0YLRg9C70LQg0LPSr9C50LvQs9GN0L3R
jSDSr9KvABMl0JTQsNGA0LDQsNGF0YLQsNC5INGF0YPQstCw0LDQu9GG0LDRhQAWKtCU0L7QvtC0
INGF0q/RgdC90Y3Qs9GC0LjQudCzINC00Y3Qu9Cz0Y3RhQAUJtCU0L7QvtC0INGF0q/RgdC90Y3Q
s9GC0LjQudCzINGF0LDQsNGFABYq0JTQvtC+0LQg0YXSr9GB0L3RjdCz0YLQuNC50LMg0YXRg9GA
0LDQsNGFABAf0JTQvtC+0YDRhSDQt9Op0LLQu9Op0LzQttKv0q/QtAAWKtCU0YPRg9C00LvQsNCz
0LAg0YXQuNC50LPQtNGN0LYg0LHQsNC50L3QsAAMF9CU0YPRg9GB0LDRhSDQvtCz0L3QvtC+AAoT
0JTRg9GD0YIg0YXQsNC50LvRggAIENCU0Y3Qu9Cz0Y3RgdGN0L0ACxXQlNGN0Y3RiCDRiNC40LvQ
ttC40YUAFSfQltC40Lsg0YHQvtC90LPQvtGFINGA0YPRgyDRgdGN0LvQs9GN0YUABw7Ql9Op0LLQ
u9Op0LzQtgAQH9CX06nQstC706nQvNC2INGF0LDRgNGD0YPQu9Cw0YUAGCnQl9Op0LLRiNOp06nR
gNOp06nQs9Kv0Lkg0L7Qs9C90L7QvjogJTEkcwAIENCY0JTQrdCS0KXQk9Ku0JkACBDQmNCU0K3Q
ktCl0KLQrdCZAA4b0JjRgNGB0Y3QvSDQtNGD0YPQtNC70LDQs9CwAB030JjRgNGB0Y3QvSDQtNGD
0YPQtNC70LDQs9GL0LMg0YXQsNGA0YPRg9C70LYg0LHQsNC50L3QsAAhPtCa0LDQu9C10L3QtNCw
0YDQuNC50L0g0L7RgNC+0YUg0LPQvtGA0LjQvCDRgNGD0YMg0YHRjdC70LPRjdGFAAUJ0JzQtdGC
0LArAAUK0JzQuNC90YPRggAQHtCc0LjQvdGD0YIg0YHQvtC90LPQvtC90L4g0YPRgwAOG9Cc0YPQ
ttC40LnQvSDRgtOp0LPRgdCz06nQuwAMF9Cc0YPQttC40LnQvSDRjdGF0LvRjdC7AA0Z0J3QsNCy
0LjQs9Cw0YbRi9C9INGG0Y3RgQAVKNCd0LDQstC40LPQsNGG0YvQvSDRhtGN0YHQuNC50LMg0YXQ
sNCw0YUAFyvQndKv0q/RgCDRhdGD0YPQtNCw0YEg0YPRgNGD0YMg0YjQuNC70LbQuNGFAAUK0J7Q
s9C90L7QvgAwVdCe0LPQvdC+0L4g0L3RjCDRgtC+0L7RhtC+0L7Qu9GB0L7QvSDRhdGN0Y3RgtGN
0Lkg0YLQsNCw0YDQsNGF0LPSr9C5INCx0LDQudC90LA6ICUxJHMADRnQntCz0L3QvtC+INC+0YDR
g9GD0LvQsNGFAAwX0J7Qs9C90L7QviDRgdC+0L3Qs9C+0YUAFiXQntC00L7QvtCz0LjQudC9INGB
0L7QvdCz0L7Qu9GCOiAlMSRzABkv0J7QvSDRgdC+0L3Qs9C+0LPRhyDRhdCw0YDQsNCz0LTQsNC2
INCx0LDQudC90LAAToCQ0J7QvSDRgdC+0L3Qs9C+0YXRi9C9INGC0YPQu9C0INGI0YPQtNGA0LDR
hSDRjdGB0LLRjdC7INOp0LTTqdGAINGB0L7QvdCz0L7RhSDRgNGD0YMg0LHRg9GG0LDQsNC2INGB
0Y3Qu9Cz0Y3RhdC40LnQvSDRgtGD0LvQtCDRgtC+0LLRiNC40L3QviDRg9GDAA4b0J7RgNGD0YPQ
u9GB0LDQvSDQvtCz0L3QvtC+ABQh0J7RgNGD0YPQu9GB0LDQvSDQvtCz0L3QvtC+OiAlMSRzAAoT
0J/QvtC/0LDQvyDRhtC+0L3RhQAJEtCh0L7QvdCz0L7QvtCz0q/QuQAIENCh0L7QvdCz0L7RgdC+
0L0ADhvQodC+0L3Qs9C+0YHQvtC9INC+0LPQvdC+0L4ABgzQodGN0LvQs9GN0YUAAwbQotCw0LEA
BgzQotCw0YHQu9Cw0YUACRLQotCw0YLQs9Cw0LvQt9Cw0YUAHjjQotC10LrRgdGCINC+0YDRg9GD
0LvQsNGFINCz0L7RgNC40Lwg0YDRg9GDINGB0Y3Qu9Cz0Y3RhQAuTNCi0L7QvtGG0L7QvtC70YHQ
vtC9INC+0L3RiyAlMSRzIC0gJTIkcyDQvNGD0LbQsNCw0YEg0LPQsNGA0YHQsNC9INC+0LPQvdC+
0L4AChPQo9C90LDQtNCw0LMg0YbRjdGBAAsW0KPQvdGC0YDQsNCw0LvRgtGC0LDQuQAGC9Ck0YPQ
vdC60YYrAAQI0KXQsNC50YUADBfQpdCw0LnRhSDQsNGB0YPRg9C70LPQsAAFC9Cl0LDQudGF4oCm
AA0Z0KXQsNGA0LjQu9GG0LDRhSDRhtC+0L3RhQAIENCl0LDRgNC40YPQu9Cw0YUAJkjQpdGD0LPQ
sNGG0LDQsNC90Ysg0LjQvdGC0LXRgNCy0LDQu9GL0L0g0L7RgNC+0LvRgiDQsdGD0YDRg9GDINCx
0LDQudC90LAACBDQpdGD0YDQsNCw0YHQsNC9ABUp0KXRjdGB0Y3Qs9GH0LvRjdC9INGC0Y3QvNC0
0Y3Qs9C70Y3RgdGN0L0ADhvQpdKv0YDRjdGN0L3QtCDQsdCw0LnQs9Cw0LAADx3QpdKv0YHQvdGN
0LPRgtC40LnQsyDRhdCw0LDRhQADBtCm0LDQswAKE9Cm0LDQsyDRgdC+0L3Qs9C+0YUABAfQptGN
0YErAAwX0KfQuNGA0Y3RhSDQsdCw0YDQuNGD0LsABQnQqNC40YTRgisACxXQrdGF0LvRjdGFINC+
0LPQvdC+0L4AAwbQt9Cw0LkADBfQvNC40L3Rg9GC0YvQvSDRgtGD0YDRiAAHDtC+0YDRg9GD0LvQ
sNGFAAYM0YPRgdGC0LPQsNGFAAsV0YbQsNCz0LjQudC9INGC0YPRgNGIAAIE0q7QpQALFdKu0Lsg
0YXRjdGA0Y3Qs9GB0Y3RhQAPHdKu0YDQs9GN0LvQttC40LvQtiDQsdCw0LnQvdCwAAIE0q7TqAAe
N9Ku06gg0Y3RgdCy0Y3QuyDSrtClINGN0YHRjdGF0LjQudCzINGB0L7QvdCz0L7QvdC+INGD0YMA
K1HTqNC80L3TqdGFINC20LjQu9Kv0q/QtNC40LnQsyDRhdCw0YDRg9GD0LvQsNGF0YvQvSDRgtGD
0LvQtCDQs9Kv0LnQu9Cz0Y3QvdGNINKv0q8AFSfTqNC80L3TqdGFINGB0LDRgCDQu9GD0YMg06nT
qdGA0YfQu9Op0YUAJ0nTqNC80L3TqdGFINGB0LDRgNGL0LMg0YXQsNGA0YPRg9C70LDRhdGL0L0g
0YLRg9C70LQg0LPSr9C50LvQs9GN0L3RjSDSr9KvAAcO06jQvdOp06nQtNOp0YAABQclMSRk67aE
AAgOJTEkZOyLnCDsoJXqsIEABgolMSRk7Iuc6rCEAAcNJTEkZO2NvOyEvO2KuAAKFCUxJHPrhYTs
nLzroZwg7J2064+ZAAkRJXPqs7wo7JmAKSDqs7XsnKAAAgbqsbDsoIgAAgbqsoDsg4kABQnqsoDs
g4kuLi4AAwnqsoDsg4nslrQABxPqsoDsg4nslrQg67O064K06riwAAYQ6rKA7IOJ7Ja0IOyCreyg
nAAGDuqzteycoCDrjIDsg4E6AAUL6riw6rCEKOu2hCkABg7quLDqsIQo7Iuc6rCEKQACBuq6vOyn
kAACBuuCoOynnAAFDeuCoOynnCDshKDtg50ABQ3rgqDsp5wg7J6F66ClAAgU64uk7J2MIOuLrOuh
nCDrs4Dqsr0AAgbri6vquLAABAzrjIDtmZTsg4HsnpAAEB7rjbDsnbTthLAg7ZeI7JqpIOyViCDr
kKg6ICUxJHMAHTnrjbDsnbTthLDqsIAg7JiI7IOBIOyXsOuPhCDrspTsnIQoJTEkc34lMiRzKeul
vCDrspfslrTrgqgAGTfrjbDsnbTthLDqsIAg7JiI7IOBIO2MqO2EtOqzvCDsnbzsuZjtlZjsp4Ag
7JWK7J2MOiAlMSRzAAMJ64+E7JuA66eQAAYQ64+E7JuA66eQIO2RnOyLnAADCeuPmeyYgeyDgQAG
EOuTnOuemOq3uCDtlbjrk6QABxPrk5zroa3ri6TsmrQg66mU64m0AAQK67KU7JyEIOuBnQAECuuy
lOychCDrgrQABQ3rspTsnIQg7Iuc7J6RAAED67aEAAQK67aEIOyEoO2DnQACBuyCrOyaqQAFDeyC
rOyaqSDspJHsp4AABxPshKDtg53rkJjsp4Ag7JWK7J2MAAMJ7ISg7YOd65CoAAYQ7ISg7YOd7ZWc
IOuCoOynnAAFDeyImOyLoCDsoITtmZQAChjsiJjsi6Ag7KCE7ZmUIOqygOyCrCDspJEAI1vsiqTs
mYDsnbTtlITtlZjsl6wg7Jew64+E66W8IOyEoO2Dne2VmOqxsOuCmCDtg63tlZjsl6wg64Kg7Kec
IOyEoO2DneycvOuhnCDrj4zslYTqsIDshLjsmpQuAAMJ7Iqk7JyE7LmYAA0h7Iqk7YGs66Gk7ZWY
7JesIOuLpOydjCDri6wg67O06riwAA0h7Iqk7YGs66Gk7ZWY7JesIOydtOyghCDri6wg67O06riw
AA4k7Iqk7YGs66Gk7ZWY7JesIOydtOyghCDsl7Drj4Qg67O06riwAA4k7Iqk7YGs66Gk7ZWY7Jes
IOydtO2bhCDsl7Drj4Qg67O06riwAAUP7Iqk7Y6Y7J207Iqk67CUAAIG7Iuc6rCEAAUN7Iuc6rCE
IOyEoO2DnQADCeyLnOyekeydvAAFDeyLnO2KuCDri6vquLAAChrslYTrnpjsnZgg7LaU7LKcIOqy
gOyDieyWtAAECuyVsSDshKDtg50AAgbsl4bsnYwACxvsl7Drj4Qg7ISg7YOdIOuPhOq1rCDtkZzs
i5wAChrsl7Drj4Qg7ISg7YOd7Jy866GcIOyghO2ZmAACBuyYpOuKmAACBuyYpOyghAAQKOyYpOyg
hCDrmJDripQg7Jik7ZuE66W8IOyEoO2Dne2VmOyEuOyalC4AAgbsmKTtm4QAAgbsmYTro4wABQ3s
nITroZwg7J2064+ZAAUN7J2M7ISxIOqygOyDiQAIFOydtOyghCDri6zroZwg67OA6rK9AAYQ7J28
67aAIOyEoO2DneuQqAAHE+yeheugpeydtCDsnpjrqrvrkKgABhDsnoXroKXtlZwg64Kg7KecAAwW
7J6F66Cl7ZWcIOuCoOynnDogJTEkcwAJF+yemOuqu+uQnCDquLDqsIQg7J6F66ClAAUN7KCE7LK0
IOuztOq4sAAFDeyghO2ZlCDrgYrquLAAAgbsoJHquLAAAgbsoJHtnpgAAwnsooXro4zsnbwABArs
p4Ttlokg7KSRAAgU7KeE7ZaJIOykkeyduCDthrXtmZQABQ3stpTqsIAg7Ji17IWYAA0h7LqY66aw
642UIOyeheugpSDrqqjrk5zroZwg7KCE7ZmYAAIG7Lyc7KeQAAUN7YOQ7IOJIOuplOuJtAAIFO2D
kOyDiSDrqZTribQg64ur6riwAAED7YOtAA0h7YWN7Iqk7Yq4IOyeheugpSDrqqjrk5zroZwg7KCE
7ZmYAAIG7Ya17ZmUAAQK7Yyd7JeFIOywvQACBu2OvOy5qAAIFO2VmOuLqCDsi5ztirgg64ur6riw
AAgU7ZWY64uoIOyLnO2KuCDsoJHquLAACRftlZjri6gg7Iuc7Yq4IO2OvOy5mOq4sAANGe2YhOye
rCDshKDtg53sgqztla06ICUxJHMABhDtmYjsnLzroZwg7J2064+ZAAwaJTEkZCDguorgurvgu4jg
uqfgu4LguqHguocACRElMSRkIOC6meC6suC6l+C6tQAOHiUxJGQg4LuA4Lqb4Lq14oCL4LuA4LqK
4Lqx4LqZLgAIDiUxJGQg4LuC4Lqh4LqHABEz4LqB4Lqn4LqU4Lqq4Lqt4Lqa4Lqa4Lqy4LqH4Lqq
4LuI4Lqn4LqZ4LuB4Lql4LuJ4LqnAAwk4LqB4Lqx4Lqa4LuE4Lqb4Luc4LuJ4Lqy4Lqr4Lq84Lqx
4LqBABY24LqB4Lqy4LqZ4LuA4Lql4Lq34Lqt4LqB4Lqb4Lqx4LqU4LqI4Lq44Lqa4Lqx4LqZOiAl
MSRzABM54LqB4Lqy4LqZ4LuB4LqZ4Lqw4LqZ4Lqz4Lqi4Lq54LuI4LqC4LuJ4Lqy4LqH4Lql4Lq4
4LuI4LqhABU/4LqB4Lqz4Lql4Lqx4LqH4LqB4Lqn4LqU4Lqq4Lqt4Lqa4Lqq4Lqy4LqN4LuC4LqX
4LuA4LqC4Lq74LuJ4LqyABI24LqB4Lqz4oCL4Lql4Lqx4LqH4oCL4LqU4Lqz4oCL4LuA4LqZ4Lq1
4LqZ4oCL4LqB4Lqy4LqZAAoe4LqB4LuI4Lqt4LqH4LuC4LqV4LuJ4LqV4Lqt4LqaAAgY4LqB4LuI
4Lqt4LqZ4LqX4LuI4Lq94LqHABAw4LqC4Lqw4Lqr4LqN4Lqy4LqN4LqK4Lq14LqU4Lql4Lq44LuI
4Lqh4Lqq4Lq44LqUAAoe4LqC4Lqw4Lqr4LqN4Lqy4LqN4LuB4Lql4LuJ4LqnABxU4LqC4LuN4LuJ
4Lqh4Lq54LqZ4LqX4Lq14LuI4Lqb4LuJ4Lqt4LqZ4LuA4LqC4Lq74LuJ4Lqy4Lqa4LuN4LuI4LqW
4Lq34LqB4LqV4LuJ4Lqt4LqHAA0n4LqE4Lqz4Lqq4Lqz4Lql4Lqx4Lqa4LqE4Lq74LuJ4LqZ4Lqr
4LqyAAcV4LqE4Lqz4LuB4LqZ4Lqw4LqZ4LqzAAUP4LqK4Lqt4LqB4Lqr4LqyAAwk4LqK4Lqt4LqB
4Lqr4Lqy4LqU4LuJ4Lqn4LqN4Lqq4Lq94LqHAAYS4LqK4Lqt4LqB4Lqr4Lqy4oCmAAcV4LqK4Lq7
4LuI4Lqn4LuC4Lqh4LqHAAcV4LqN4Lqw4Lqr4Lqn4LuI4Lqy4LqHABEz4LqV4Lq74Lqn4LuA4Lql
4Lq34Lqt4LqB4LuA4Lqe4Lq14LuI4Lqh4LuA4LqV4Lq14LqhAAQM4LqZ4Lqy4LqX4Lq1ABAm4LqZ
4Lqz4LqX4Lqy4LqH4LuE4Lqb4Lqr4Lqy4Lqb4Lq1ICUxJHMACh7guprgu4jguq3gupnguojgurHg
uprguqXgurLguoEABQ/guprgu43gu4jguqHgurUACyHguprgu43gu4jgu4TgupTgu4ngu4DguqXg
urfguq3guoEABxXgupvgurDgupXgurTgu4DguqrgupQANICY4Lqb4Lqx4LqU4LuA4Lqe4Lq34LuI
4Lqt4LuA4Lql4Lq34Lqt4LqB4Lqb4Lq1IOC6q+C6vOC6tyDgu4HgupXgurDgu4Dgup7gurfgu4jg
uq3guqrgurDguqvgurzgurHguprguoHgurHguprgu4TgupvguqvgurLguoHgurLgupngu4DguqXg
urfguq3guoHguqfgurHgupkAAwngupvgurTgupQABhLgupvgurTgupTguorgurXgupQAEDDgupvg
urTgupTguorgurXgupTguqXgurjgu4jguqHguqrgurjgupTgu4Tguqfgu4kABhLgupvgurTgupTg
u4Tguqfgu4kAEzngupvgurTgupTigIvgu4DguqHigIvgupngurnguoHgurLgupnigIvgupngurPi
gIvgupfgurLguocABxXgupvgurjgu4jguqHguoHgurvgupQAEjbgupvgu4jgur3gupngu4Dgupvg
urHgupngu4DgupTgurfguq3gupngupXgu43gu4jgu4TgupsAEzngupvgu4jgur3gupngu4Dgupvg
urHgupngu4DgupTgurfguq3gupngupzgu4jgurLgupnguqHgurIADSfgupvgu4jgur3gupngu4Tg
upvgu4DguqXgurfguq3guoHgupvgurUADSfgupvgu4nguq3gupnguqfgurHgupngupfgurXgu4Hg
uqXgu4nguqcAEy3gupvgu4nguq3gupnguqfgurHgupngupfgurXgu4HguqXgu4nguqc6ICUxJHMA
BhLguqHgurfgu4ngupngurXgu4kACRvguqLgurngu4jgu4Pgupngu4TguqXguo3gurAAAwnguqXg
urbgupoADy3guqXgurbguprguoLgu43gu4nguoTguqfgurLguqHguorguq3guoHguqvgurIABQ/g
uqfgurHgupngupfgurUAGDzguqfgurHgupngupfgurXgupfgurXgu4jguprgu43gu4jguq3gurDg
upngurjguo3gurLgupQ6ICUxJHMAEDDguqfgurHgupngupfgurXgupfgurXgu4jgu4DguqXgurfg
uq3guoHgu4Tguqfgu4kAI13guqfgurHgupngupfgurXguprgu43gu4jguoHgurvguofguoHgurHg
uprguq7gurnguprgu4HguprguprgupfgurXgu4jguoTgurLgupTgu4Tguqfgu4k6ICUxJHMAJlrg
uqfgurHgupngupfgurXguqLgurngu4jgupnguq3guoHgu4TguqXguo3gurDgupvgurXgupfgurXg
u4jguoTgurLgupTgu4Tguqfgu4kgJTEkcyAtICUyJHMADCTguqfgurHgupngupfgurXguqrgurTg
u4ngupnguqrgurjgupQADirguqfgurHgupngupfgurXgu4DguqXgurXgu4jguqHgupXgurvgu4ng
upkABhLguqfgurLguofguqrgurLguo0ABhLguqfgurTgupTgurXgu4Lguq0AGUvguqrgurDguqvg
urzgurHguprgu4Tgupvgu4Pguorgu4ngu4Lgu53gupTgupvgu4nguq3gupnguoLgu43gu4nguoTg
uqfgurLguqEAH13guqrgurDguqvgurzgurHguprgu4Tgupvgu4Pguorgu4ngu4Lgu53gupTgupvg
u4nguq3gupnguoLgu43gu4nguqHgurngupngupvgurDgupXgurTgupfgurTgupkADCTguqrgurDg
u4HgupTguofguoTgurPgu4HgupngurDgupngurMADy3guqrgurDgu4HgupTguofgupXgurvguqfg
u4DguqXgurfguq3guoHgupvgurUACBjguqrgurLguo3gu4Lgupfguq3guq3guoEACh7guqrgurLg
uo3gu4Lgupfgu4DguoLgurvgu4ngurIADCTguqrgurPguqXgurHguprguorgurvgu4jguqfgu4Lg
uqHguocACRvguqrgurPguqXgurHguprgupngurLgupfgurUACyHguqrgurTgu4ngupnguqrgurjg
upTgu4TguqXguo3gurAACh7guqrgurvgu4jguofguoLgu43gu4nguqHgurngupkAETPguqvguo3g
u43gu4nguorgurXgupTguqXgurjgu4jguqHguqrgurjgupTguqXgurvguocABxXguqvguo3gu43g
u4nguqXgurvguocACBjguqvguo3gu43gu4ngu4HguqXgu4nguqcACBjguqvgurzgurHguofgupfg
u4jgur3guocAGUvguq3gurTgupngup7gurjgupTgu4TguqXguo3gurDguqfgurHgupngupfgurXg
uprgu43gu4jgupbgurfguoHgupXgu4nguq3guocABhLguq7gurHguprguqrgurLguo0ACyHgu4Dg
uprgurTgu4jguofgupfgurHguofgu53gurvgupQABAzgu4DgupvgurXgupQADCTgu4DguqHgupng
urnguoHgurLgupngupngurPgupfgurLguocAEDDgu4DguqHgupngurngu4Hguprguprgu4DguqXg
urfgu4jguq3gupnguqXgurvguocADSfgu4DguqXgurXgu4jguqHgupXgurvgu4ngupngu4TguqXg
uo3gurAAGkrgu4DguqXgurfguq3guoHguoHgu4jguq3gupngupfgu4jgur3guocg4Lqr4Lq84Lq3
IOC6q+C6vOC6seC6h+C6l+C7iOC6veC6hwAMJOC7gOC6peC6t+C6reC6geC6iuC6u+C7iOC6p+C7
guC6oeC6hwAJG+C7gOC6peC6t+C6reC6geC6meC6suC6l+C6tQAKHuC7gOC6peC6t+C6reC6geC6
p+C6seC6meC6l+C6tQAJG+C7gOC6peC6t+C6reC6geC7geC6peC7ieC6pwAJG+C7gOC6peC6t+C6
reC6geC7geC6reC6seC6mgAOKuC7gOC6peC6t+C7iOC6reC6meC6guC6tuC7ieC6meC7gOC6l+C6
tOC6hwAcVOC7gOC6peC6t+C7iOC6reC6meC7gOC6nuC6t+C7iOC6reC6quC6sOC7geC6lOC6h+C6
m+C6teC6geC7iOC6reC6meC7nOC7ieC6suC6meC6teC7iQAcVOC7gOC6peC6t+C7iOC6reC6meC7
gOC6nuC6t+C7iOC6reC6quC6sOC7geC6lOC6h+C6m+C6teC6q+C6vOC6seC6h+C6iOC6suC6geC6
meC6teC7iQAcVOC7gOC6peC6t+C7iOC6reC6meC7gOC6nuC6t+C7iOC6reC6quC6sOC7geC6lOC6
h+C7gOC6lOC6t+C6reC6meC6geC7iOC6reC6meC7nOC7ieC6sgAaTuC7gOC6peC6t+C7iOC6reC6
meC7gOC6nuC6t+C7iOC6reC6quC6sOC7geC6lOC6h+C7gOC6lOC6t+C6reC6meC6leC7jeC7iOC7
hOC6mwADCeC7geC6luC6mgAKHuC7geC6muC7iOC6h+C6m+C6seC6meC6geC6seC6mgAOJOC7geC6
muC7iOC6h+C6m+C6seC6meC6lOC7ieC6p+C6jSAlcwAFD+C7geC6peC7ieC6p+C7hgAIGOC7g+C6
quC7iOC6p+C6seC6meC6l+C6tQAMJOC7nOC7ieC6suC6iOC7jeC6m+C6seC6reC6muC6reC6seC6
mgAICCUxJGQgJSUuAAsLJTEkZCBtaW51dGUABwdBQ1RJVkFUAAsNQWZpyJlhyJtpIHRvdAAbHUFm
aciZZWF6xIMgYmFsb251bCBleHBsaWNhdGl2ABMVQWxlZ2XIm2kgbyBhcGxpY2HIm2llAAsLQXBl
bCBwcmltaXQAExZBcGVsIMOubiBkZXNmxIPImXVyYXJlAAMDQXppABAQQmFsb24gZXhwbGljYXRp
dgAOEEJpZmF0xIMgcGFyyJtpYWwABQZDYXV0xIMABgdDb211dMSDACkqQ29tdXTEgyBsYSBtb2R1
bCBkZSBpbnRyb2R1Y2VyZSBhIHRleHR1bHVpACosQ29tdXTEgyBsYSBtb2R1bCBkZSBpbnRyb2R1
Y2VyZSDDrm4gY2FsZW5kYXIAGxxDb211dMSDIGxhIHNlbGVjdGFyZWEgYW51bHVpAA4QQ8SDdXRh
cmUgdm9jYWzEgwAHCUPEg3V0YcibaQAIDEPEg3V0YcibaeKApgAKCkRFWkFDVElWQVQAEBFEYXRh
IGRlIMOubmNlcGVyZQAREkRhdGEgZGUgw65uY2hlaWVyZQAyNURhdGEgZXN0ZSDDrm4gYWZhcmEg
aW50ZXJ2YWx1bHVpIGRlIGFuaSAlMSRzIOKAkyAlMiRzAA4PRGF0YSBpbnRyb2R1c8SDABQVRGF0
YSBpbnRyb2R1c8SDOiAlMSRzACssRGF0YSBudSBjb3Jlc3B1bmRlIG1vZGVsdWx1aSBhyJl0ZXB0
YXQ6ICUxJHMAGhtEYXRhIG51IGVzdGUgcGVybWlzxIM6ICUxJHMADg9EYXRhIHNlbGVjdGF0xIMA
BAVEYXTEgwAmKERlcnVsZWF6xIMgcGVudHJ1IGEgYWZpyJlhIGFuaSBhbnRlcmlvcmkAJihEZXJ1
bGVhesSDIHBlbnRydSBhIGFmaciZYSBhbmkgdWx0ZXJpb3JpACgrRGVydWxlYXrEgyBwZW50cnUg
YSBhZmnImWEgbHVuYSBhbnRlcmlvYXLEgwAnKkRlcnVsZWF6xIMgcGVudHJ1IGEgYWZpyJlhIGx1
bmEgdXJtxIN0b2FyZQAKCkRlemFjdGl2YXQAHx9FeHRpbmRlIGZvYWlhIGRpbiBwYXJ0ZWEgZGUg
am9zAAYGRXh0aW5zABARRmVyZWFzdHLEgyBwb3AtdXAABAVGaWzEgwAEBkbEg3LEgwAEBEdhdGEA
ERFHaGlkYWogZGUgdHJhZ2VyZQBOT0dsaXNlYXrEgyBwZW50cnUgYSBzZWxlY3RhIHVuIGFuIHNh
dSBhdGluZ2UgcGVudHJ1IGEgcmV2ZW5pIGxhIHNlbGVjdGFyZWEgemlsZWkAKSlJbnRlcnZhbHVs
IGRlIGRhdGUgaW50cm9kdXMgbnUgZXN0ZSB2YWxpZAAQEUludHJhcmUgbmV2YWxpZMSDAA4OSW50
cm9kdSBkYXRlbGUAERJNYWkgbXVsdGUgb3DIm2l1bmkAERFNZW5pdSBkZSBuYXZpZ2FyZQAPD01l
bml1IGRyb3AtZG93bgAGBk1lbml1KwAeH05hdmlnYcibaSBsYSBlY3JhbnVsIGRlIHBvcm5pcmUA
DxFOYXZpZ2HIm2kgw65uIHN1cwAXGE5hdmlnaGVhesSDIGxhIGFudWwgJTEkcwAKCk5lc2VsZWN0
YXQAGBpPcMibaXVuZWEgc2VsZWN0YXTEgzogJTEkcwAICE9yYSAlMSRkAAMET3LEgwAICFJlc3Bp
bmdlACEiUmVzdHLDom5nZSBmb2FpYSBkaW4gcGFydGVhIGRlIGpvcwALDVJlc3Ryw6JuZ2XIm2kA
CAlSZXN0csOibnMACAlSxINzcHVuZGUAGxxTZSBmaWx0cmVhesSDIHVuIGFwZWwgcHJpbWl0AAgI
U2VsZWN0YXQAGBlTZWxlY3RlYXrEgyBhLm0uIHNhdSBwLm0uAA8QU2VsZWN0ZWF6xIMgZGF0YQAR
ElNlbGVjdGVhesSDIGRhdGVsZQATFFNlbGVjdGVhesSDIG1pbnV0ZWxlAA4PU2VsZWN0ZWF6xIMg
b3JhAB0dU2VsZWN0b3J1bCBkZSBhbiBlc3RlIHZpemliaWwAExVTZsOicsiZaXQgZGUgaW50ZXJ2
YWwAEBBTdWdlc3RpaSBtYWkgam9zABESVGVybWVuIGRlIGPEg3V0YXJlABgZVHJlY2kgbGEgbHVu
YSBhbnRlcmlvYXLEgwAXGFRyZWNpIGxhIGx1bmEgdXJtxIN0b2FyZQAVFlRyaW1pdGXIm2kgZm9s
b3NpbmQgJXMAFRZUcmltaXRlyJtpIGludGVyb2dhcmVhAAwNVHJpbWl0ZcibaSBsYQAVFnRpbXAg
ZGUgY8OidGV2YSBtaW51dGUADQ50aW1wIGRlIG8gb3LEgwAHCMOObiBjdXJzAAsMw45uIGludGVy
dmFsABMUw45uY2VwdXQgZGUgaW50ZXJ2YWwABwjDjm5jaGlkZQANDsOObmNoaWRlIGZvYWlhAB8g
w45uY2hpZGUgZm9haWEgZGluIHBhcnRlYSBkZSBqb3MAGhvDjm5jaGlkZSBtZW5pdWwgZGUgbmF2
aWdhcmUAFBbImHRlcmdlyJtpIGludGVyb2dhcmVhAAsLJTEkZCBtaW51dGEACAklMSRkIG9yw6sA
Dg8lMSRkIHDDq3IgcWluZC4ABQVBS1RJVgAFBkFzbmrDqwANDUJyZW5kYSBycmV6ZXMADw9EYXRh
IGUgZmlsbGltaXQADAxEYXRhIGUgZnV0dXIAEhJEYXRhIGUgZnV0dXI6ICUxJHMADw9EYXRhIGUg
bWJhcmltaXQADw9EYXRhIGUgemdqZWRodXIANThEYXRhIGphc2h0w6sgZGlhcGF6b25pdCB0w6sg
cHJpdHVyIHTDqyB2aXRpdCAlMSRzIC0gJTIkcwAWFkRhdGEgbnVrIGxlam9oZXQ6ICUxJHMALC1E
YXRhIG51ayBww6tycHV0aGV0IG1lIG1vdGl2aW4gZSBwcml0dXI6ICUxJHMABwdEaWFsb2d1ABMT
RG9yZXphIGUgenZhcnJpdGplcwAQEURyaXRhcmUga8OrcmN5ZXNlAA0ORMOrcmdvIHB5ZXRqZW4A
FBRGaWxsaW1pIGkgZGlhcGF6b25pdAASEkZ1bmRpIGkgZGlhcGF6b25pdAAKCkZ1bmtzaW9uaSsA
CQlGdXQgZGF0YXQAAwNIaXEAFBVIaXEgZmxldMOrbiBlIHBvc2h0bWUAEhJIeXJqZSBlIHBhdmxl
ZnNobWUAKSpIeXJqZSBlIHBhdmxlZnNobWUgZSBkaWFwYXpvbml0IHTDqyBkYXRhdmUABwdKT0FL
VElWAAcHSm9ha3RpdgArLEthbG8gdGUgbW9kYWxpdGV0aSBpICJIeXJqZXMgc8OrIGthbGVuZGFy
aXQiACgpS2FsbyB0ZSBtb2RhbGl0ZXRpIGkgIkh5cmplcyBzw6sgdGVrc3RpdCIAGxxLYWxvIHRl
IHpnamVkaGphIGUgbmrDqyB2aXRpAAwOS8OrcmtpbSBtZSB6w6sABQZLw6tya28ADQ5Lw6tya28g
cHlldGplbgAGCUvDq3Jrb+KApgATFkvDq3NoaWxsYSBww6tyIHZlZ2zDq24AJipMw6t2aXogcMOr
ciB0w6sgc2hmYXF1ciBtdWFqaW4gZSBhcmRoc2jDq20AJyxMw6t2aXogcMOrciB0w6sgc2hmYXF1
ciBtdWFqaW4gZSBtw6twYXJzaMOrbQAlKEzDq3ZpeiBww6tyIHTDqyBzaGZhcXVyIHZpdGV0IGUg
YXJkaHNobWUAJipMw6t2aXogcMOrciB0w6sgc2hmYXF1ciB2aXRldCBlIG3Dq3BhcnNobWUAAgJN
RAAFBU1ieWxsAAwNTWJ5bGwgZmxldMOrbgAYGU1ieWxsIG1lbnluw6sgZSBuYXZpZ2ltaXQAEhJN
ZW55amEgZSBuYXZpZ2ltaXQAFxlNZW55amEgbWUgbMOrc2hpbSBwb3NodMOrAAcHTWVueWphKwAU
FU5hdmlnbyBuw6sgdml0aW4gJTEkcwAICE5kYWplIG1lAAsLTmRhamUgbWUgJXMAGxxOZHJ5c2hv
IHRlIG11YWppIGkgYXJkaHNow6ttABkZTmRyeXNobyB0ZSBtdWFqaSBpIGthbHVhcgAGB05kw6ty
cm8ACwtOZ2ppdHUgbGFydAASFE51ayDDq3NodMOrIHpnamVkaHVyAAoLTsOrIHZhemhkaW0AEBFP
cHNpb25lIHTDqyB0amVyYQAXGk9yaWVudG9odSBww6tyIG7DqyBzaHTDq3BpAAICUEQABQVQYWxv
cwAWF1BhbG9zIGZsZXTDq24gZSBwb3NodG1lAA4OUGFzdHJvIHB5ZXRqZW4AFBZQamVzw6tyaXNo
dCBlIHNow6tudWFyACAjUG8gZmlsdHJvbiBuasOrIHRlbGVmb25hdMOrIGh5csOrc2UACQpQw6ty
Z2ppZ2p1ABESUMOrcnpnamlkaCBtaW51dGF0AAYGUmVmdXpvAFtjUnLDq3NocWl0IHNocGVqdCBw
w6tyIHTDqyB6Z2plZGh1ciBuasOrIHZpdCBvc2UgdHJva2l0IHDDq3IgdMOrIGthbHVhciBzw6ty
aXNoIHRlIHpnamVkaGphIGUgZGl0w6tzABodU2hmYXEga8Orc2hpbGxhdCBww6tyIHZlZ2zDq24A
DQ9TaGZhcSDDp2RvIGdqw6sAAwNTb3QAFBZTdWdqZXJpbWV0IG3DqyBwb3NodMOrABETVGVsZWZv
bmF0w6sgaHlyw6tzZQAVF1RlbGVmb25hdMOrIG7DqyB2YXpoZGltAAYGVSBrcnllAAcHVSBwYWxv
cwAJCVUgemdqZXJ1YQAWFlpnamVkaGphIGFrdHVhbGU6ICUxJHMACAhaZ2plZGh1cgAbHVpnamVk
aMOrc2kgaSB2aXRpdCBpIGR1a3Now6ttABcYWmdqZXJvIGZsZXTDq24gZSBwb3NodG1lAAwMWmdq
aWRoIGRhdGF0AAwNWmdqaWRoIGRhdMOrbgAVFlpnamlkaCBuasOrIGFwbGlrYWNpb24ACwxaZ2pp
ZGggb3LDq24AGxtaZ2ppZGggcGFyYWRpdGUgb3NlIHBhc2RpdGUACApoYXDDq3NpcsOrAAgIb3Jh
ICUxJGQACgtww6tyIG1pbnV0YQAHCXDDq3Igb3LDqwAOFSUxJGQg2YHZiiDYp9mE2YXYptipLgAZ
L9ij2K/Yp9ipINin2K7YqtmK2KfYsSDYp9mE2KPYudmI2KfZhSDZhdix2KbZitipAA4b2KXYr9iu
2KfZhCDYp9mE2KrZiNin2LHZitiuAA4a2KXYr9iu2KfZhCDYutmK2LEg2LXYp9mE2K0AGCzYpdiv
2K7Yp9mEINmG2LfYp9mCINiy2YXZhtmKINi62YrYsSDYtdin2YTYrQAPHNil2LHYs9in2YQg2LfZ
hNioINin2YTYqNit2KsADRnYpdi42YfYp9ixINin2YTYqtmE2YXZititAAUK2KXYutmE2KfZggAV
KNil2LrZhNin2YIg2KfZhNio2LfYp9mC2Kkg2KfZhNiz2YHZhNmK2KkADBfYpdi62YTYp9mCINin
2YTZiNix2YLYqQASItil2LrZhNin2YIg2YLYp9im2YXYqSDYp9mE2KrZhtmC2YQAEB7YpdmE2YrZ
gyDYp9mE2KfZgtiq2LHYp9it2KfYqjoABQrYpdmK2YLYp9mBAA8d2KfYrtiq2YrYp9ixINin2YTY
qtmI2KfYsdmK2K4ADhvYp9iu2KrZitin2LEg2KfZhNiv2YLYp9im2YIADRnYp9iu2KrZitin2LEg
2KfZhNiz2KfYudipAAwX2KfYrtiq2YrYp9ixINiq2KfYsdmK2K4ADBfYp9iu2KrZitin2LEg2KrY
t9io2YrZggAFCtin2YTYqNit2KsABw7Yp9mE2KrYp9ix2YrYrgAWKdin2YTYqtin2LHZitiuINin
2YTYsNmKINiq2YUg2KXYr9iu2KfZhNmHABAf2KfZhNiq2KfYsdmK2K4g2KfZhNmF2K3Yr9mO2ZHY
rwAcMtin2YTYqtio2K/ZitmEINil2YTZiSDZiNi22LkgItil2K/Yrtin2YQg2KfZhNmG2LUiACRB
2KfZhNiq2KjYr9mK2YQg2KXZhNmJINmI2LbYuSAi2KfZhNil2K/Yrtin2YQg2YHZiiDYp9mE2KrZ
gtmI2YrZhSIAEyTYp9mE2KrYqNiv2YrZhCDZhNin2K7YqtmK2KfYsSDYs9mG2KkAGC3Yp9mE2KrY
utmK2YrYsSDYpdmE2Ykg2KfZhNi02YfYsSDYp9mE2KrYp9mE2YoAGC3Yp9mE2KrYutmK2YrYsSDY
pdmE2Ykg2KfZhNi02YfYsSDYp9mE2LPYp9io2YIADxzYp9mE2KrZhtmC2YQg2KXZhNmJINij2LnZ
hNmJABEg2KfZhNiq2YjYrNmHINil2YTZiSDYp9mE2YXZhtiy2YQACA/Yp9mE2YLYp9im2YXYqSsA
BQrYp9mE2YrZiNmFACxS2KfZhtiq2YLZkNmEINmE2YTYo9iz2YHZhC/ZhNmE2KPYudmE2Ykg2YTY
pdi42YfYp9ixINin2YTYs9mG2YjYp9iqINin2YTYqtin2YTZitipLgAsUtin2YbYqtmC2ZDZhCDZ
hNmE2KPYs9mB2YQv2YTZhNij2LnZhNmJINmE2KXYuNmH2KfYsSDYp9mE2LPZhtmI2KfYqiDYp9mE
2LPYp9io2YLYqS4AKUzYp9mG2KrZgtmQ2YQg2YTZhNij2LPZgdmEL9mE2YTYo9i52YTZiSDZhNil
2LjZh9in2LEg2KfZhNi02YfYsSDYp9mE2KrYp9mE2YouAClM2KfZhtiq2YLZkNmEINmE2YTYo9iz
2YHZhC/ZhNmE2KPYudmE2Ykg2YTYpdi42YfYp9ixINin2YTYtNmH2LEg2KfZhNiz2KfYqNmCLgAD
Btio2K3YqwAID9io2K3YqyDYtdmI2KrZigAECdio2K3Yq+KApgAMF9io2K/Yp9mK2Kkg2KfZhNmG
2LfYp9mCAAoT2KjYr9mI2YYg2KrYp9ix2YrYrgAOG9iq2KfYsdmK2K4g2KfZhNin2YbYqtmH2KfY
oQALFdiq2KfYsdmK2K4g2KfZhNio2K/YoQAFCtiq2KjYr9mK2YQABQrYqti12LrZitixABUo2KrY
tdi62YrYsSDYp9mE2KjYt9in2YLYqSDYp9mE2LPZgdmE2YrYqQAFCtiq2YHYudmK2YQABQrYqtmE
2YXZititAAIE2KrZhQAhPNiq2YUg2YjYtti5INi52YTYp9mF2Kkg2YHZiiDYp9mE2YXYsdio2ZHY
uSDYqNi02YPZhCDYrNiy2KbZigAVKNiq2YjYs9mK2Lkg2KfZhNio2LfYp9mC2Kkg2KfZhNiz2YHZ
hNmK2KkAAwbYrdiw2YEACxXYrtmK2KfYsdin2Kog2KPZg9ir2LEABQrYr9mC2YrZgtipAAMG2LHY
r9mRAAMG2LHZgdi2AAQI2LPYp9i52KkAAQLYtQAHDdi32YTYqCDYqNit2KsACA/Yudix2LYg2KfZ
hNmD2YQACxXYudmE2KfZhdipINiq2KjZiNmK2KgACRHYutmK2LEg2YXYrdiv2ZHYrwAJEdi62YrY
sSDZhdmB2LnZkdmEAAQI2YHYttin2KEACRHZgdmKINin2YTZhti32KfZggAFCtmB2YrYr9mK2YgA
ChPZgtin2KbZhdipINiq2YbZgtmEAAwX2YLYp9im2YXYqSDZhdmG2LPYr9mE2KkACxXZgti32Lkg
2KfZhNin2KrYtdin2YQAChPZgtmK2K8g2KfZhNiq2YLYr9mFAAoT2YTZhdiv2Kkg2K/Zgtin2KbZ
ggAJEdmE2YXYr9ipINiz2KfYudipAAEC2YUABQrZhdit2K/ZkdivAA0Y2YXYrdmIINi32YTYqCDY
p9mE2KjYrdirAAoT2YXYsdio2ZHYuSDYrdmI2KfYsQA2YtmF2LHZkNmR2LEg2LPYsdmK2LnZi9in
INmE2KrYrdiv2YrYryDYudin2YXYjCDYo9mIINin2YbZgtixINmE2YTYsdis2YjYuSDYpdmE2Ykg
2KrYrdiv2YrYryDZitmI2YUuAAkR2YXYtNin2LHZg9ipINmF2LkADBTZhdi02KfYsdmD2Kkg2YXY
uSAlcwAGDNmF2LXYutmO2ZHYsQAFCtmF2YHYudmR2YQAChPZhdmC2KjYtiDYp9mE2LPYrdioAAwX
2YXZg9in2YTZhdipINis2KfYsdmK2KkADBfZhdmD2KfZhNmF2Kkg2YjYp9ix2K/YqQAGDNmF2YjY
s9mO2ZHYuQAMF9mG2KfZgdiw2Kkg2YXZhtio2KvZgtipAAwX2YbZh9in2YrYqSDYp9mE2YbYt9in
2YIAGC3Zitiq2YUg2YHYrdi1INin2YTZhdmD2KfZhNmF2Kkg2KfZhNmI2KfYsdiv2KkAJT/ZitmP
2LHYrNmJINin2K7YqtmK2KfYsSDYtSAo2LXYqNin2K3Zi9inKSDYo9mIINmFICjZhdiz2KfYodmL
KS4ACxLigI8lMSRkINiv2YLZitmC2KkAChDigI8lMSRkINiz2KfYudipABYm4oCP2KfZhNin2YbY
qtmC2KfZhCDYpdmE2Ykg2LnYp9mFICUxJHMAHjXigI/Yp9mE2KrYp9ix2YrYriDYp9mE2LDZiiDY
qtmFINil2K/Yrtin2YTZhzog4oCOJTEkcwAyVeKAj9in2YTYqtin2LHZitiuINiu2KfYsdisINmG
2LfYp9mCINin2YTYo9i52YjYp9mFINin2YTZhdiq2YjZgtmO2ZHYuTog4oCOJTEkcyAtICUyJHMA
HDHigI/Yp9mE2KrYp9ix2YrYriDYutmK2LEg2YXYs9mF2YjYrSDYqNmHOiDigI4lMSRzABUk4oCP
2KfZhNiq2K3Yr9mK2K8g2KfZhNit2KfZhNmKOiAlMSRzAAwU4oCP2KfZhNiz2KfYudipICUxJGQA
LE/igI/ZhNinINmK2KrZiNin2YHZgiDYp9mE2KrYp9ix2YrYriDZhdi5INin2YTZhtmF2Lcg2KfZ
hNmF2KrZiNmC2Y7Zkdi5OiDigI4lMSRzAAsMJTEkZMKgaGV1cmVzAA8QJTEkZMKgcG91ciBjZW50
LgAWGUFjY8OpZGVyIMOgIGwnYW5uw6llICUxJHMAFRVBZmZpY2hlciBsJ2luZm8tYnVsbGUAXGFC
YWxheWV6IGwnw6ljcmFuIHBvdXIgc8OpbGVjdGlvbm5lciB1bmUgYW5uw6llIG91IGFwcHV5ZXog
cG91ciByZXZlbmlyIMOgIGxhIHPDqWxlY3Rpb24gZCd1biBqb3VyABESQm/DrnRlIGRlIGRpYWxv
Z3VlAAcHQ2hhbmdlcgANDURhbnMgbGEgcGxhZ2UANTdEYXRlIGhvcnMgZGUgbGEgcGxhZ2UgZCdh
bm7DqWVzIGF0dGVuZHVlwqA6ICUxJHMgLSAlMiRzAAsLRGF0ZSBzYWlzaWUAEhNEYXRlIHNhaXNp
ZcKgOiAlMSRzABMURG9ubsOpZXMgaW5jb3JyZWN0ZXMAGhtEw6l2ZWxvcHBlciBsYSBib3R0b20g
c2hlZXQACAhFbiBjb3VycwAOD0ZlbsOqdHJlIHBvcC11cAAWFkZlcm1lciBsYSBib3R0b20gc2hl
ZXQAGxtGaWx0cmFnZSBkJ3VuIGFwcGVsIGVudHJhbnQABwdJZ25vcmVyAAoKSW5mby1idWxsZQAy
M0xhIGRhdGUgbmUgY29ycmVzcG9uZCBwYXMgYXUgZm9ybWF0IGF0dGVuZHXCoDogJTEkcwADA05P
TgACAk9LAAMDT1VJABMUUGFydGllbGxlbWVudCBjb2Now6kAHx9QYXNzZXIgYXUgbW9kZSBkZSBz
YWlzaWUgQWdlbmRhAB4eUGFzc2VyIGF1IG1vZGUgZGUgc2Fpc2llIFRleHRlABkZUGxhZ2UgZGUg
ZGF0ZXMgbm9uIHZhbGlkZQAaGlJldmVuaXIgZW4gaGF1dCBkZSBsYSBwYWdlABcYUsOpZHVpcmUg
bGEgYm90dG9tIHNoZWV0ABAQU2Fpc2lyIGRlcyBkYXRlcwAWF1PDqWxlY3Rpb25uZXIgZGVzIGRh
dGVzABgZU8OpbGVjdGlvbm5lciBkZXMgbWludXRlcwAfIFPDqWxlY3Rpb25uZXIgbGUgZm9ybWF0
IEFNIG91IFBNABUWU8OpbGVjdGlvbm5lciB1bmUgZGF0ZQAWF1PDqWxlY3Rpb25uZXIgdW5lIGhl
dXJlAAkJZW4gaGV1cmVzAAoKZW4gbWludXRlcwA0N0RhdHVtIGplIGl6dmFuIG/EjWVraXZhbm9n
IHJhc3BvbmEgZ29kaW5lICUxJHMg4oCTICUyJHMAGRpEYXR1bSBuaWplIGRvcHXFoXRlbjogJTEk
cwAvMERhdHVtIHNlIG5lIHBvZHVkYXJhIHMgb8SNZWtpdmFuaW0gdXpvcmtvbTogJTEkcwALC0Rh
dHVtIHVub3NhABERRGF0dW0gdW5vc2E6ICUxJHMACAhEaWplbGkgcwAUFkRqZWxvbWnEjW5vIHBv
dHZyxJFlbm8ADg9JZGkgbmEgcG/EjWV0bnUADA1JemJyacWhaSB1cGl0ABQVTWFya2VyIHphIHBv
dmxhxI1lbmplAAYGTmF0cmFnABUVTmF2aWdhY2lqc2tpIGl6Ym9ybmlrAA0PTmV2YcW+ZcSHaSB1
bm9zABERT2RhYmlyIGFwbGlrYWNpamUADQ1PZGFiaXIgbWludXRhAAsLT2RhYmlyIHNhdGEAGRlP
ZGJhY2l2YW5qZSBkb25qZSB0YWJsaWNlAAQET3BpcwARElBhZGFqdcSHaSBpemJvcm5pawBGRlBv
bWFrbml0ZSBzZSB6YSBvZGFiaXIgZ29kaW5lIGlsaSBkb2Rpcm5pdGUgemEgcG92cmF0YWsgbmEg
b2RhYmlyIGRhbmEAJiZQb21ha25pdGUgc2UgemEgcHJpa2F6IGthc25pamloIGdvZGluYQApKVBv
bWFrbml0ZSBzZSB6YSBwcmlrYXogcHJldGhvZG5vZyBtamVzZWNhACUlUG9tYWtuaXRlIHNlIHph
IHByaWtheiByYW5pamloIGdvZGluYQAoKVBvbWFrbml0ZSBzZSB6YSBwcmlrYXogc2xqZWRlxIdl
ZyBtamVzZWNhAB0dUG9taWNhbmplIG5hIHByZXRob2RuaSBtamVzZWMAHB1Qb21pY2FuamUgbmEg
c2xqZWRlxIdpIG1qZXNlYwAMDFBvc2xpamVwb2RuZQAODlBveml2IHUgdGlqZWt1AAcHUHJla2lu
aQAWFlByZWxhemFrIHUgZ29kaW51ICUxJHMAHh9QcmlqZWxheiBuYSBuYcSNaW4gdW5vc2EgdGVr
c3RhACMkUHJpamVsYXogbmEgbmHEjWluIHVub3NhIHUgS2FsZW5kYXJ1ABkZUHJpamVsYXogbmEg
b2RhYmlyIGdvZGluZQAKClByaWplcG9kbmUADA1QcmlrYcW+aSBvcGlzABobUHJvxaFpcml2YW5q
ZSBkb25qZSB0YWJsaWNlAAYHU2HFvmV0bwAXGFNhxb5pbWFuamUgZG9uamUgdGFibGljZQAFBlNh
xb5taQAXGFRyZW51dGHEjW5pIG9kYWJpcjogJTEkcwAICFUgdGlqZWt1AAsLVW5vcyBkYXR1bWEA
IiRVbm9zIGRhdHVtc2tvZyByYXNwb25hIG5pamUgdmHFvmXEh2kAFRZVcGl0IHphIHByZXRyYcW+
aXZhbmplAAoKVmlkZW96YXBpcwAgIFZpZGxqaXYgamUgYWxhdCB6YSBvZGFiaXIgZ29kaW5lACIi
WmF0dmFyYW5qZSBpemJvcm5pa2EgemEgbmF2aWdhY2lqdQAQEFphdHZhcmFuamUgbGlzdGEACAht
aW51dGFtYQAMDG5hIGplZGFuIHNhdAAGBnN2ZW1pcgALFSUxJGQg4KSf4KSV4KWN4KSV4KWHLgAI
DiUxJGQg4KSk4KS+4KS4AAsXJTEkZCDgpK7gpL/gpKjgpL/gpJ/gpYcAChQlMSRkIOCkteCkvuCk
nOCkpOCkvgAaQCUxJHMg4KS14KSw4KWN4KS34KS+4KS14KSwIOCkqOClh+CkteCljeCkueCkv+Ck
l+Clh+CknyDgpJXgpLDgpL4ADiAlcyDgpLjgpLkg4KS24KWH4KSF4KSwIOCkleCksOCkvgARJUFN
IOCkleCkv+CkguCkteCkviBQTSDgpKjgpL/gpLXgpKHgpL4ADCLgpIXgpILgpLbgpKTgpIMg4KSk
4KSq4KS+4KS44KSy4KWHAB1F4KSF4KS24KS+IOCkpOCkvuCksOCkluClh+CksuCkviDgpIXgpKjg
pYHgpK7gpKTgpYAg4KSo4KS+4KS54KWAOiAlMSRzAAoc4KSF4oCN4KWF4KSqIOCkqOCkv+CkteCk
oeCkvgALH+CkhuCko+CkluClgCDgpKrgpLDgpY3gpK/gpL7gpK8ACx/gpIfgpKjgpJXgpK7gpL/g
pILgpJcg4KSV4KWJ4KSyABtJ4KSH4KSo4KSV4KSu4KS/4KSC4KSXIOCkleClieCksiDgpLjgpY3g
pJXgpY3gpLDgpYDgpKgg4KSV4KSw4KSkIOCkhuCkueClhwAQLOCkh+CkqOCkquClgeCknyDgpJrg
pYHgpJXgpYDgpJrgpYcg4KSG4KS54KWHAAoc4KSJ4KSk4KWN4KSk4KSwIOCkpuCljeCkr+CkvgAI
FuCkj+CkguCkn+CksCDgpJXgpLDgpL4AFS/gpI/gpILgpJ/gpLAg4KSV4KWH4KSy4KWAIOCkpOCk
vuCksOClgOCkljogJTEkcwARL+Ckj+CkguCkn+CksCDgpJXgpYfgpLLgpYfgpLLgpYAg4KSk4KS+
4KSw4KWA4KSWAAsf4KSV4KS+4KS54KWA4KS54KWAIOCkqOCkvuCkueClgAAdT+CkleClheCksuCl
h+CkguCkoeCksCDgpIfgpKjgpKrgpYHgpJ8g4KSu4KWL4KSh4KS14KSwIOCkuOCljeCkteCkv+Ck
miDgpJXgpLDgpL4ACx3gpJXgpYngpLIg4KSs4KSC4KSmIOCkleCksOCkvgALH+CkleCli+CksuCl
heCkquCljeCkuCDgpJXgpLDgpL4ADCLgpJXgpYvgpLLgpYXgpKrgpY3gpLgg4KSV4KWH4KSy4KS+
ABAs4KSV4KWN4KS14KWH4KSw4KWAIOCkuOCkrOCkruCkv+CknyDgpJXgpLDgpL4ADyngpJXgpY3i
gI3gpLXgpYfgpLDgpYAg4KS44KS+4KSrIOCkleCksOCkvgAUOOCkmOCksOCkvuCkleCkoeClhyDg
pKjgpYfgpLXgpY3gpLngpL/gpJfgpYfgpJ8g4KSV4KSw4KS+AAwi4KSf4KWC4KSy4KSf4KS/4KSq
IOCkpuCkvuCkluCkteCkvgADCeCkn+ClheCkrAAdT+Ckn+Clh+CkleCljeCkuOCljeCknyDgpIfg
pKjgpKrgpYHgpJ8g4KSu4KWL4KSh4KS14KSwIOCkuOCljeCkteCkv+CkmiDgpJXgpLDgpL4AChzg
pKHgpL/gpLjgpK7gpL/gpLgg4KSV4KSw4KS+AAsf4KSh4KWN4KSw4KWF4KSXIOCkueClheCkguCk
oeCksgAOKOCkoeCljeCksOClieCkquCkoeCkvuCkieCkqCDgpK7gpYfgpKjgpYIAHEzgpKTgpLPg
pL7gpLbgpYAg4KSF4KS44KSy4KWH4KSy4KWAIOCktuClgOCknyDgpJXgpYvgpLLgpYXgpKrgpY3g
pLgg4KSV4KSw4KS+ABtJ4KSk4KSz4KS+4KS24KWAIOCkheCkuOCksuClh+CksuClgCDgpLbgpYDg
pJ8g4KSh4KS/4KS44KSu4KS/4KS4IOCkleCksOCkvgAeUuCkpOCks+CkvuCktuClgCDgpIXgpLjg
pLLgpYfgpLLgpYAg4KS24KWA4KSfIOCkteCkv+CkuOCljeCkpOCkvuCksOClgOCkpCDgpJXgpLDg
pL4ADibgpKTgpL7gpLDgpJbgpL4g4KSP4KSC4KSf4KSwIOCkleCksOCkvgALH+CkpOCkvuCksOCk
luCkviDgpKjgpL/gpLXgpKHgpL4ACx/gpKTgpL7gpLDgpYDgpJYg4KSo4KS/4KS14KSh4KS+AB1P
4KSk4KS+4KSw4KWA4KSWIOCksOClh+CkguCknOCkmuClhyDgpIfgpKjgpKrgpYHgpJ8g4KSa4KWB
4KSV4KWA4KSa4KWHIOCkhuCkueClhwA1e+CkpOCkvuCksOClgOCkliDgpLngpYAgJTEkcyAtICUy
JHMg4KSv4KS+IOCkheCkquClh+CkleCljeCkt+Ckv+CkpCDgpLDgpYfgpILgpJzgpJrgpY3gpK/g
pL4g4KSs4KS+4KS54KWH4KSw4KSa4KWAIOCkhuCkueClhwAqaOCkpOCkvuCksOClgOCkliDgpLng
pYAg4KSF4KSq4KWH4KSV4KWN4KS34KS/4KSkIOCkquClheCkn+CksOCljeCkqOCktuClgCDgpJzg
pYHgpLPgpKQg4KSo4KS+4KS54KWAOiAlMSRzAAMJ4KSk4KS+4KS4AAkZ4KSk4KS+4KS4IOCkqOCk
v+CkteCkoeCkvgAIGOCkpOCkvuCkuOCkvuCkuOCkvuCkoOClgAAkZOCkqOCkguCkpOCksOCkmuCl
gCDgpLXgpLDgpY3gpLcg4KSm4KS+4KSW4KS14KSj4KWN4KSv4KS+4KS44KS+4KSg4KWAIOCkuOCl
jeCkleCljeCksOCli+CksiDgpJXgpLDgpL4ACRngpKjgpJXgpL7gpLAg4KSm4KWN4KSv4KS+AAYS
4KSo4KS/4KS14KSh4KSy4KS+AAsf4KSo4KS/4KS14KSh4KSy4KS+IOCkqOCkvuCkueClgAAOKOCk
qOCkv+CkteCkoeCksuClh+CksuClgCDgpKTgpL7gpLDgpYDgpJYADyvgpKjgpYfgpLXgpY3gpLng
pL/gpJfgpYfgpLbgpKgg4KSu4KWH4KSo4KWCABc/4KSo4KWH4KS14KWN4KS54KS/4KSX4KWH4KS2
4KSoIOCkruClh+CkqOClgiDgpKzgpILgpKYg4KSV4KSw4KS+ACRk4KSq4KWB4KSi4KWA4KSyIOCk
ruCkueCkv+CkqOCkviDgpKbgpL7gpJbgpLXgpKPgpY3gpK/gpL7gpLjgpL7gpKDgpYAg4KS44KWN
4KSV4KWN4KSw4KWL4KSyIOCkleCksOCkvgAUOOCkquClgeCkouClgOCksiDgpK7gpLngpL/gpKjg
pY3gpK/gpL7gpLXgpLAg4KSs4KSm4KSy4KS+AAoc4KSq4KWC4KSw4KWN4KSjIOCkneCkvuCksuCl
hwAmauCkquClguCksOCljeCkteClgOCkmuClgCDgpLXgpLDgpY3gpLcg4KSm4KS+4KSW4KS14KSj
4KWN4KSv4KS+4KS44KS+4KSg4KWAIOCkuOCljeCkleCljeCksOCli+CksiDgpJXgpLDgpL4ADyvg
pKrgpY3gpLDgpJfgpKTgpYDgpKrgpKXgpL7gpLXgpLAg4KSG4KS54KWHAAcT4KSs4KSC4KSmIOCk
huCkueClhwAkZOCkruCkvuCkl+ClgOCksiDgpK7gpLngpL/gpKjgpL4g4KSm4KS+4KSW4KS14KSj
4KWN4KSv4KS+4KS44KS+4KSg4KWAIOCkuOCljeCkleCljeCksOCli+CksiDgpJXgpLDgpL4AFDjg
pK7gpL7gpJfgpYDgpLIg4KSu4KS54KS/4KSo4KWN4KSv4KS+4KS14KSwIOCkrOCkpuCksuCkvgAF
D+CkruCkv+CkqOCkv+CknwALIeCkruCkv+CkqOCkv+Ckn+CkvuCkguCkuOCkvuCkoOClgAAMIuCk
ruCkv+CkqOCkv+Ckn+ClhyDgpKjgpL/gpLXgpKHgpL4ABQ3gpK7gpYfgpKjgpYIrABQ44KSv4KS+
4KSC4KSa4KWN4KSv4KS+4KS44KWL4KSs4KSkIOCktuClh+CkheCksCDgpJXgpLDgpL4ACx/gpLDg
pYfgpILgpJzgpJrgpL4g4KS24KWH4KS14KSfAA4o4KSw4KWH4KSC4KSc4KSa4KWAIOCkuOClgeCk
sOClgeCkteCkvuCkpAAJG+CksOClh+CkguCknOCkruCkp+CljeCkr+ClhwARL+CkteCksCDgpKjg
pYfgpLXgpY3igI3gpLngpL/gpJfgpYfgpJ8g4KSV4KSw4KS+ABhA4KS14KSw4KWN4KS3IOCkqOCk
v+CkteCkoeCko+ClhyDgpLXgpLAg4KS44KWN4KS14KS/4KSaIOCkleCksOCkvgBRgNvgpLXgpLDg
pY3gpLcg4KSo4KS/4KS14KSh4KSj4KWN4KSv4KS+4KS44KS+4KSg4KWAIOCkuOCljeKAjeCkteCk
vuCkh+CkqiDgpJXgpLDgpL4sIOCkleCkv+CkguCkteCkviDgpKbgpL/gpLXgpLgg4KSo4KS/4KS1
4KSh4KSj4KWN4KSv4KS+4KS14KSwIOCkquCksOCkpCDgpLjgpY3gpLXgpL/gpJog4KSV4KSw4KSj
4KWN4KSv4KS+4KS44KS+4KSg4KWAIOCkn+ClheCkqiDgpJXgpLDgpL4AFjzgpLXgpLDgpY3gpLcg
4KSq4KS/4KSV4KSwIOCkpuClg+CktuCljeCkr+CkruCkvuCkqCDgpIbgpLngpYcADijgpLXgpL/g
pLjgpY3gpKTgpL7gpLDgpL/gpKQg4KSV4KWH4KSy4KS+AAcV4KS14KWN4KS54KS/4KSh4KS/4KST
AAoc4KS14KWN4KS54KWJ4KSH4KS4IOCktuCli+CkpwALHeCktuClgOCknyDgpKzgpILgpKYg4KSV
4KSw4KS+AAoc4KS24KWL4KSnIOCkleCljeCkteClh+CksOClgAAEDOCktuCli+Ckp+CkvgAFD+Ck
tuCli+Ckp+CkvuKApgAPK+CkuOCkguCkquCko+CljeCkr+CkvuCkmuClgCDgpKTgpL7gpLDgpYDg
pJYADx/gpLjgpKbgpY3gpK8g4KSo4KS/4KS14KShOiAlMSRzAAkZ4KS44KSw4KWN4KS1IOCkquCk
vuCkueCkvgAEDOCkuOClgeCksOClggAPKeCkuOClgeCksOClgiDgpIXgpLjgpLLgpYfgpLLgpL4g
4KSV4KWJ4KSyAAgW4KS44KWB4KSw4KWCIOCkhuCkueClhwATNeCkuOClgeCksOClgiDgpLngpYvg
pKPgpY3gpK/gpL7gpJrgpYAg4KSk4KS+4KSw4KWA4KSWAA8p4KS44KWC4KSa4KSo4KS+IOCkluCk
vuCksuClgCDgpIbgpLngpYfgpKQABQ/gpLjgpY3gpLXgpL/gpJoABAzgpLngpJ/gpLXgpL4ABArg
pa/gpa/gpa8rAAoUJTEkZCDgrJjgrKPgrY3grJ/grL4AChQlMSRkIOCsruCsv+CsqOCsv+CsnwAG
CiUxJGTgrJ/grL4AGkAlMSRzIOCsrOCssOCtjeCst+CsleCtgSDgrKjgrL7grK3grL/grJfgrYfg
rJ8g4KyV4Kyw4Kyo4K2N4Kyk4K2BABQyJXMg4Ky44Ky5IOCsuOCth+Ctn+CsvuCssOCtjeKAjSDg
rJXgrLDgrKjgrY3grKTgrYEAFzVBTSDgrJXgrL/grK7grY3grKzgrL4gUE0g4Kya4K2f4KyoIOCs
leCssOCsqOCtjeCspOCtgQALH+CsheCsl+CtjeCssOCsvuCsueCtjeCtnyDgrJXgrLAACx/grIXg
rKfgrL/grJUg4Kys4Ky/4KyV4Kyz4K2N4KyqAAMJ4KyF4Kyo4K2NAAsf4KyF4Kys4K2I4KynIOCs
h+CsqOCsquCtgeCsn+CtjQAWPOCsheCsrOCtiOCspyDgrKTgrL7grLDgrL/grJYg4Kyw4K2H4Kye
4K2N4KycIOCsh+CsqOCsquCtgeCsnwADCeCshuCsnOCsvwALH+CshuCssOCsruCtjeCsrSDgrKTg
rL7grLDgrL/grJYAMXvgrIbgrLbgrL4g4KyV4Kyw4Ky+4Kyv4Ky+4KyJ4Kyl4Ky/4Kys4Ky+IOCs
quCsvuCsn+CssOCtjeCsqCDgrLjgrLkg4Kyk4Ky+4Kyw4Ky/4KyWIOCsruCth+CssyDgrLngrYfg
rIngrKjgrL7grLngrL/grIE6ICUxJHMAGUXgrIbgrLbgrL/grILgrJUg4Kyt4Ky+4Kys4K2HIOCs
r+CsvuCsnuCtjeCsmiDgrJXgrLDgrL7grK/grL7grIfgrJvgrL8AChzgrIfgrKjgrJXgrK7grL/g
rIIg4KyV4Kyy4K2NAA0l4KyJ4Kyk4K2N4Kyk4KywIOCspuCsv+CsheCsqOCtjeCspOCtgQAVO+Cs
ieCsquCssOCsleCtgSDgrKjgrYfgrK3grL/grJfgrYfgrJ/grY0g4KyV4Kyw4Kyo4K2N4Kyk4K2B
AB1P4KyP4KyVIOCsh+CsqOCsleCsruCsv+CsgiDgrJXgrLLgrJXgrYEg4Ky44K2N4KyV4K2N4Kyw
4Ky/4Kyo4K2NIOCsleCssOCtgeCsm+CsvwBfgPvgrI/grJUg4Kys4Kyw4K2N4Ky3IOCsmuCtn+Cs
qCDgrJXgrLDgrL/grKzgrL4g4Kyq4Ky+4KyH4KyBIOCsuOCtjeCtseCsvuCsh+CsqiDgrJXgrLDg
rKjgrY3grKTgrYEg4KyV4Ky/4Kyu4K2N4Kys4Ky+IOCsj+CslSDgrKbgrL/grKgg4Kya4K2f4Kyo
IOCsleCssOCsv+CsrOCsviDgrKrgrL7grIfgrIEg4Kyq4K2B4Kyj4Ky/IOCsuOCtjeCtseCsv+Cs
miDgrJXgrLDgrL/grKzgrL7grJXgrYEg4Kyf4Ky+4KyqIOCsleCssOCsqOCtjeCspOCtgQAGEuCs
j+Cso+CtjeCsn+CssOCtjQAYQuCsj+CsueCsvuCsmeCtjeCslSDgrLjgrLkg4Ky44K2H4K2f4Ky+
4Kyw4K2N4oCMIOCsleCssOCsqOCtjeCspOCtgQAKHOCsleCsv+Csm+CsvyDgrKjgrL7grLngrL/g
rIEAIVvgrJXgrYfgrLLgrYfgrKPgrY3grKHgrLAg4KyH4Kyo4Kyq4K2B4KyfIOCsruCti+CsoeCs
leCtgSDgrLjgrY3grbHgrL/grJog4KyV4Kyw4Kyo4K2N4Kyk4K2BABIy4KyV4K2N4K2x4K2H4Kyw
4K2AIOCsluCsvuCssuCsvyDgrJXgrLDgrKjgrY3grKTgrYEAEjLgrJXgrY3grbHgrYfgrLDgrYAg
4Kym4Ky+4KyW4KyyIOCsleCssOCsqOCtjeCspOCtgQALH+CsluCsvuCssOCsnCDgrJXgrLDgrKjg
rY3grKTgrYEAEjLgrJfgrYvgrJ/grL/grI8g4KyG4Kyq4K2N4oCNIOCsrOCsvuCsm+CsqOCtjeCs
pOCtgQAFD+CsmOCso+CtjeCsn+CsvgAQLOCsmOCso+CtjeCsn+CsviDgrJrgrZ/grKgg4KyV4Kyw
4Kyo4K2N4Kyk4K2BAAoc4KyY4Kyj4K2N4Kyf4Ky+IOCsquCsvuCsh+CsgQAGEuCsmuCsvuCssuCs
v+Csm+CsvwAMIuCsmuCsvuCssuCsv+CspeCsv+CsrOCsviDgrJXgrLLgrY0ACBbgrJrgrL7grLLg
rYEg4KyF4Kyb4Ky/AA8r4Kya4K2f4KyoIOCsleCssOCsvuCsr+CsvuCsh+CsqOCsvuCsueCsv+Cs
gQAFD+CsmuCtn+CsqOCsv+CspAALH+CsmuCtn+CsqOCsv+CspCDgrKTgrL7grLDgrL/grJYABAzg
rJ/grL7grKzgrY0ABhLgrJ/grYHgrLLgrJ/grL/grKoADyvgrJ/grYHgrLLgrJ/grL/grKog4Kym
4K2H4KyW4Ky+4Kyo4K2N4Kyk4K2BAB9V4Kyf4K2H4KyV4K2N4Ky44KyfIOCsh+CsqOCsquCtgeCs
nyDgrK7grYvgrKHgrJXgrYEg4Ky44K2N4K2x4Ky/4KyaIOCsleCssOCsqOCtjeCspOCtgQAFD+Cs
oeCsvuCsj+CssuCslwAHFeCsoeCsv+CssuCsv+Csn+CtjeKAjQANJeCsoeCtjeCssOCsquCsoeCs
vuCsieCsqCDgrK7grYfgrKjgrYEADSXgrKHgrY3grLDgrL7grJcg4Ky54K2H4Kyj4K2N4Kyh4K2H
4KyyAAUP4Kyk4Ky+4Kyw4Ky/4KyWABAs4Kyk4Ky+4Kyw4Ky/4KyWIOCsmuCtn+CsqCDgrJXgrLDg
rKjgrY3grKTgrYEAIFDgrKTgrL7grLDgrL/grJbgrJXgrYEg4KyF4Kyo4K2B4Kyu4Kyk4Ky/IOCs
puCsv+CshuCsr+CsvuCsh+CsqOCsvuCsueCsv+CsgTogJTEkcwAWPuCspOCsvuCssOCsv+CsluCs
l+CtgeCsoeCsvOCsv+CslSDgrJrgrZ/grKgg4KyV4Kyw4Kyo4K2N4Kyk4K2BABM34Kyk4Ky+4Kyw
4Ky/4KyW4KyX4K2B4Kyh4Ky84Ky/4KyVIOCssuCth+CsluCsqOCtjeCspOCtgQA6gIrgrKTgrL7g
rLDgrL/grJbgrJ/grL8g4KyG4Ky24Ky+IOCsleCssOCsvuCsr+CsvuCsieCspeCsv+CsrOCsviDg
rKzgrLDgrY3grLcg4Kyw4K2H4Kye4K2N4KycICUxJHMgLSAlMiRz4Kyw4K2BIOCsrOCsvuCsueCs
vuCssOCthyDgrIXgrJvgrL8ADijgrKjgrL7grK3grL/grJfgrYfgrLjgrKjgrY0g4Kyu4K2H4Kyo
4K2BABpI4Kyo4Ky+4Kyt4Ky/4KyX4K2H4Ky44Kyo4K2NIOCsruCth+CsqOCtgSDgrKzgrKjgrY3g
rKYg4KyV4Kyw4Kyo4K2N4Kyk4K2BAA4m4Kyq4Kyq4K2NLeCsheCsquCtjSDgrbHgrL/grKPgrY3g
rKHgrYsAKXHgrKrgrLAg4Kys4Kyw4K2N4Ky34KyX4K2B4Kyh4Ky84Ky/4KyVIOCspuCth+CsluCs
vuCsh+CsrOCsviDgrKrgrL7grIfgrIEg4Ky44K2N4KyV4K2N4Kyw4K2L4KyyIOCsleCssOCsqOCt
jeCspOCtgQApceCsquCssOCsrOCssOCtjeCspOCtjeCspOCtgCDgrK7grL7grLgg4Kym4K2H4KyW
4Ky+4KyH4Kys4Ky+IOCsquCsvuCsh+CsgSDgrLjgrY3grJXgrY3grLDgrYvgrLIg4KyV4Kyw4Kyo
4K2N4Kyk4K2BACFd4Kyq4Kyw4Kys4Kyw4K2N4Kyk4K2N4Kyk4K2AIOCsruCsvuCsuOCsleCtgSDg
rKrgrLDgrL/grKzgrLDgrY3grKTgrY3grKTgrKgg4KyV4Kyw4Kyo4K2N4Kyk4K2BABQ44Kyq4Kyw
4Ky+4Kyu4Kyw4K2N4Ky2IOCspOCss+CthyDgrKbgrL/grIbgrK/grL7grIfgrJvgrL8ALHrgrKrg
rYLgrLDgrY3grKwg4Kys4Kyw4K2N4Ky34KyX4K2B4Kyh4Ky84Ky/4KyVIOCspuCth+CsluCsvuCs
h+CsrOCsviDgrKrgrL7grIfgrIEg4Ky44K2N4KyV4K2N4Kyw4K2L4KyyIOCsleCssOCsqOCtjeCs
pOCtgQAseuCsquCtguCssOCtjeCsrOCsrOCssOCtjeCspOCtjeCspOCtgCDgrK7grL7grLgg4Kym
4K2H4KyW4Ky+4KyH4Kys4Ky+IOCsquCsvuCsh+CsgSDgrLjgrY3grJXgrY3grLDgrYvgrLIg4KyV
4Kyw4Kyo4K2N4Kyk4K2BACRm4Kyq4K2C4Kyw4K2N4Kys4Kys4Kyw4K2N4Kyk4K2N4Kyk4K2AIOCs
ruCsvuCsuOCsleCtgSDgrKrgrLDgrL/grKzgrLDgrY3grKTgrY3grKTgrKgg4KyV4Kyw4Kyo4K2N
4Kyk4K2BABU54Kys4Kyf4KyuIOCsuOCsv+Csn+CsleCtgSDgrJbgrL7grLDgrJwg4KyV4Kyw4Kyo
4K2N4Kyk4K2BABhC4Kys4Kyf4KyuIOCsuOCsv+Csn+CsleCtgSDgrKzgrL/grLjgrY3grKTgrL7g
rLAg4KyV4Kyw4Kyo4K2N4Kyk4K2BABlF4Kys4Kyf4KyuIOCsuOCsv+Csn+CsleCtgSDgrLjgrJng
rY3grJXgrYHgrJrgrL/grKQg4KyV4Kyw4Kyo4K2N4Kyk4K2BAAQM4Kys4Kyo4K2N4KymAAgW4Kys
4Kyo4K2N4KymIOCsheCsm+CsvwAULuCsrOCssOCtjeCspOCtjeCspOCsruCsvuCsqOCssCDgrJrg
rZ/grKg6ICUxJHMAHU/grKzgrLDgrY3grLcg4Kya4K2f4KyoIOCsleCssOCsv+CsrOCsvuCsleCt
gSDgrLjgrY3grbHgrL/grJog4KyV4Kyw4Kyo4K2N4Kyk4K2BABM14Kys4Kyw4K2N4Ky3IOCsquCs
v+CsleCssCDgrKbgrYfgrJbgrL7grK/grL7grIngrJvgrL8AEC7grKzgrL/grLjgrY3grKTgrL7g
rLAg4KyV4Kyw4Ky+4Kyv4Ky+4KyH4Kyb4Ky/AAwi4Kyt4KyP4Ky44K2N4oCMIOCsuOCssOCtjeCs
muCtjeCsmgAFD+CsreCsv+CsoeCsv+CskwAFD+CsruCsv+CsqOCsv+CsnwAQLOCsruCsv+CsqOCs
v+CsnyDgrJrgrZ/grKgg4KyV4Kyw4Kyo4K2N4Kyk4K2BAAoc4Kyu4Ky/4Kyo4Ky/4KyfIOCsquCs
vuCsh+CsgQAEDOCsruCth+CsqOCtgQALH+CssOCth+CsnuCtjeCsnCDgrIbgrLDgrK7grY3grK0A
CRngrLDgrYfgrJ7grY3grJwg4Ky24K2H4Ky3AAsf4Kyw4K2H4Kye4K2N4Kyc4Kyw4K2HIOCsheCs
m+CsvwARMeCssuCth+CsluCsvuCsr+CsvuCsh+CspeCsv+CsrOCsviDgrKTgrL7grLDgrL/grJYA
FzfgrLLgrYfgrJbgrL7grK/grL7grIfgrKXgrL/grKzgrL4g4Kyk4Ky+4Kyw4Ky/4KyWOiAlMSRz
AAwa4Ky24Kyk4KyV4Kyh4Ky84Ky+ICUxJGTgpaQACRngrLbgrYfgrLcg4Kyk4Ky+4Kyw4Ky/4KyW
AA4o4Ky44KyC4KyV4K2B4Kya4Ky/4KykIOCsleCssOCsqOCtjeCspOCtgQARMeCsuOCsmeCtjeCs
leCtgeCsmuCsv+CspCDgrJXgrLDgrL7grK/grL7grIfgrJvgrL8ACx/grLjgrKzgrYEg4Kym4K2H
4KyW4Kyo4K2N4Kyk4K2BAA0l4Ky44Kyu4Ky+4Kyq4K2N4KykIOCsleCssOCsqOCtjeCspOCtgQAN
JeCsuOCssOCtjeCsmuCtjeCsmiDgrJXgrLDgrKjgrY3grKTgrYEADijgrLjgrLDgrY3grJrgrY3g
rJog4KyV4Kyw4Kyo4K2N4Kyk4K2B4oCmAA0l4Ky44Kyw4K2N4Kya4K2N4KyaIOCsleCtjeCtseCt
h+CssOCtgAAQLOCsuOCsv+Csn+CtjSDgrKzgrKjgrY3grKYg4KyV4Kyw4Kyo4K2N4Kyk4K2BAAcV
4Ky44K2N4Kyq4K2H4Ky44K2N4oCNAAwi4Ky44K2N4K2x4Ky/4KyaIOCsleCssOCsqOCtjeCspOCt
gQAGEuCsueCti+Csh+Csl+CssuCsvgAcTuCsueCti+CsruCtjSDgrKrgrYfgrJzgrY3igIzgrJXg
rYEg4Kyo4K2H4Kyt4Ky/4KyX4K2H4Kyf4K2NIOCsleCssOCsqOCtjeCspOCtgQAICyUxJGQg0LzQ
uNC9AAsQJTEkZCDQv9C+0YHRgtC+LgAGByUxJGQg0YcAChPQiNC+0Ygg0L7Qv9GG0LjRmNCwABQh
0JDQutGC0YPQtdC70L3QuCDQuNC30LHQvtGAOiAlMSRzABMk0JLQuNC00ZnQuNCyINCx0LjRgNCw
0Ycg0LPQvtC00LjQvdCwABEh0JPQu9Cw0YHQvtCy0L3QsCDQv9GA0LXRgtGA0LDQs9CwAAUK0JTQ
sNC90LDRgQAPHdCU0LDRgtGD0Lwg0LfQsNCy0YDRiNC10YLQutCwACpK0JTQsNGC0YPQvCDQvdC1
INC+0LTQs9C+0LLQsNGA0LAg0L7Rh9C10LrQuNCy0LDQvdC+0Lwg0YjQsNCx0LvQvtC90YM6ICUx
JHMAGSrQlNCw0YLRg9C8INC90LjRmNC1INC00L7Qt9Cy0L7RmdC10L06ICUxJHMADRnQlNCw0YLR
g9C8INC/0L7Rh9C10YLQutCwADNX0JTQsNGC0YPQvCDRmNC1INC40LfQstCw0L0g0L7Rh9C10LrQ
uNCy0LDQvdC+0LMg0L7Qv9GB0LXQs9CwINCz0L7QtNC40L3QsCAlMSRzIOKAkyAlMiRzABIj0JTQ
tdC70LjQvNC40YfQvdC+INC+0LfQvdCw0YfQtdC90L4ADRnQlNC10LvQuNGC0LUg0L/QvtC80L7R
m9GDABsx0JTQtdC70LjRgtC1INC/0L7QvNC+0ZvRgyDQsNC/0LvQuNC60LDRhtC40ZjQtSAlcwAN
GdCU0L7Qu9Cw0LfQvdC4INC/0L7Qt9C40LIAGjHQl9Cw0YLQstC+0YDQuCDQvNC10L3QuCDQt9Cw
INC90LDQstC40LPQsNGG0LjRmNGDABAf0JfQsNGC0LLQvtGA0LjRgtC1INGC0LDQsdC10LvRgwAJ
EtCY0KHQmtCJ0KPQp9CV0J3QngAbNNCY0LTQtdC90YLQuNGE0LjQutCw0YLQvtGAINC30LAg0L/R
gNC10LLQu9Cw0YfQtdGa0LUAFSLQmNC00LjRgtC1INC90LAg0LPQvtC00LjQvdGDOiAlMSRzABAe
0JjQtNC40YLQtSDQvdCwINC/0L7Rh9C10YLQvdGDAAwX0JjQtNC40YLQtSDQvdCw0LPQvtGA0LUA
FCfQmNC30LDQsdC10YDQuNGC0LUg0LDQv9C70LjQutCw0YbQuNGY0YMADx3QmNC30LDQsdC10YDQ
uNGC0LUg0LTQsNGC0YPQvAAQH9CY0LfQsNCx0LXRgNC40YLQtSDQtNCw0YLRg9C80LUAEB/QmNC3
0LDQsdC10YDQuNGC0LUg0LzQuNC90YPRgtC1ACA70JjQt9Cw0LHQtdGA0LjRgtC1INC/0YDQtSDQ
v9C+0LTQvdC1INC40LvQuCDQv9C+INC/0L7QtNC90LUADRnQmNC30LDQsdC10YDQuNGC0LUg0YHQ
sNGCAA4b0JjQt9Cw0LHRgNCw0L3QuCDQtNCw0YLRg9C8AAgQ0JjQt9Cw0LHRgNCw0L3QvgAPHdCY
0YHQutCw0YfRg9Gb0Lgg0L/RgNC+0LfQvtGAAAkS0JjRgdC60ZnRg9GH0LXQvdC+AAcO0JrQsNGA
0YLQuNGG0LAACxXQmtGA0LDRmCDQvtC/0YHQtdCz0LAAEiLQnNC10L3QuCDQt9CwINC90LDQstC4
0LPQsNGG0LjRmNGDAAUK0J3QuNGI0YLQsAANGdCd0LjRmNC1INC40LfQsNCx0YDQsNC90L4ADRnQ
ntCx0YDQuNGI0LjRgtC1INGD0L/QuNGCAAkS0J7QsdGY0LDRiNGa0LXRmtC1ABIi0J7QtNCx0LDR
htC4INC00L7RmtGDINGC0LDQsdC10LvRgwAIENCe0LTQsdCw0YbQuNGC0LUADRnQn9Cw0LTQsNGY
0YPRm9C4INC80LXQvdC4AA8b0J/QvtC30LjQsiDRmNC1INGDINGC0L7QutGDACtQ0J/QvtC80LXR
gNCw0ZjRgtC1INC00LAg0LHQuCDRgdC1INC/0YDQuNC60LDQt9Cw0LvQtSDQutCw0YHQvdC40ZjQ
tSDQs9C+0LTQuNC90LUAKk7Qn9C+0LzQtdGA0LDRmNGC0LUg0LTQsCDQsdC4INGB0LUg0L/RgNC4
0LrQsNC30LDQu9C1INGA0LDQvdC40ZjQtSDQs9C+0LTQuNC90LUAK1DQn9C+0LzQtdGA0LDRmNGC
0LUg0LTQsCDQsdC4INGB0LUg0L/RgNC40LrQsNC30LDQviDQv9GA0LXRgtGF0L7QtNC90Lgg0LzQ
tdGB0LXRhgApTNCf0L7QvNC10YDQsNGY0YLQtSDQtNCwINCx0Lgg0YHQtSDQv9GA0LjQutCw0LfQ
sNC+INGB0LvQtdC00LXRm9C4INC80LXRgdC10YYADhvQn9C+0YfQtdGC0LDQuiDQvtC/0YHQtdCz
0LAADRnQn9C+0YjQsNGZ0LjRgtC1INGD0L/QuNGCAFKAl9Cf0YDQtdCy0YPRhtC40YLQtSDQtNCw
INCx0LjRgdGC0LUg0LjQt9Cw0LHRgNCw0LvQuCDQs9C+0LTQuNC90YMg0LjQu9C4INC00L7QtNC4
0YDQvdC40YLQtSDQtNCwINCx0LjRgdGC0LUg0YHQtSDQstGA0LDRgtC40LvQuCDQvdCwINC40LfQ
sdC+0YAg0LTQsNC90LAAFinQn9GA0LXQtNC70L7Qt9C4INGB0YMg0YMg0L3QsNGB0YLQsNCy0LrR
gwAIENCf0YDQtdC60LjQtNCw0YcADBfQn9GA0LXQutC40L3QuCDQstC10LfRgwAIENCf0YDQtdGC
0YDQsNCz0LAAChTQn9GA0LXRgtGA0LDQttC40YLQtQAPHdCf0YDQtdGC0YDQsNC20LjRgtC1INGD
0L/QuNGCAAsX0J/RgNC10YLRgNCw0LbQuNGC0LXigKYAFyvQn9GA0LXRktC40YLQtSDQvdCwINC4
0LfQsdC+0YAg0LPQvtC00LjQvdC1ABox0J/RgNC10ZLQuNGC0LUg0L3QsCDQv9GA0LXRgtGF0L7Q
tNC90Lgg0LzQtdGB0LXRhgAdNtCf0YDQtdGS0LjRgtC1INC90LAg0YDQtdC20LjQvCDRg9C90L7R
gdCwINGC0LXQutGB0YLQsAAiP9Cf0YDQtdGS0LjRgtC1INC90LAg0YDQtdC20LjQvCDRg9C90L7R
gdCwINGDINCa0LDQu9C10L3QtNCw0YDRgwAYLdCf0YDQtdGS0LjRgtC1INC90LAg0YHQu9C10LTQ
tdGb0Lgg0LzQtdGB0LXRhgARIdCf0YDQuNC60LDQttC4INC+0LHRmNCw0YjRmtC10ZrQtQALFdCf
0YDQuNC60LDQttC4INGB0LLQtQAaMdCf0YDQvtCy0LXRgNCw0LLQsCDRgdC1INC00L7Qu9Cw0LfQ
vdC4INC/0L7Qt9C40LIADBfQn9GA0L7RiNC40YDQtdC90L4g0ZjQtQATJNCf0YDQvtGI0LjRgNC4
INC00L7RmtGDINGC0LDQsdC10LvRgwADBtCh0LDRggAFCtCh0LrRg9C/0LgAESDQodC60YPQv9C4
INC00L7RmtGDINGC0LDQsdC10LvRgwALFdCh0LrRg9C/0ZnQtdC90L4g0ZjQtQAID9CjINC00L7Q
vNC10YLRgwAGC9CjINGC0L7QutGDAAgQ0KPQmtCJ0KPQp9CV0J3QngAIENCj0LrRmdGD0YfQtdC9
0L4ADhvQo9C90LXRgdC40YLQtSDQtNCw0YLRg9C80LUACxXQo9C90LXRgtC4INC00LDRgtGD0LwA
ERvQo9C90LXRgtC4INC00LDRgtGD0Lw6ICUxJHMAHjjQo9C90L7RgSDQvtC/0YHQtdCz0LAg0LTQ
sNGC0YPQvNCwINGY0LUg0L3QtdCy0LDQttC10ZvQuAAQHtCj0L3QvtGBINGY0LUg0L3QtdCy0LDQ
ttC10ZvQuAAJEdC30LAg0LzQuNC90YPRgtC1AAcN0LfQsCDRgdCw0YLQtQACBNC/0L4AAgTQv9GA
ABAe0YLQsNGB0YLQtdGAINC30LAg0YDQsNC30LzQsNC6AAgIJTEkZCBtaW4ACwslMSRkIHBvc3Rv
LgAGByUxJGQgxI0AFBRBa3R1ZWxuaSBpemJvcjogJTEkcwAFBURhbmFzADM2RGF0dW0gamUgaXp2
YW4gb8SNZWtpdmFub2cgb3BzZWdhIGdvZGluYSAlMSRzIOKAkyAlMiRzACosRGF0dW0gbmUgb2Rn
b3ZhcmEgb8SNZWtpdmFub20gxaFhYmxvbnU6ICUxJHMAGhpEYXR1bSBuaWplIGRvenZvbGplbjog
JTEkcwANDkRhdHVtIHBvxI1ldGthAA8QRGF0dW0gemF2csWhZXRrYQASFERlbGltacSNbm8gb3pu
YcSNZW5vAA0ORGVsaXRlIHBvbW/Eh3UAGxxEZWxpdGUgcG9tb8SHdSBhcGxpa2FjaWplICVzAAcH
RGlqYWxvZwANDURvbGF6bmkgcG96aXYAERFHbGFzb3ZuYSBwcmV0cmFnYQAGBkdvdG92bwAKC0lT
S0xKVcSMRU5PABwdSWRlbnRpZmlrYXRvciB6YSBwcmV2bGHEjWVuamUAFRVJZGl0ZSBuYSBnb2Rp
bnU6ICUxJHMAEBFJZGl0ZSBuYSBwb8SNZXRudQAMDElkaXRlIG5hZ29yZQAPEUlza2HEjXXEh2kg
cHJvem9yAAoLSXNrbGp1xI1lbm8AFBRJemFiZXJpdGUgYXBsaWthY2lqdQAPD0l6YWJlcml0ZSBk
YXR1bQAQEEl6YWJlcml0ZSBkYXR1bWUAEBBJemFiZXJpdGUgbWludXRlACAgSXphYmVyaXRlIHBy
ZSBwb2RuZSBpbGkgcG8gcG9kbmUADQ1JemFiZXJpdGUgc2F0AA4OSXphYnJhbmkgZGF0dW0ACAhJ
emFicmFubwAKC0pvxaEgb3BjaWphAAcHS2FydGljYQALC0tyYWogb3BzZWdhABISTWVuaSB6YSBu
YXZpZ2FjaWp1AAUFTWludXQADQ1OaWplIGl6YWJyYW5vAAUGTmnFoXRhAAsMT2JqYcWhbmplbmpl
AA0OT2JyacWhaXRlIHVwaXQAExNPZGJhY2kgZG9uanUgdGFiZWx1AAgIT2RiYWNpdGUABQVPZGJp
agAICE9kZ292b3JpAA0OUGFkYWp1xIdpIG1lbmkAKytQb21lcmFqdGUgZGEgYmkgc2UgcHJpa2F6
YWxlIGthc25pamUgZ29kaW5lACoqUG9tZXJhanRlIGRhIGJpIHNlIHByaWthemFsZSByYW5pamUg
Z29kaW5lACsrUG9tZXJhanRlIGRhIGJpIHNlIHByaWthemFvIHByZXRob2RuaSBtZXNlYwApKlBv
bWVyYWp0ZSBkYSBiaSBzZSBwcmlrYXphbyBzbGVkZcSHaSBtZXNlYwAPD1Bveml2IGplIHUgdG9r
dQAOD1BvxI1ldGFrIG9wc2VnYQAOD1BvxaFhbGppdGUgdXBpdAAWFlByZWRsb3ppIHN1IHUgbmFz
dGF2a3UACAlQcmVraWRhxI0ADAxQcmVraW5pIHZlenUACAhQcmV0cmFnYQAKC1ByZXRyYcW+aXRl
AA8QUHJldHJhxb5pdGUgdXBpdAALDlByZXRyYcW+aXRl4oCmAFJSUHJldnVjaXRlIGRhIGJpc3Rl
IGl6YWJyYWxpIGdvZGludSBpbGkgZG9kaXJuaXRlIGRhIGJpc3RlIHNlIHZyYXRpbGkgbmEgaXpi
b3IgZGFuYQAXGFByZcSRaXRlIG5hIGl6Ym9yIGdvZGluZQAaG1ByZcSRaXRlIG5hIHByZXRob2Ru
aSBtZXNlYwAdH1ByZcSRaXRlIG5hIHJlxb5pbSB1bm9zYSB0ZWtzdGEAIiRQcmXEkWl0ZSBuYSBy
ZcW+aW0gdW5vc2EgdSBLYWxlbmRhcnUAGBpQcmXEkWl0ZSBuYSBzbGVkZcSHaSBtZXNlYwATFVBy
aWthxb5pIG9iamHFoW5qZW5qZQALDFByaWthxb5pIHN2ZQAaGlByb3ZlcmF2YSBzZSBkb2xhem5p
IHBveml2AAwNUHJvxaFpcmVubyBqZQAUFVByb8WhaXJpIGRvbmp1IHRhYmVsdQADA1NhdAAFBVNr
dXBpABISU2t1cGkgZG9uanUgdGFiZWx1AAwMU2t1cGxqZW5vIGplAAgIVSBkb21ldHUABgZVIHRv
a3UACQpVS0xKVcSMRU5PAAkKVWtsanXEjWVubwAODlVuZXNpdGUgZGF0dW1lAAsLVW5ldGkgZGF0
dW0AERFVbmV0aSBkYXR1bTogJTEkcwAQElVub3MgamUgbmV2YcW+ZcSHaQAeIFVub3Mgb3BzZWdh
IGRhdHVtYSBqZSBuZXZhxb5lxIdpABQVVmlkbGppdiBiaXJhxI0gZ29kaW5hABoaWmF0dm9yaSBt
ZW5pIHphIG5hdmlnYWNpanUAEBBaYXR2b3JpdGUgdGFiZWx1AAICcG8AAgJwcgAQEHRhc3RlciB6
YSByYXptYWsACQl6YSBtaW51dGUABwd6YSBzYXRlAAsLJTEkZCBkYWtpa2EAERMlMSRzIHnEsWzE
sW5hIGdpZGluAA0OJXMgaWxlIHBheWxhxZ8AEhNBbHQgc2F5ZmF5xLEgZGFyYWx0ABQWQWx0IHNh
eWZhecSxIGdlbmnFn2xldAAREkFsdCBzYXlmYXnEsSBrYXBhdAAHB0FuYWh0YXIAAwNBcmEAERVB
cmFsxLFrIGJhxZ9sYW5nxLFjxLEACwxBcmFsxLFrIHNvbnUACAlBcmFsxLFrdGEABQVBcmFtYQAN
DUFyYW1hIHNvcmd1c3UAExVBcmHDpyBpcHVjdW51IGfDtnN0ZXIABAZBcmHigKYAAgNBw4cABAZB
w6fEsWsACw9Bw6fEsWzEsXIgbWVuw7wAEBNCYcWfbGFuZ8Sxw6cgdGFyaWhpABITQmlyIHV5Z3Vs
YW1hIHNlw6dpbgAMDUJpdGnFnyB0YXJpaGkABQVCaXR0aQAFBkJ1Z8O8bgAOEERha2lrYXnEsSBz
ZcOnaW4ABgZEYXJhbHQACw5EYXJhbHTEsWxtxLHFnwAQEERldmFtIGVkZW4gYXJhbWEADAxEZXZh
bSBlZGl5b3IAEBJEacSfZXIgc2XDp2VuZWtsZXIAFxlFdmUgZ2lkacWfIHlvbHVudSBnw7ZzdGVy
AAsLR2VsZW4gYXJhbWEAFRhHZWxlbiBhcmFtYSBzw7x6w7xsw7x5b3IADQ9HZW5pxZ9sZXRpbG1p
xZ8ADhBHZXppbm1lIG1lbsO8c8O8ABYZR2V6aW5tZSBtZW7DvHPDvG7DvCBrYXBhdAATFUdlw6dl
cmxpIHNlw6dpbTogJTEkcwAOEEdlw6dlcnNpeiBnaXJpxZ8AHSJHZcOnZXJzaXogdGFyaWggYXJh
bMSxxJ/EsSBnaXJpxZ9pAA0NR2lyaWxlbiB0YXJpaAATE0dpcmlsZW4gdGFyaWg6ICUxJHMABQVL
QVBBVAAGB0thcGFsxLEABQVLYXBhdABJU0theWTEsXJhcmFrIGJpciB5xLFsIHNlw6dpbiB2ZXlh
IGfDvG4gc2XDp21lIGLDtmzDvG3DvG5lIGdlcmkgZMO2bm1layBpw6dpbiBkb2t1bnVuABscS8Sx
c21pIG9sYXJhayBrb250cm9sIGVkaWxkaQAFBk1lbsO8KwAWGE1ldGluIGdpcmnFnyBtb2R1bmEg
Z2XDpwAODlBvcC11cCBQZW5jZXJlAAYGUmVkZGV0AAkJU2FhdCAlMSRkAAoLU2FhdCBzZcOnaW4A
DQ5TYXlmYXnEsSBrYXBhdAAFBVNla21lAAsLU2VzbGkgYXJhbWEADQ5TZcOnaWxlbiB0YXJpaAAG
B1Nlw6dpbGkADA5TZcOnaWxpIGRlxJ9pbAAUFlNvbnJha2kgYXlhIGRlxJ9pxZ90aXIAIyhTb25y
YWtpIGF5xLEgZ8O2c3Rlcm1layBpw6dpbiBrYXlkxLFyxLFuACctU29ucmFraSB5xLFsbGFyxLEg
Z8O2c3Rlcm1layBpw6dpbiBrYXlkxLFyxLFuAA4PU29yZ3V5dSBnw7ZuZGVyAA8PU29yZ3V5dSB0
ZW1pemxlABIVU8O8csO8a2xlbWUgdHV0YW1hY8SxABcZVGFrdmltIGdpcmnFnyBtb2R1bmEgZ2XD
pwAFBVRhcmloAAkKVGFyaWggc2XDpwAxOVRhcmloLCBpc3RlbmVuICUxJHMgLSAlMiRzIHnEsWwg
YXJhbMSxxJ/EsW7EsW4gZMSxxZ/EsW5kYQAnKlRhcmloLCBpc3RlbmVuIGJpw6dpbWxlIGXFn2xl
xZ9taXlvcjogJTEkcwAcHFRhcmloZSBpemluIHZlcmlsbWl5b3I6ICUxJHMADw9UYXJpaGxlcmkg
Z2lyaW4ADxBUYXJpaGxlcmkgc2XDp2luAA0RVMO8bcO8bsO8IGfDtnN0ZXIABwhZYW7EsXRsYQAD
A1lvawAKC1l1a2FyxLEgZ2l0AAsMWcO8emRlICUxJGQuABofWcSxbCBzZcOnaWNpIGfDtnLDvG7D
vHIgZHVydW1kYQAQE1nEsWwgc2XDp2ltaW5lIGdlw6cABgdib8WfbHVrAAYGZGFraWthAAQEc2Fh
dAADA3NpbAACA8OWUwATFsOWbmNla2kgYXlhIGRlxJ9pxZ90aXIAIijDlm5jZWtpIGF5xLEgZ8O2
c3Rlcm1layBpw6dpbiBrYXlkxLFyxLFuACYtw5ZuY2VraSB5xLFsbGFyxLEgZ8O2c3Rlcm1layBp
w6dpbiBrYXlkxLFyxLFuACAkw5ZuZXJpbGVyaSBhxZ9hxJ/EsWRhIGJ1bGFiaWxpcnNpbml6ABMX
w5bDliB2ZXlhIMOWUyd5aSBzZcOnaW4ADQ7DnHN0IEthcmFrdGVyKwAPEcSwbGV0acWfaW0ga3V0
dXN1AAUGxLBwdWN1AA8RxZ51bnVubGEgcGF5bGHFnzoACg8lMSRkINmB24zYtdiv25QAFiYlcyDa
qduSINiz2KfYqtq+INin2LTYqtix2KfaqSDaqdix24zaugAEBCs5OTkABQdBbHQr4oCOAAoMRnVu
Y3Rpb24r4oCOAAYITWVudSvigI4ABghNZXRhK+KAjgAHCVNoaWZ0K+KAjgAFB1N5bSvigI4AAgTY
otisAAIE2KLZgQAFCdii2YEg24HbkgACBNii2YYABQnYotmGINuB25IAFijYp9izINqp25Ig2LPY
p9iq2r4g2KfYtNiq2LHYp9qpINqp2LHbjNq6ABIi2KfYs9iq2YHYs9in2LEg2KzZhdi5INqp2LHY
p9im24zaugAQHtin2LPYqtmB2LPYp9ixINi12KfZgSDaqdix24zaugARINin2YjZvtixINmG24zZ
iNuM2q/bjNm5INqp2LHbjNq6AAwW2KfZkNmGINqp2YXZhtqvINqp2KfZhAAYLNin2ZDZhiDaqdmF
2YbaryDaqdin2YQg2qnbjCDYp9iz2qnYsduM2YbZhtqvABcq2Kfar9mE25Ig2YXYp9uBINmF24za
uiDYqtio2K/bjNmEINqp2LHbjNq6ACxQ2Kfar9mE25Ig2YXbgduM2YbbkiDaqdinINqI24zZudin
INiv2qnavtin2YbbkiDaqduSINmE24zbkiDYp9iz2qnYsdmI2YQg2qnYsduM2roAEiHYp9uM2qkg
2KfbjNm+INmF2YbYqtiu2Kgg2qnYsduM2roAZIC02KfbjNqpINiz2KfZhCDZhdmG2KrYrtioINqp
2LHZhtuSINqp25Ig2YTbjNuSINiz2YjYp9im2b4g2qnYsduM2rog24zYpyDYp9uM2qkg2K/ZhiDZ
hdmG2KrYrtioINqp2LHZhtuSINqp24wg2K7Yp9i32LEg2K/ZiNio2KfYsduBINiz2YjYptqGINqp
2LHZhtuSINqp25Ig2YTbjNuSINiq2r7Zvtiq2r7Zvtin2KbbjNq6ACdG2KfbjNqpINiz2KfZhCDa
qdinINin2YbYqtiu2KfYqCDaqdix2YbbkiDaqduSINmE24zbkiDYs9mI2KbahiDaqdix24zaugAL
Fdio2LHYrtin2LPYqiDaqdix24zaugAMFtio2LnYryDYp9iyINiv2YjZvtuB2LEALlPYqNi52K8g
2qnbkiDYs9in2YTZiNq6INqp2Kcg2ojbjNm52Kcg2K/aqdq+2KfZhtuSINqp25Ig2YTbjNuSINin
2LPaqdix2YjZhCDaqdix24zaugAKE9iq2KfYsduM2K4g2KLYutin2LIADBfYqtin2LHbjNiuINin
2K7Yqtiq2KfZhQAQHtiq2KfYsduM2K4g2YXZhtiq2K7YqCDaqdix24zaugAYKtiq2KfYsduM2K4g
2qnbjCDYrdivINqp2Kcg2LrZhNi3INin2YYg2b7ZuQAPHNiq2YTYp9i0INqp2Kcg2KfYs9iq2YHY
s9in2LEACRHYqtmE2KfYtCDaqdix24zaugAKFNiq2YTYp9i0INqp2LHbjNq64oCmAB432KrZhNin
2LQg2qnbjCDYqtis2KfZiNuM2LIg2YbbjNqG25Ig2K/Ys9iq24zYp9ioINuB24zaugAPHNiq2YjY
p9ix24zYriDYr9ix2Kwg2qnYsduM2roAESDYqtmI2KfYsduM2K4g2YXZhtiq2K7YqCDaqdix24za
ugAID9is2KfYsduMINqp2KfZhAAUJNis2LLZiNuMINi32YjYsSDZvtixINqG24zaqSDaqdix2K/b
gQAID9is2YjYp9ioINiv24zaugAOGtiv2LHYrCDaqdix2K/bgSDYqtin2LHbjNiuAAsU2LHbjNmG
2Kwg2YXbjNq6INuB25IADhrYsduM2YbYrCDaqdinINin2K7Yqtiq2KfZhQAOGtix24zZhtisINqp
24wg2LTYsdmI2LnYp9iqABov2LPYp9mEINqp2Kcg2YXZhtiq2K7YqCDaqdmG2YbYr9uBINmF2LHY
ptuMINuB25IACxXYs9io2r7bjCDYr9uM2qnavtuM2roABAjYs9mI2KbahgAJEdiz2qnbjNqR2Kcg
2q/bjNinAAYM2LPaqduM2pHbjNq6AAwW2LTbjNm5INio2YbYryDaqdix24zaugAJEdi12YjYqtuM
INiq2YTYp9i0AAkQ2LrZhNi3INin2YYg2b7ZuQAOGti624zYsSDZhdmG2KrYrtioINqp2LHYr9uB
ACdG2YLYqNmEINin2LIg2K/ZiNm+24HYsSDbjNinINio2LnYryDYp9iyINiv2YjZvtuB2LEg2YXZ
htiq2K7YqCDaqdix24zaugAMGNmC2KjZhOKAjNin2LIg2K/ZiNm+24HYsQANGdmF2LLbjNivINin
2K7YqtuM2KfYsdin2KoAChPZhdiz2KrYsdivINqp2LHbjNq6AAoT2YXZhtiq2K7YqCDaqdix2K/b
gQAQHtmF2YbYqtiu2Kgg2qnYsdiv24Eg2KrYp9ix24zYrgAMFtmF2YbZgti32Lkg2qnYsSDYr9uM
2roAAwbZhdmG2bkAChLZhdmG2bkg2qnbkiDZhNuM25IADxzZhdmG2bnYsyDZhdmG2KrYrtioINqp
2LHbjNq6AA4b2YbbjNmI24zar9uM2LTZhiDZhduM2YbbjNmIABcr2YbbjNmI24zar9uM2LTZhiDZ
hduM2YbbjNmIINio2YbYryDaqdix24zaugAaL9mG24zahtuSINqp24wg2LTbjNm5INqp2Ygg2KjY
sdiu2KfYs9iqINqp2LHbjNq6ABUm2YbbjNqG25Ig2qnbjCDYtNuM2bkg2qnZiCDYs9qp24zakduM
2roAFyrZhtuM2obbkiDaqduMINi024zZuSDaqdmIINm+2r7bjNmE2KfYptuM2roABQrZiNuM2ojb
jNmIAAYL2bnZiNmEINm52b4ADhrZudmI2YQg2bnZviDYr9qp2r7Yp9im24zaugADBtm524zYqAAg
Otm524zaqdiz2bkg2KfZhtiv2LHYp9isINqp25Ig2LfYsdiyINm+2LEg2LPZiNim2oYg2qnYsduM
2roACxTZvtin2b4g2KfZviDZiNmG2ojZiAAtUtm+2obavtmE25Ig2LPYp9mE2YjauiDaqdinINqI
24zZudinINiv2qnavtin2YbbkiDaqduSINmE24zbkiDYp9iz2qnYsdmI2YQg2qnYsduM2roALVLZ
vtqG2r7ZhNuSINmF24HbjNmG25Ig2qnYpyDaiNuM2bnYpyDYr9qp2r7Yp9mG25Ig2qnbkiDZhNuM
25Ig2KfYs9qp2LHZiNmEINqp2LHbjNq6AAsV2b7avtuM2YTYp9uM2Kcg2q/bjNinAAoT2b7bjNi0
2LHZgdiqINmF24zaugAGDNqI2KfYptmE2KfarwAPHNqI2LHYp9m+INqI2KfYpNmGINmF24zZhtuM
2YgACRHaqdmI2KbbjCDZhtuB24zaugAhPNqp24zZhNmG2ojYsSDYp9mG2K/Ysdin2Kwg2qnbkiDY
t9ix2LIg2b7YsSDYs9mI2KbahiDaqdix24zaugAYLNqv2LLYtNiq24Eg2YXYp9uBINmF24zauiDZ
hdmG2KrZgtmEINqp2LHbjNq6ABcq2q/avtixINqp24wg2LfYsdmBINmG24zZiNuM2q/bjNm5INqp
2LHbjNq6ABAe2q/avtiz24zZudmG25Ig2qnYpyDbgduM2YbaiNmEAAUK2q/avtmG2bnbgQAQHtqv
2r7Zhtm524Eg2YXZhtiq2K7YqCDaqdix24zaugAMFtqv2r7Zhtm525Ig2qnbkiDZhNuM25IABgvb
gdmIINqv24zYpwAKEOKAjyUxJGQg2YXZhtm52LMAKUfigI/Yqtin2LHbjNiuINmF2KrZiNmC2Lkg
2b7bjNm52LHZhiDYs9uSINmF2YXYp9ir2YQg2YbbgduM2rog24HbkjogJTEkcwAdMeKAj9iq2KfY
sduM2K4g2qnbjCDYp9is2KfYstiqINmG24HbjNq6INuB25I6ICUxJHMAFSPigI/Yr9ix2Kwg2qnY
sdiv24Eg2KrYp9ix24zYrjogJTEkcwAaLuKAj9iz2KfZhCDigI4lMSRzINm+2LEg2YbbjNmI24za
r9uM2bkg2qnYsduM2roALkvigI/Zhdiq2YjZgti5INiz2KfZhCDaqduMINit2K8gJTEkc+KAjyAt
ICUyJHMg2LPbkiDYqNin24HYsSDaqduMINiq2KfYsduM2K4AFSXigI/ZhdmI2KzZiNiv24Eg2KfZ
htiq2K7Yp9ioOiDigI4lMSRzAAoR4oCP4oCOJTEkZCDYqNis25IADBXigI/igI4lMSRkINqv2r7Z
htm525IACxclMSRkIOCmrOCmvuCmnOCmv+Cmm+CnhwALFyUxJGQg4Ka24Kak4Ka+4KaC4Ka24KWk
AAgSJWQg4KaY4Kaj4KeN4Kaf4Ka+AAgSJWQg4Kau4Ka/4Kao4Ka/4KafABg+JXPgp7Ag4Kac4Kew
4Ka/4Kav4Ka84Kak4KeHIOCmtuCnjeCmrOCnh+Cmr+CmvOCmvuCnsCDgppXgp7DgppUABgZTZWFy
Y2gABQVzcGFjZQAMIuCmheCml+CnjeCnsOCmvuCmueCnjeCmryDgppXgp7DgppUACx/gpoXgpqfg
pr/gppUg4Kas4Ka/4KaV4Kay4KeN4KaqAAIG4KaF4KaoAAoa4KaF4KaoIOCmleCnsOCmviDgpobg
ppvgp4cAG0HgpoXgpqjgp4Hgpq7gp4vgpqbgpr/gpqQg4Kao4KeL4Ka54KeL4Kex4Ka+IOCmpOCm
vuCnsOCmv+CmljogJTEkcwANJeCmheCmqOCnjeCmpOCnsOCnjeCml+CmvuCmruCngCDgppXgprIA
AgbgpoXgpqsABhDgpoXgpqsg4KaG4Kab4KeHAAwi4KaF4Kau4Ka+4Kao4KeN4KavIOCmh+CmqOCm
quCngeCmnwAaSOCmheCmruCmvuCmqOCnjeCmryDgpqTgpr7gp7Dgpr/gppbgp7Ag4Kaq4Kew4Ka/
4Ka44Kew4KewIOCmh+CmqOCmquCngeCmnwAaSOCmhuCmguCmtuCmv+CmleCmreCmvuCnseCnhyDg
pqrgp7Dgp4DgppXgp43gprfgpr4g4KaV4Kew4Ka+IOCmueCniOCmm+CnhwAgWOCmhuCml+CnsCDg
pqzgppvgp7Dgpqzgp4vgp7Ag4Kam4KeH4KaW4KeB4Kex4Ka+4Kas4Kay4KeIIOCmuOCnjeCmleCn
jeCnsOKAmeCmsiDgppXgp7DgppUAAwngpobgppzgpr8ADijgpobgp7Dgpq7gp43gpq3gpqPgpr/g
p7Ag4Kak4Ka+4Kew4Ka/4KaWABpI4KaH4Kav4Ka84Ka+4KewIOCmnOCnsOCmv+Cmr+CmvOCmpOCn
hyDgprbgp43gpqzgp4fgpq/gprzgpr7gp7Ag4KaV4Kew4KaVAAsf4KaJ4Kak4KeN4Kak4KewIOCm
puCmv+Cmr+CmvOCmlQAHE+Cmj+CmleCniyDgpqjgpr7gpocAJ2ngpo/gpp/gpr4g4KaF4Kao4KeN
4Kak4Kew4KeN4KaX4Ka+4Kau4KeAIOCmleCmsuCnsCDgpqrgp7Dgp4DgppXgp43gprfgpr4g4KaV
4Kew4Ka/IOCmpeCmleCmviDgprngp4jgppvgp4cAUoDa4KaP4Kaf4Ka+IOCmrOCmm+CnsCDgpqzg
pr7gppvgpqjgpr8g4KaV4Kew4Ka/4Kas4Kay4KeIIOCmm+Cni+CnseCmvuCmh+CmqiDgppXgp7Dg
ppUg4KaF4Kal4Kas4Ka+IOCmj+Cmn+CmviDgpqbgpr/gpqgg4Kas4Ka+4Kab4Kao4Ka/IOCmleCn
sOCmvuCnsCDgprjgp4Hgpqzgpr/gpqfgpr7gpp/gp4vgprLgp4gg4KaJ4Kat4Kak4Ka/IOCmr+Cm
vuCmrOCmsuCniCDgpp/gpr/gpqrgppUAChzgppPgpqrgp7DgprLgp4gg4Kav4Ka+4KaT4KaVABhE
4KaV4Kaj4KeN4Kag4Kan4KeN4Kas4Kao4Ka/4KewIOCmpuCnjeCmrOCmvuCnsOCmviDgprjgpqjg
p43gpqfgpr7gpqgADSPgppXgprIg4KaV4Ka+4Kaf4Ka/IOCmpuCmv+Cmr+CmvOCmlQAeUuCmleCn
h+CmsuCnh+Cmo+CnjeCmoeCmvuCnsCDgpofgpqjgpqrgp4Hgpp8g4Kau4oCZ4Kah4Kay4KeIIOCm
uOCmsuCmqOCmvyDgppXgp7DgppUAEjDgppXgp4vgpqjgp4sg4KaP4Kaq4KeNIOCmrOCmvuCmm+Cm
qOCmvyDgppXgp7DgppUAES/gppfgp4Pgprkg4Kaq4KeD4Ka34KeN4Kag4Ka+4Kay4KeIIOCmr+Cm
vuCmk+CmlQAFD+CmmOCmo+CnjeCmn+CmvgAPKeCmmOCmo+CnjeCmn+CmviDgpqzgpr7gppvgpqjg
pr8g4KaV4Kew4KaVAAsf4KaY4Kaj4KeN4Kaf4Ka+4KewIOCmrOCmvuCmrOCnhwAKGuCmmuCmsuCm
vyDgpqXgppXgpr4g4KaV4KayAAQM4Kab4KeB4KaH4KaaAAYS4Kaf4KeB4Kay4Kaf4Ka/4KaqAA8r
4Kaf4KeB4Kay4Kaf4Ka/4KaqIOCmpuCnh+CmluCngeCnseCmvuCmk+CmlQADCeCmn+Cnh+CmrAAH
FeCmoeCmvuCmr+CmvOCmsuKAmeCmlwAOKOCmoeCnjeCnsOCmquCmoeCmvuCmieCmqOCnsCDgpq7g
p4fgpqjgp4EADSXgpqHgp43gp7Dgp4fgppcg4Ka54KeH4Kaj4KeN4Kah4KeH4KayABhC4Kak4Kay
4KakIOCmquCnsOCmvuCmruCnsOCnjeCmtiDgpqbgp4fgppbgp4HgppPgp7Hgpr4g4Ka54KeI4Kab
4KeHABhC4Kak4Kay4KewIOCmtuCnjeCmrOCngOCmn+CmluCmqCDgpoXgppfgp43gp7Dgpr7gprng
p43gpq8g4KaV4Kew4KaVABc/4Kak4Kay4KewIOCmtuCnjeCmrOCngOCmn+CmluCmqCDgpqzgpr/g
prjgp43gpqTgpr7gp7Ag4KaV4Kew4KaVABY84Kak4Kay4KewIOCmtuCnjeCmrOCngOCmn+CmluCm
qCDgprjgpoLgppXgp4vgpprgpqgg4KaV4Kew4KaVAAUP4Kak4Ka+4Kew4Ka/4KaWAAsf4Kak4Ka+
4Kew4Ka/4KaWIOCmpuCmv+Cmr+CmvOCmlQAPKeCmpOCmvuCnsOCmv+CmliDgpqzgpr7gppvgpqjg
pr8g4KaV4Kew4KaVADJ+4Kak4Ka+4Kew4Ka/4KaW4Kaf4KeLIOCmj+CmhyDgpqrgp43gp7DgpqTg
p43gpq/gpr7gprbgpr/gpqQg4KaG4Kew4KeN4Ka54Ka/4Kaf4KeL4KewIOCmuOCniOCmpOCnhyDg
pq7gpr/gprLgpr4g4Kao4Ka+4KaHOiAlMSRzADFz4Kak4Ka+4Kew4Ka/4KaW4Kaf4KeLIOCmquCn
jeCnsOCmpOCnjeCmr+CmvuCmtuCmv+CmpCDgpqzgppvgp7Dgp7Ag4Kaq4Kew4Ka/4Ka44KewICUx
JHMgLSAlMiRz4KewIOCmrOCmvuCmueCmv+CnsOCnsAALH+CmpuCmv+Cmr+CmvOCmviDgpqTgpr7g
p7Dgpr/gppYAESXgpqbgpr/gpq/gprzgpr4g4Kak4Ka+4Kew4Ka/4KaWOiAlMSRzAA8r4Kao4KeH
4Kat4Ka/4KaX4KeH4Ka24KeN4Kas4KaoIOCmruCnh+CmqOCngQAYQuCmqOCnh+CmreCmv+Cml+Cn
h+CmtuCnjeCmrOCmqCDgpq7gp4fgpqjgp4Eg4Kas4Kao4KeN4KanIOCmleCnsOCmlQAMIOCmquCm
qi3gpobgpqog4Kex4Ka/4Kaj4KeN4Kah4oCZACFb4Kaq4Ka+4Kab4KewIOCmrOCmm+CnsOCmrOCn
i+CnsCDgpqbgp4fgppbgp4Hgp7Hgpr7gpqzgprLgp4gg4Ka44KeN4KaV4KeN4Kew4oCZ4KayIOCm
leCnsOCmlQAYQOCmquCmvuCmoCDgpofgpqjgpqrgp4Hgpp8g4Kau4oCZ4Kah4Kay4KeIIOCmuOCm
suCmqOCmvyDgppXgp7DgppUABAzgpqrgp4Hgp7Hgpr4AIFjgpqrgp4Lgp7Dgp43gpqzgpr7gprng
p43gpqgg4KaF4Kal4Kas4Ka+IOCmheCmquCnsOCmvuCmueCnjeCmqCDgpqzgpr7gppvgpqjgpr8g
4KaV4Kew4KaVACZq4Kaq4KeC4Kew4KeN4Kas4Kex4Kew4KeN4Kak4KeAIOCmruCmvuCmueCmn+Cn
iyDgpqbgp4fgppbgp4Hgp7Hgpr7gpqzgprLgp4gg4Ka44KeN4KaV4KeN4Kew4oCZ4KayIOCmleCn
sOCmlQAZReCmquCnguCnsOCnjeCmrOCnseCnsOCnjeCmpOCngCDgpq7gpr7gprngprLgp4gg4Ka4
4Kay4Kao4Ka/IOCmleCnsOCmlQAaSOCmquCnjeCnsOCmleCnjeCnsOCmv+Cmr+CmvOCmvuCmleCn
sOCmoyDgppXgp7Dgpr8g4Kal4KaV4Ka+IOCmueCniOCmm+CnhwAQLuCmquCnjeCnsOCmpOCnjeCm
r+CmvuCmluCnjeCmr+CmvuCmqCDgppXgp7DgppUAECzgpqrgp43gp7Dgprbgp43gpqgg4Kam4Ka+
4KaW4Ka/4KayIOCmleCnsOCmlQAGEuCmquCnsOCmvuCmueCnjeCmqAAOKOCmquCnsOCmv+CmuOCn
sOCnsCDgpobgp7Dgpq7gp43gpq3gpqPgpr8AECzgpqrgp7Dgpr/gprjgp7Dgp7Ag4Kat4Ka/4Kak
4Kew4KakIOCmhuCmm+CnhwAOKOCmquCnsOCmv+CmuOCnsOCnsCDgprjgpq7gpr7gpqrgp43gpqTg
pr8AI2Hgpqrgp7Dgp7Hgp7Dgp43gpqTgp4Ag4Kau4Ka+4Ka54Kaf4KeLIOCmpuCnh+CmluCngeCn
seCmvuCmrOCmsuCniCDgprjgp43gppXgp43gp7DigJngprIg4KaV4Kew4KaVABY84Kaq4Kew4Kex
4Kew4KeN4Kak4KeAIOCmruCmvuCmueCmsuCniCDgprjgprLgpqjgpr8g4KaV4Kew4KaVABMz4Kas
4Kab4KewIOCmrOCmvuCmm+CmqOCmvyDgppXgp7Dgpr7gp7Ag4Kab4KeB4KaH4KaaABdB4Kas4Kab
4KewIOCmrOCmvuCmm+CmqOCmv+CmleCnsOCnjeCmpOCmviDgpqbgp4Pgprbgp43gpq/gpq7gpr7g
pqgADyngpqzgpr7gppvgpqjgpr8g4KaV4Kew4Ka+IOCmpOCmvuCnsOCmv+CmlgAOJuCmrOCmvuCm
m+CmqOCmvyDgppXgp7Dgpr4g4Ka54KeI4Kab4KeHABIw4Kas4Ka+4Kab4Kao4Ka/IOCmleCnsOCm
viDgprngp4vgp7Hgpr4g4Kao4Ka+4KaHAA8p4Kas4Ka/4Ka44KeN4Kak4Ka+4KewIOCmleCnsOCm
viDgpobgppvgp4cAFC7gpqzgp7Dgp43gpqTgpq7gpr7gpqjgp7Ag4Kas4Ka+4Kab4Kao4Ka/OiAl
MSRzABg64Kas4Kew4KeN4Ka3ICUxJHPgprLgp4gg4Kao4KeH4Kat4Ka/4KaX4KeH4oCZ4KafIOCm
leCnsOCmlQAGEuCmreCmv+CmoeCmv+CmheKAmQAFD+CmruCmv+CmqOCmv+CmnwAPKeCmruCmv+Cm
qOCmv+CmnyDgpqzgpr7gppvgpqjgpr8g4KaV4Kew4KaVAAsf4Kau4Ka/4Kao4Ka/4Kaf4KewIOCm
rOCmvuCmrOCnhwAOJuCmtuCnjeCmrOCngOCmnyDgpqzgpqjgp43gpqcg4KaV4Kew4KaVAAoc4Ka4
4KaC4KaV4KeL4Kaa4KaoIOCmleCnsOCmlQAOJuCmuOCmguCmleCni+CmmuCmqCDgppXgp7Dgpr4g
4KaG4Kab4KeHAAkZ4Ka44KaV4Kay4KeLIOCmmuCmvuCmk+CmlQAKHOCmuOCmqOCnjeCmp+CmvuCm
qCDgppXgp7DgppUACx/gprjgpqjgp43gpqfgpr7gpqgg4KaV4Kew4KaV4oCmABEv4Ka44Kao4KeN
4Kan4Ka+4KaoIOCmleCnsOCmviDgpqrgp43gp7Dgprbgp43gpqgAFTngprjgpqjgp43gpqfgpr7g
pqgg4KaV4Kew4Ka+IOCmquCnjeCnsOCmtuCnjeCmqCDgpq7gpprgppUADijgprjgpq7gpr7gpqrg
p43gpqTgpr/gp7Ag4Kak4Ka+4Kew4Ka/4KaWAAsf4Ka44Kau4KeN4Kaq4Kao4KeN4KaoIOCmueKA
meCmsgAECuCnr+Cnr+CnrysABgYlMSRkIGgAFxhCaXJhxI0gZ29kaW5lIGplIHZpZGxqaXYALTBE
YXR1bSBqZSBpenZhbiBvxI1la2l2YW5vZyByYXNwb25hICUxJHMg4oCTICUyJHMAMzREYXR1bWkg
c2UgbmUgcG9kdWRhcmFqdSBzIG/EjWVraXZhbmltIG9icmFzY2VtOiAlMSRzAA8QRGlqYWxvxaFr
aSBva3ZpcgAaGkRpamVsaSBwdXRlbSBhcGxpa2FjaWplICVzAAkJRGlqZWxpIHNhABMVRGplbGlt
acSNbm8gb3puYcSNZW5vABsbRmlsdHJpcmFuamUgZG9sYXpub2cgcG96aXZhABYXR2xhc292bm8g
cHJldHJhxb5pdmFuamUACAhJZGkgZ29yZQAnKEtsaXpuaXRlIGRhIHNlIHByaWthxb5lIHByZXRo
b2RuaSBtamVzZWMAJihLbGl6bml0ZSBkYSBzZSBwcmlrYcW+ZSBzbGplZGXEh2kgbWplc2VjACUm
S2xpem5pdGUgZGEgc2UgcHJpa2HFvnUga2FzbmlqZSBnb2RpbmUAJCVLbGl6bml0ZSBkYSBzZSBw
cmlrYcW+dSByYW5pamUgZ29kaW5lAAwMS3JhaiByYXNwb25hAAYGTWludXRhABweTmV2YcW+ZcSH
aSB1bm9zIHJhc3BvbmEgZGF0dW1hAA0NTmlqZSBvZGFicmFubwALDE9icmnFoWkgdXBpdAAUFE9k
YWJlcml0ZSBhcGxpa2FjaWp1AA8PT2RhYmVyaXRlIGRhdHVtABAQT2RhYmVyaXRlIGRhdHVtZQAQ
EE9kYWJlcml0ZSBtaW51dGUAJSVPZGFiZXJpdGUgcHJpamVwb2RuZSBpbGkgcG9zbGlqZXBvZG5l
AA4OT2RhYmVyaXRlIHNhdGUADQ1PZGFiaXIgZGF0dW1hAA4OT2RhYnJhbmkgZGF0dW0ACAhPZGFi
cmFubwAGBk9kYmFjaQALC09kYmFjaXZhbmplABgYT2RiYWNpdmFuamUgZG9uamUgdGFiZWxlABcX
T2RsYXphayBuYSAlMSRzLiBnb2RpbnUADQ5Qb2dyZcWhYW4gdW5vcwAMDFBveml2IHUgdG9rdQAP
EFBvxI1ldGFrIHJhc3BvbmEADA1Qb8WhYWxqaSB1cGl0ABgYUHJlYmFjaSBuYSBvZGFiaXIgZ29k
aW5lACorUHJlYmFjaXZhbmplIG5hIG5hxI1pbiByYWRhIHVub3NhIGthbGVuZGFyYQAnKFByZWJh
Y2l2YW5qZSBuYSBuYcSNaW4gcmFkYSB1bm9zYSB0ZWtzdGEACAlQcmV0cmHFvmkADQ5QcmV0cmHF
vmkgdXBpdAANDlByZXRyYcW+aXRlLi4uAA0OUHJldHJhxb5pdmFuamUASEhQcmV2dWNpdGUgZGEg
b2RhYmVyZXRlIGdvZGludSBpbGkgZG9kaXJuaXRlIGRhIHNlIHZyYXRpdGUgbmEgb2RhYmlyIGRh
bmEAGBhQcmlqZWRsb3ppIHN1IHUgbmFzdGF2a3UAExVQcmlrYcW+aSBza2/EjW5pIG9waXMACQlQ
cm9taWplbmkAHR1Qcm9taWplbmkgbmEgcHJldGhvZG5pIG1qZXNlYwAcHVByb21pamVuaSBuYSBz
bGplZGXEh2kgbWplc2VjAAkKUHJvxaFpcmVubwAZGlByb8WhaXJpdmFuamUgZG9uamUgdGFiZWxl
ABUXUnXEjWljYSB6YSBwcmV2bGHEjWVuamUACwxTa2/EjW5pIG9waXMADQ5Ta2/EjW5pIHByb3pv
cgAEBFN1emkAFhdTdcW+YXZhbmplIGRvbmplIHRhYmVsZQAGB1N1xb5lbm8AFRVUcmVudXRuaSBv
ZGFiaXI6ICUxJHMADw9VbmVzZW4gamUgZGF0dW0AFRVVbmVzZW4gamUgZGF0dW06ICUxJHMACwxW
acWhZSBvcGNpamEAHh9WcmF0aXRlIHNlIG5hIHBvxI1ldG51IHN0cmFuaWN1AB4eWmF0dmFyYW5q
ZSBuYXZpZ2FjaW9ub2cgbWVuaWphABERWmF0dmFyYW5qZSB0YWJlbGUADAxwb3NsaWplcG9kbmUA
BQVwcmlqLgAGBnJhem1hawAGBnphIHNhdAANDSUxJGQgcHJvY2VudC4ACgslMSRkwqBob2RpbgAK
CyUxJGTCoG1pbnV0ABQYQWt0dcOhbG7DrSB2w71ixJtyOiAlMSRzAA4RRGFsxaHDrSBtb8W+bm9z
dGkAKjBEYXR1bSBtaW1vIG/EjWVrw6F2YW7DvSByb3pzYWggcm9rxa8gJTEkc+KAkyUyJHMAKC1E
YXR1bSBuZW9kcG92w61kw6Egb8SNZWvDoXZhbsOpbXUgdnpvcnU6ICUxJHMADhBEYXR1bSB1a29u
xI1lbsOtAA4QRGF0dW0gemFow6FqZW7DrQAOD0RpYWxvZ292w6kgb2tubwAEBERuZXMAFRhEb3Rh
eiBwcm8gdnlobGVkw6F2w6Fuw60AAwNGbisAExdIbGFzb3bDqSB2eWhsZWTDoXbDoW7DrQAGBkhs
ZWRhdAAGBkhvZGluYQAGBkhvdG92bwATFkplIHZpZMSbdCB2w71ixJtyIHJva3UABQVLYXJ0YQAN
DUtvbmVjIHJvenNhaHUAERROYXZpZ2HEjW7DrSBuYWLDrWRrYQAPEU5lcGxhdG7DqSBvYmRvYsOt
AA0PTmVwbGF0bsO9IMO6ZGFqABYXTmVwb3ZvbGVuw6kgZGF0dW06ICUxJHMACQpOZXZ5YnLDoW5v
AA0QTsOhdnJoIGplIG7DrcW+ZQANDU9kZXNsYXQgZG90YXoACQpPZG3DrXRub3V0AAcHUG9waXNl
awAfJVBvc3VudXTDrW0gem9icmF6w610ZSBkYWzFocOtIG3Em3PDrWMAISZQb3N1bnV0w61tIHpv
YnJhesOtdGUgcG96ZMSbasWhw60gcm9reQAjKVBvc3VudXTDrW0gem9icmF6w610ZSBwxZllZGNo
b3rDrSBtxJtzw61jACImUG9zdW51dMOtbSB6b2JyYXrDrXRlIHDFmWVkY2hvesOtIHJva3kAERRQ
cm9iw61oYWrDrWPDrSBob3ZvcgAHCVByb2LDrWjDoQAdJFByb3bEm8WZb3bDoW7DrSBwxZnDrWNo
b3rDrWhvIGhvdm9ydQBBSFDFmWVqZXTDrW0gcHJzdGVtIHZ5YmVydGUgcm9rIG5lYm8gc2Uga2xl
cG51dMOtbSB2cmHFpXRlIGvCoHbDvWLEm3J1IGRuZQAVG1DFmWVqw610IG5hIGRhbMWhw60gbcSb
c8OtYwAQElDFmWVqw610IG5hIHBsb2NodQAZH1DFmWVqw610IG5hIHDFmWVkY2hvesOtIG3Em3PD
rWMAEhRQxZllasOtdCBuYSByb2sgJTEkcwAND1DFmWVqw610IG5haG9ydQAICVDFmWVwbm91dAAn
LlDFmWVwbm91dCBuYSByZcW+aW0gemFkw6F2w6Fuw60gZG8ga2FsZW5kw6HFmWUAICVQxZllcG5v
dXQgbmEgcmXFvmltIHphZMOhdsOhbsOtIHRleHR1ABYZUMWZZXBub3V0IG5hIHbDvWLEm3Igcm9r
dQAICVDFmWlqbW91dAAOEVDFmcOtY2hvesOtIGhvdm9yAAkJUm96YmFsZW5vABcYUm96YmFsaXQg
c3BvZG7DrSB0YWJ1bGt1ABMVUm96YmFsb3ZhY8OtIG5hYsOtZGthAAcHU2JhbGVubwAGBlNiYWxp
dAAVFlNiYWxpdCBzcG9kbsOtIHRhYnVsa3UACAlTZMOtbGV0IHMAFBdTZMOtbGV0IHPCoGFwbGlr
YWPDrSAlcwAMDFNtYXphdCBkb3RhegAJCVYgcm96c2FodQADA1ZZUAASElZ5YmVydGUgQU0gbmVi
byBQTQAMDFZ5YmVydGUgZGF0YQAODlZ5YmVydGUgbWludXR5AA0OVnlicmFuw6kgZGF0dW0ADw9W
eWJyYXQgYXBsaWthY2kADAxWeWJyYXQgZGF0dW0ADQ1WeWJyYXQgaG9kaW51AAcIVnlicsOhbm8A
CQtWeWhsZWRhdOKApgAHB1Z5cG51dG8AEBFWeXNrYWtvdmFjw60gb2tubwADA1pBUAAMDVphZGFu
w6kgZGF0dW0AEhNaYWRhbsOpIGRhdHVtOiAlMSRzAAwMWmFkZWp0ZSBkYXRhAAcHWmFwbnV0bwAH
CFphdsSbc2l0AAYIWmF2xZnDrXQAFhpaYXbFmcOtdCBuYXZpZ2HEjW7DrSBwYW5lbAAMD1phdsWZ
w610IHNlxaFpdAAVGFphdsWZw610IHNwb2Ruw60gdGFidWxrdQAPEVphxI3DoXRlayByb3pzYWh1
ABAQWm9icmF6aXQgcG9waXNlawAMDVpvYnJheml0IHbFoWUACAltZXplcm7DrWsACgpwcm8gaG9k
aW51AAoKcHJvIG1pbnV0eQATF8OaY2h5dCBwcm8gcMWZZXRhxb5lbsOtABMYxIzDoXN0ZcSNbsSb
IHphxaFrcnRudXRvAAUIxb3DoWRuw6kADg4lMSRkIHBvciBjaWVuLgAICEFDVElWQURPAAgIQWN0
aXZhZG8AHBxDYW1iaWFyIGFsIG1vZG8gZGUgZXNjcml0dXJhAC0uQ2FtYmlhciBhbCBtb2RvIGRl
IGludHJvZHVjY2nDs24gZGUgY2FsZW5kYXJpbwAfIENhbWJpYXIgcGFyYSBzZWxlY2Npb25hciB1
biBhw7FvAAYGQ2VycmFyABkbQ2VycmFyIG1lbsO6IGRlIG5hdmVnYWNpw7NuABcXQ2llcnJhIGxh
IGhvamEgaW5mZXJpb3IAFBVDb25zdWx0YSBkZSBiw7pzcXVlZGEAGBhDb250cmFlIGxhIGhvamEg
aW5mZXJpb3IAERJDdWFkcm8gZGUgZGnDoWxvZ28ACwtERVNBQ1RJVkFETwAUFERlbnRybyBkZWwg
aW50ZXJ2YWxvAAsLRGVzYWN0aXZhZG8AFRZEZXNjcmlwY2nDs24gZW1lcmdlbnRlAE9RRGVzbGl6
YSBlbCBkZWRvIHBhcmEgc2VsZWNjaW9uYXIgdW4gYcOxbyBvIHRvY2EgcGFyYSB2b2x2ZXIgYSBz
ZWxlY2Npb25hciB1biBkw61hABgYRGVzcGxhemFyc2UgaGFjaWEgYXJyaWJhAAoKRGVzcGxlZ2Fk
bwAaGkRlc3BsaWVnYSBsYSBob2phIGluZmVyaW9yACQlRGVzcGzDoXphdGUgcGFyYSB2ZXIgZWwg
bWVzIHNpZ3VpZW50ZQAnKURlc3Bsw6F6YXRlIHBhcmEgdmVyIGxvcyBhw7FvcyBhbnRlcmlvcmVz
ACMkRWwgaW50ZXJ2YWxvIGRlIGZlY2hhcyBubyBlcyB2w6FsaWRvAAcHRXNwYWNpbwA3OEZlY2hh
IGZ1ZXJhIGRlbCBpbnRlcnZhbG8gZGUgYcOxb3MgcHJldmlzdG86ICUxJHMgLSAlMiRzABERRmVj
aGEgaW50cm9kdWNpZGEAFxdGZWNoYSBpbnRyb2R1Y2lkYTogJTEkcwAREUZpbiBkZWwgaW50ZXJ2
YWxvAAkLRnVuY2nDs27CoCsAFBRJbmljaW8gZGVsIGludGVydmFsbwAFBUludHJvABERSW50cm9k
dWNpciBmZWNoYXMACwtJciBhIGluaWNpbwAOD0lyIGFsIGHDsW8gJTEkcwAUFE1hcmNhZG8gcGFy
Y2lhbG1lbnRlAAcJTWF5w7pzwqArAAYITWVuw7rCoCsABwdNaW51dG9zAB0eTW9zdHJhciBkZXNj
cmlwY2nDs24gZW1lcmdlbnRlAAcHTmluZ3VubwAPD05vIHNlbGVjY2lvbmFkbwAHB09jdWx0YXIA
ExNTZWxlY2Npb25hciBtaW51dG9zABobU2VsZWNjaW9uYXIgdW5hIGFwbGljYWNpw7NuAA8QU2Vs
ZWNjacOzbjogJTEkcwAICFN1cHJpbWlyAAgIVmVyIHRvZG8ACgolMSRkIGtsc3QuAAwOJTEkZCBt
w61uw7p0dXIADQ4lMSRkIHByw7NzZW50LgAPEUHDsGdlcsOwYXJseWtpbGwrABQXQnJleXRhIMOt
IGZ5cnJpIG3DoW51w7AAFBhCcmV5dGEgw60gbsOmc3RhIG3DoW51w7AACgpEYWdzZXRuaW5nACEh
RGFnc2V0bmluZyBlciBla2tpIGxleWZpbGVnOiAlMSRzACowRGFnc2V0bmluZyBlciB1dGFuIMOh
w6Z0bGHDsHJhIMOhcmE6ICUxJHPigJMlMiRzAC8zRGFnc2V0bmluZyBwYXNzYXIgZWtraSB2acOw
IMOhw6Z0bGHDsCBteW5zdHVyOiAlMSRzAAkKRGVpbGEgbWXDsAAMDURlaWxhIG1lw7AgJXMABwhE
cmFna2zDswAGBkVra2VydAAKC0Vra2kgdmFsacOwAAkJRmFyYSBoZWltAAgIRmFyYSB1cHAADAxG
ZWxsaXZhbG15bmQAEBBGbGVpcmkgdmFsa29zdGlyABYXRmxldHRhIHRpbCDDoXJzaW5zICUxJHMA
HSFGbGV0dHUgdGlsIGHDsCBzasOhIGZ5cnJpIG3DoW51w7AAGh1GbGV0dHUgdGlsIGHDsCBzasOh
IGZ5cnJpIMOhcgAdIkZsZXR0dSB0aWwgYcOwIHNqw6EgbsOmc3RhIG3DoW51w7AAGyBGbGV0dHUg
dGlsIGHDsCBzasOhIHPDrcOwYXJpIMOhcgAFBUZsaXBpAAYGR2x1Z2dpAAUFSGFmbmEAFhlIYWth
w7AgdmnDsCBhw7AgaGx1dGEgdGlsABISSHJlaW5zYSBmeXJpcnNwdXJuAAUFSHVuc2EAEBJIdW5z
YSBibGHDsCBuZcOwc3QADg9Jbm5hbiB0w61tYWJpbHMABgZLVkVJS1QACAhLbC4gJTEkZAALC0ts
dWtrdXN0dW5kAAYGS3ZlaWt0AAgJTGVnZ2phIMOhAAQETGVpdAAQEExlaXRhcmZ5cmlyc3B1cm4A
BghMZWl0YeKApgAJCkxvayBzdmnDsHMACgtMb2thIGJsYcOwaQAUFExva2EgeWZpcmxpdHN2YWxt
eW5kAAkJTG9rYWRhZ3VyAAUGTG9racOwAAYGTWlubmthABETTWlubmthIGJsYcOwIG5lw7BzdAAH
CE1pbm5rYcOwAAoLTXluZHPDrW10YWwABghNw61uw7p0YQATFE7DunZlcmFuZGkgdmFsOiAlMSRz
AAgIUmFkZGxlaXQABgdTTMOWS0tUABAQU2VuZGEgZnlyaXJzcHVybgAICVNqw6EgYWxsdAAGBlNr
aXB0YQArL1NraXB0YSB5ZmlyIMOtIGlubmbDpnJzbHVhw7BmZXLDsCBmeXJpciBkYWdhdGFsABsd
U2tpcHRhIHlmaXIgw60gdGV4dGFpbm5zbMOhdHQAFxpTa2lwdGEgeWZpciDDrSB2YWwgw6Egw6Fy
aQAQElNrcsOhw7AgZGFnc2V0bmluZwAWGFNrcsOhw7AgZGFnc2V0bmluZzogJTEkcwAWGFNsw6HD
sHUgaW5uIGRhZ3NldG5pbmdhcgAGB1Nsw7Zra3QADQ1TcHJldHRpZ2x1Z2dpAElRU3RyasO6a3R1
IHRpbCBhw7AgdmVsamEgw6FyIGXDsGEgw710dHUgdGlsIGHDsCBza2lwdGEgYWZ0dXIgeWZpciDD
rSBhw7AgdmVsamEgZGFnABEUU3TDpmtrYSBibGHDsCBuZcOwc3QABwlTdMOma2thw7AABQVTdmFy
YQAVF1PDrWFyIHPDrW10YWwgc2VtIGJlcnN0AAwNU8OtbXRhbCBiZXJzdAAOEFPDrW10YWwgw60g
Z2FuZ2kADhBTw71uYSDDoWJlbmRpbmd1ABgbVGlsbMO2Z3VyIGjDqXIgZnlyaXIgbmXDsGFuAAwN
VXBwaGFmIHN2acOwcwAMDFVwcGhhZnNkYWd1cgAQEFZhbGluIGRhZ3NldG5pbmcABQZWYWxpw7AA
CAhWYWxteW5kKwASElZlbGR1IGRhZ3NldG5pbmdhcgAMDFZlbGR1IGZvcnJpdAAREVZlbGphIGRh
Z3NldG5pbmd1ABMUVmVsamEgZi5oLiBlw7BhIGUuaC4ACwtWZWxqYSBrbHN0LgAND1ZlbGphIG3D
rW7DunR1cgAPD1lmaXJsaXRzdmFsbXluZAAGB2JpbHNsw6EAAgJlaAAEBWV5w7BhAAICZmgAERFm
eXJpciBrbHVra3VzdHVuZAAND2Z5cmlyIG3DrW7DunR1cgAICcOBYmVuZGluZwALDMOBcnN2YWwg
YmlydAAFBsONIGRhZwAJCsONIHZpbm5zbHUAEhTDk2dpbGR1ciBpbm5zbMOhdHR1cgAWGcOTZ2ls
dCB0w61tYWJpbCBmw6ZydCBpbm4ACgolMSRkIG1pbml0ACEhQmVyYWxpaCBrZXBhZGEgbW9kIGlu
cHV0IGthbGVuZGFyAB0dQmVyYWxpaCBrZXBhZGEgbW9kIGlucHV0IHRla3MAHh5CZXJhbGloIGtl
cGFkYSBwZW1pbGloYW4gdGFodW4AERFDYWRhbmdhbiBkaSBiYXdhaAAEBENhcmkABgZDYXJpYW4A
DAxDYXJpYW4gc3VhcmEABQdDYXJp4oCmAA0NRGFsYW0gbGlwdXRhbgAMDERpa2VtYmFuZ2thbgAL
C0Rpa3VuY3Vwa2FuAAcHRnVuZ3NpKwAFBUhJRFVQAAUFSGlkdXAAHBxJbnB1dCBqdWxhdCB0YXJp
a2ggdGlkYWsgc2FoAA8PSW5wdXQgdGlkYWsgc2FoABgYS2VtYmFuZ2thbiBoZWxhaWFuIGJhd2Fo
AAkJS2V0ZXBpa2FuABcXS2V0ZXBpa2FuIGhlbGFpYW4gYmF3YWgADQ1Lb25nc2kgZGVuZ2FuABAQ
S29uZ3NpIGRlbmdhbiAlcwAUFEtvc29uZ2thbiBwZXJ0YW55YWFuABcXS3VuY3Vwa2FuIGhlbGFp
YW4gYmF3YWgADAxMYWdpIHBpbGloYW4AUVFMZXJldCB1bnR1ayBtZW1pbGloIHRhaHVuIGF0YXUg
a2V0aWsgdW50dWsgYmVydHVrYXIga2VtYmFsaSBrZXBhZGEgcGVtaWxpaGFuIGhhcmkABARNQVRJ
AA8PTWFzdWtrYW4gdGFyaWtoAAQETWF0aQAMDE1lbnUgbHVuZ3N1cgAFBU1pbml0ABAQTmF2aWdh
c2kga2UgYXRhcwAWFk5hdmlnYXNpIGtlIHRhaHVuICUxJHMAFBROYXZpZ2FzaSBsYW1hbiB1dGFt
YQADA1AvTQACAlBHAA4OUGVtZWdhbmcgc2VyZXQAFxdQZW1pbGloIHRhaHVuIGtlbGloYXRhbgAQ
EFBlbmdodWp1bmcganVsYXQADQ1QZXJhdHVzICUxJGQuAA8PUGVybXVsYWFuIGp1bGF0ABERUGVy
dGFueWFhbiBjYXJpYW4AFRVQaWxpaCBQRyBhdGF1IFBURy9NTE0ACQlQaWxpaCBhcGwACwtQaWxp
aCBtaW5pdAAMDFBpbGloIHRhcmlraAAUFFBpbGloYW4gc2VtYXNhOiAlMSRzAAkJUnVudHVoa2Fu
ABYWU2ViYWhhZ2lhbm55YSBkaXRhbmRhaQAQEFNlcmFoIHBlcnRhbnlhYW4AEhJUYW1hdGthbiBQ
YW5nZ2lsYW4ABgZUYXJpa2gANzdUYXJpa2ggZGkgbHVhciBqdWxhdCB0YWh1biB5YW5nIGRpamFu
Z2tha2FuICUxJHMgLSAlMiRzAA4OVGFyaWtoIGRpcGlsaWgACwtUYXJpa2ggbXVsYQAMDFRhcmlr
aCB0YW1hdAA4OFRhcmlraCB0aWRhayBzZXBhZGFuIGRlbmdhbiBjb3JhayB5YW5nIGRpamFuZ2th
a2FuOiAlMSRzABYWVGFyaWtoIHlhbmcgZGltYXN1a2thbgAcHFRhcmlraCB5YW5nIGRpbWFzdWtr
YW46ICUxJHMAIiJUYXJpa2ggeWFuZyB0aWRhayBkaWJlbmFya2FuOiAlMSRzACgoVGF0YWwgdW50
dWsgbWVudW5qdWtrYW4gYnVsYW4gc2ViZWx1bW55YQAoKFRhdGFsIHVudHVrIG1lbnVuanVra2Fu
IGJ1bGFuIHNldGVydXNueWEAJiZUYXRhbCB1bnR1ayBtZW51bmp1a2thbiB0YWh1biBrZW11ZGlh
bgAnJ1RhdGFsIHVudHVrIG1lbnVuanVra2FuIHRhaHVuIHRlcmRhaHVsdQAQEFRldGluZ2thcCBU
aW1idWwABQVUaWFkYQAICFRpcCBhbGF0AAUFVHVrYXIAHR1UdWthciBrZXBhZGEgYnVsYW4gc2Vi
ZWx1bW55YQAdHVR1a2FyIGtlcGFkYSBidWxhbiBzZXRlcnVzbnlhABISVHVuanVra2FuIHRpcCBh
bGF0AA0NVHV0dXAgaGVsYWlhbgAFBXJ1YW5nAAwMc2VsYW1hICMgamFtAA4Oc2VsYW1hICMgbWlu
aXQADAwlMSRkIG1pbnV0aXQADw8lMSRkIHByb3RzZW50aS4ACgolMSRkIHR1bmRpAAcHJTEkZC4w
MAAWF0Fhc3RhIHZhbGlqYSBvbiBuw6RodGF2AAoKQWhlbmRhbWluZQAJCUFoZW5kYXR1ZAAMDUFs
Z3Vza3V1cMOkZXYABQVBbHQgKwAXF0FsdW1pc2UgbGVoZSBhaGVuZGFtaW5lABgYQWx1bWlzZSBs
ZWhlIGxhaWVuZGFtaW5lABoaQWx1bWlzZXN0IGxlaGVzdCBsb29idW1pbmUABgZDdHJsICsAHR1F
ZWxtaXNlIGt1dSBrdXZhbWlzZWtzIGtlcmlnZQASEkZ1bmt0c2lvb25pa2xhaHYgKwAkJEhpbGlz
ZW1hdGUgYWFzdGF0ZSBrdXZhbWlzZWtzIGtlcmlnZQAKDEjDpMOkbG90c2luZwAJCkjDvHBpa2Fr
ZW4ABQVKYWdhOgAXF0phZ2FtaW5lIHJha2VuZHVzZWdhICVzAB4fSsOkcmdtaXNlIGt1dSBrdXZh
bWlzZWtzIGtlcmlnZQAGBktlZWxkdQALC0tvaHRzcGlra2VyAAcIS3V1cMOkZXYAJylLdXVww6Rl
diBlaSDDvGh0aSBlZWxkYXR1ZCBtdXN0cmlnYTogJTEkcwA3O0t1dXDDpGV2IG9uIHbDpGxqYXNw
b29sIGVlbGRhdHVkIGFhc3RhdmFoZW1pa2t1ICUxJHPigJMlMiRzABobS3V1cMOkZXYgcG9sZSBs
dWJhdHVkOiAlMSRzABAQS3V2YSBrb2h0c3Bpa2tlcgAJCkt1dmEga8O1aWsADxFLw6RpbWFzb2xl
diBrw7VuZQAKCkxhaWVuZGF0dWQAFxdMaWlndSBhYXN0YSAlMSRzIGp1dXJkZQAPD0xpaWd1IGF2
YWxlaGVsZQAKC0xpaWd1IMO8bGVzAA4OTG9oaXN0YW1pc3BpZGUABQVMb29idQALDUzDtXBldGEg
a8O1bmUACw1Mw7VwcGt1dXDDpGV2AAYHTMO8bGl0aQAXGEzDvGxpdHUgYWFzdGEgdmFsaW1pc2Vs
ZQAgIkzDvGxpdHUga2FsZW5kcmlzaXNlc3R1c3Jlxb5paW1pbGUAHiBMw7xsaXR1IHRla3N0aXNp
c2VzdHVzcmXFvmlpbWlsZQAHCU1lbsO8w7wgKwAGBk1ldGEgKwAHB01pbnV0aWQAERFNaW51dGl0
ZSB2YWxpbWluZQARE05hdmlnZWVyaW1pc21lbsO8w7wAEhNPc2FsaXNlbHQgbcOkcmdpdHVkAAgK
T3RzaWdlIOKApgAGBk90c2luZwANDk90c2luZ3Vww6RyaW5nAAQEUG9sZQAMDFBvbGUgdmFsaXR1
ZAAHB1Bvb2xlbGkAFBRQcmFlZ3VuZSB2YWxpazogJTEkcwAGBlB1dWR1YgARElDDpHJpbmd1IGVz
aXRhbWluZQATFVDDpHJpbmd1IHTDvGhpc3RhbWluZQBNUFDDvGhraWdlIGFhc3RhIHZhbGltaXNl
a3MgdsO1aSBwdXVkdXRhZ2UsIGV0IG1pbm5hIHRhZ2FzaSBww6RldmEgdmFsaW1pc2UganV1cmRl
AAkLUmlwcG1lbsO8w7wADw9Sb2hrZW0gdmFsaWt1aWQABARTRUVTAAQEU2VlcwATFFNpc2VzdGFn
ZSBrdXVww6RldmFkACIjU2lzZXN0YXRpIHNvYmltYXR1IGt1dXDDpGV2YXZhaGVtaWsAEhNTaXNl
c3RhdHVkIGt1dXDDpGV2ABgZU2lzZXN0YXR1ZCBrdXVww6RldjogJTEkcwAPEFNpc3NldHVsZXYg
a8O1bmUAHh9TaXNzZXR1bGV2YSBrw7VuZSBmaWx0cmVlcmltaW5lAA8PU29iaW1hdHUgc2lzZW5k
ABUVU29vdml0dXNlZCBvbiBhbGxwb29sAAkJU3VsZSBsZWh0ABYYU3VsZSBuYXZpZ2VlcmltaXNt
ZW7DvMO8AAUFU3ltICsADg5UdW5uaSB2YWxpbWluZQAGBlR1bm5pZAAEBVTDpG5hAAwNVMO1c3R1
a2xhaHYgKwAICFZhaGVsZWh0AA4OVmFoZW1pa3UgYWxndXMADQ5WYWhlbWlrdSBsw7VwcAAJCVZh
aGVtaWt1cwAWFlZhaGV0YSBlZWxtaXNlbGUga3V1bGUAFxhWYWhldGEgasOkcmdtaXNlbGUga3V1
bGUAEBFWYWxpZ2UgQU0gdsO1aSBQTQAOD1ZhbGlnZSBrdXVww6RldgAQEVZhbGlnZSBrdXVww6Rl
dmFkAA8PVmFsaWdlIHJha2VuZHVzAAcHVmFsaXR1ZAAPEFZhbGl0dWQga3V1cMOkZXYABgZWYWxt
aXMAJCRWYXJhc2VtYXRlIGFhc3RhdGUga3V2YW1pc2VrcyBrZXJpZ2UABQVWYXN0YQAGB1bDhExK
QVMABgdWw6RsamFzAAcHa3VzdHV0YQAODm1pbnV0aXRlIGphb2tzAA0Nc2lzZXN0dXNrbGFodgAN
DXR1bmRpZGUgamFva3MABQZ0w7xoaWsACwslMSRkIG1pbnV0aQAICCUxJGQgb3JlAA4OJTEkZCBw
ZXJjZW50by4ABQVBTFQgKwANDUFsdHJlIG9wemlvbmkAKChBcHBsaWNhemlvbmUgZmlsdHJvIGEg
Y2hpYW1hdGEgaW4gYXJyaXZvAAQEQ0FOQwAGBkNUUkwgKwAODkNhbmNlbGxhIHF1ZXJ5ABISQ2hp
YW1hdGEgaW4gYXJyaXZvABERQ2hpYW1hdGEgaW4gY29yc28ABgZDaGl1ZGkAEBBDaGl1ZGkgaWwg
Zm9nbGlvAB0dQ2hpdWRpIGlsIG1lbnUgZGkgbmF2aWdhemlvbmUAHBxDaGl1ZGkgaWwgcmlxdWFk
cm8gaW5mZXJpb3JlAAgIQ29tcHJpbWkAHh5Db21wcmltaSBpbCByaXF1YWRybyBpbmZlcmlvcmUA
DQ1Db25kaXZpZGkgY29uABQUQ29uZGl2aWRpIHRyYW1pdGUgJXMAExNDb250cm9sbG8gY29tcHJl
c3NvABERQ29udHJvbGxvIGVzcGFuc28ADAxEYXRhIGRpIGZpbmUADg5EYXRhIGRpIGluaXppbwAN
DURhdGEgaW5zZXJpdGEAExNEYXRhIGluc2VyaXRhOiAlMSRzABkZRGF0YSBub24gY29uc2VudGl0
YTogJTEkcwAQEERhdGEgc2VsZXppb25hdGEAExNEZXNjcml6aW9uZSBjb21hbmRvACEhRWxlbWVu
dG8gcGFyemlhbG1lbnRlIHNlbGV6aW9uYXRvABQURWxlbWVudG8gc2VsZXppb25hdG8AHR1Fc3Bh
bmRpIGlsIHJpcXVhZHJvIGluZmVyaW9yZQAKCkZVTlpJT05FICsABARGaW5lAA8PRmluZSBpbnRl
cnZhbGxvABMTRmluZXN0cmEgZGkgZGlhbG9nbwAODkZpbmVzdHJhIHBvcHVwAAUFSU5WSU8ACAhJ
biBjb3JzbwAREUluaXppbyBpbnRlcnZhbGxvAA4OSW5zZXJpc2NpIGRhdGUAJiZJbnRlcnZhbGxv
IGRpIGRhdGUgaW5zZXJpdG8gbm9uIHZhbGlkbwALC0ludmlhIHF1ZXJ5ADExTGEgZGF0YSBub24g
Y29ycmlzcG9uZGUgYWwgcGF0dGVybiBwcmV2aXN0bzogJTEkcwBAQExhIGRhdGEgbm9uIHJpZW50
cmEgbmVsbCdpbnRlcnZhbGxvIGRpIGFubmkgcHJldmlzdG8gKCUxJHMtJTIkcykACAhNQUlVU0Mg
KwAGBk1FTlUgKwAGBk1FVEEgKwAODk1lbnUgYSBkaXNjZXNhABMTTWVudSBkaSBuYXZpZ2F6aW9u
ZQAaGk1vc3RyYSBkZXNjcml6aW9uZSBjb21hbmRvAAwMTW9zdHJhIHR1dHRvAA8PTmVsbCdpbnRl
cnZhbGxvAAcHTmVzc3VuYQAREU5lc3N1bmEgc2VsZXppb25lAAQET2dnaQAHB09wemlvbmUAFxdP
cHppb25lIG5vbiBzZWxlemlvbmF0YQADA09yYQAYGFBhc3NhIGFsIG1lc2UgcHJlY2VkZW50ZQAY
GFBhc3NhIGFsIG1lc2Ugc3VjY2Vzc2l2bwAsLVBhc3NhIGFsbGEgbW9kYWxpdMOgIGRpIGltbWlz
c2lvbmUgQ2FsZW5kYXJpbwAnKFBhc3NhIGFsbGEgbW9kYWxpdMOgIGRpIGltbWlzc2lvbmUgVGVz
dG8AHx9QYXNzYSBhbGxhIHNlbGV6aW9uZSBkaSB1biBhbm5vAA4OUG9ydGFtaSBhIGNhc2EAFhZQ
dW50byBkaSB0cmFzY2luYW1lbnRvABAQUXVlcnkgZGkgcmljZXJjYQAKClJpYWdnYW5jaWEADg5S
aWNlcmNhIHZvY2FsZQAHB1JpZml1dGEACAhSaXNwb25kaQAGBlNQQVpJTwAFBVNZTSArABAQU2Nl
bHRhIGRpIHVuJ2FwcAAGBlNjaGVkYQBOTlNjb3JyaSBwZXIgc2VsZXppb25hcmUgdW4gYW5ubyBv
IHRvY2NhIHBlciB0b3JuYXJlIGFsbGEgc2VsZXppb25lIGRpIHVuIGdpb3JubwArK1Njb3JyaSBw
ZXIgdmlzdWFsaXp6YXJlIGdsaSBhbm5pIHByZWNlZGVudGkAKytTY29ycmkgcGVyIHZpc3VhbGl6
emFyZSBnbGkgYW5uaSBzdWNjZXNzaXZpACoqU2NvcnJpIHBlciB2aXN1YWxpenphcmUgaWwgbWVz
ZSBwcmVjZWRlbnRlACoqU2NvcnJpIHBlciB2aXN1YWxpenphcmUgaWwgbWVzZSBzdWNjZXNzaXZv
ABwcU2VsZXR0b3JlIGRlbGwnYW5ubyB2aXNpYmlsZQAREVNlbGV6aW9uYSBBTSBvIFBNAA4OU2Vs
ZXppb25hIGRhdGEADg5TZWxlemlvbmEgZGF0ZQASElNlbGV6aW9uYSBpIG1pbnV0aQANDVNlbGV6
aW9uYSBvcmEAFxdTZWxlemlvbmUgYXR0dWFsZTogJTEkcwASElN1Z2dlcmltZW50aSBzb3R0bwAO
DlRvcm5hIGluZGlldHJvABERVmFpIGFsbCdhbm5vICUxJHMAERFWYWxvcmUgbm9uIHZhbGlkbwAK
CnBlciBtaW51dGkABwdwZXIgb3JhAAkJJTEkZCB2YWwuAAcHJWQgbWluLgAHB0F0bGlrdGEABwdB
dG1lc3RpAAgIQXRzYWt5dGkACgpBdHNpc2FreXRpABgYQXRzaXNha3l0aSBhcGF0aW5pbyBsYXBv
AAsLQmFpZ3RpIHBvay4AISZCZW5kcmludGkgbmF1ZG9qYW50IHByb2dyYW3EhSDigJ4lc+KAnAAM
DEJlbmRyaW50aSBzdQAdHURhYmFydGluaXMgcGFzaXJpbmtpbWFzOiAlMSRzACYnRGF0YSBuZWF0
aXRpbmthIG51bWF0eXRvIMWhYWJsb25vOiAlMSRzABYXRGF0YSBuZWxlaWTFvmlhbWE6ICUxJHMA
MzlEYXRhIG5lcGF0ZW5rYSDEryBudW1hdHl0xbMgbWV0xbMgZGlhcGF6b27EhTogJTEkc+KAkyUy
JHMAERNEYXVnaWF1IHBhcmlua8SNacWzAA4ORGlhbG9nbyBsYW5nYXMACQlEaWFwYXpvbmUAERFE
aWFwYXpvbm8gcGFiYWlnYQAREkRpYXBhem9ubyBwcmFkxb5pYQAOD0VpdGkgxK8gJTEkcyBtLgAZ
HEVpdGkgxK8gcGFncmluZGluxK8gcHVzbGFwxK8AFBRHYXVuYW1hc2lzIHNrYW1idXRpcwAeH0dh
dW5hbW9qbyBza2FtYnXEjWlvIHRpa3JpbmltYXMABwhJZcWha290aQAIC0llxaFrb3Rp4oCmAAgJ
ScWgSlVOR1RJABIVScWhIGRhbGllcyBwYcW+eW3El3RhAAgJScWhanVuZ3RhABYYScWhc2tsZWlk
xb5pYW1hc2lzIG1lbml1AAoLScWhc2tsZWlzdGEAFxpJxaFza2xlaXN0aSBhcGF0aW7EryBsYXDE
hQARFEnFoXZhbHl0aSB1xb5rbGF1c8SFABMVScWhxaFva2FudHlzaXMgbGFuZ2FzAAkJSnVuZ2lr
bGlzAAYHTWludXTElwANDk5hcsWheW1vIG1lbml1AA8RTmFyxaF5dGkgYXVrxaF0eW4ADAxOZXBh
c2lyaW5rdGEAHR9OZXRpbmthbWEgZGllbsWzIHNla29zIMSvdmVzdGlzABESTmV0aW5rYW1hIMSv
dmVzdGlzAAQFTsSXcmEADQ1QYWJhaWdvcyBkYXRhAAcIUGFpZcWha2EADQ5QYWllxaFrYSBiYWxz
dQARE1BhaWXFoWtvcyB1xb5rbGF1c2EAGx9QYWtlaXN0aSDEryBhbmtzdGVzbsSvIG3El25lc8Sv
ABYaUGFrZWlzdGkgxK8ga2l0xIUgbcSXbmVzxK8AERFQYXNpcmlua2l0ZSBkYXRhcwAQEVBhc2ly
aW5raXRlIGRhdMSFABMTUGFzaXJpbmtpdGUgbWludXRlcwAUFVBhc2lyaW5raXRlIHByb2dyYW3E
hQATFFBhc2lyaW5raXRlIHZhbGFuZMSFACUuUGFzaXJpbmtpdGUg4oCecHJpZcWhcGlldOKAnCBh
cmJhIOKAnnBvcGlldOKAnAAKClBhc2lyaW5rdGEADw9QYXNpcmlua3RhIGRhdGEAGhtQYXNpxats
eW1haSBwYXRlaWt0aSB0b2xpYXUACQlQYXRhcmltYXMAERNQYXRlaWt0aSB1xb5rbGF1c8SFAGJp
UGVyYnJhdWtpdGUsIGthZCBwYXNpcmlua3R1bcSXdGUgbWV0dXMsIGFyYmEgcGFsaWVza2l0ZSwg
a2FkIGdyxK/FvnR1bcSXdGUgaXIgdsSXbCBwYXNpcmlua3R1bcSXdGUgZGllbsSFACgsUGVyanVu
Z3RpIMSvIGthbGVuZG9yaWF1cyDEr3Zlc3RpZXMgcmXFvmltxIUAHB9QZXJqdW5ndGkgxK8gbWV0
xbMgcGFzaXJpbmtpbcSFACImUGVyanVuZ3RpIMSvIHRla3N0byDEr3Zlc3RpZXMgcmXFvmltxIUA
DQ5QcmFkxb5pb3MgZGF0YQAPEFByb2NlbnTFszogJTEkZC4AGBlSb2RvbWFzIG1ldMWzIHBhcmlu
a2lrbGlzAA8QUm9keXRpIHBhdGFyaW3EhQAqK1NsaW5raXRlLCBrb2wgYnVzIHJvZG9tYXMgYW5r
c3Rlc25pcyBtxJdudW8AJSZTbGlua2l0ZSwga29sIGJ1cyByb2RvbWFzIGtpdGFzIG3El251bwAo
KFNsaW5raXRlLCBrb2wgYnVzIHJvZG9taSBhbmtzdGVzbmkgbWV0YWkAJidTbGlua2l0ZSwga29s
IGJ1cyByb2RvbWkgdsSXbGVzbmkgbWV0YWkACQlTdXRyYXVrdGEACQlTdXRyYXVrdGkAFhhTdXRy
YXVrdGkgYXBhdGluxK8gbGFwxIUAFBVUYWJ1bGlhdmltbyBrbGF2acWhYXMADQ9Vxb5kYXJ5dGkg
bGFwxIUAFhhVxb5kYXJ5dGkgbmFyxaF5bW8gbWVuaXUADQ9WYWl6ZG8gxK9yYcWhYXMABwdWYWxh
bmRhABETVmlsa2ltbyByYW5rZW7El2zElwAGBlZ5a3N0YQAUFFZ5a3N0YW50aXMgc2thbWJ1dGlz
AAcIbWludXTEl3MABgZwb3BpZXQACQpwcmllxaFwaWV0AAgIdmFsYW5kb3MABwjErkpVTkdUSQAH
CMSuanVuZ3RhAAsMxK52ZXN0YSBkYXRhABESxK52ZXN0YSBkYXRhOiAlMSRzAAwNxK52ZXN0aSBk
YXRhcwAICcWgaWFuZGllbgAJC8W9ci4gdmlza8SFAAcL4oCeQWx04oCcICsACAzigJ5DdHJs4oCc
ICsADBDigJ5GdW5jdGlvbuKAnCArAAgM4oCeTWVudeKAnCArAAgM4oCeTWV0YeKAnCArAAkN4oCe
U2hpZnTigJwgKwAHC+KAnlN5beKAnCArAAgM4oCeZGVsZXRl4oCcAAcL4oCeZW50ZXLigJwABwvi
gJ5zcGFjZeKAnAAEBCUxJGQACwslMSRkIG1pbnV0dQAICEFLVElCQVRVAAUFQWJpYW4ABwdBaG9s
a3VhAA8PQWhvemtvIGJpbGFrZXRhAAoKQWt0aWJhdHV0YQAGBkFsZGF0dQAZGUFsZGF0dSBhdXJy
ZWtvIGhpbGFiZXRlcmEAJCRBbGRhdHUgZWd1dGVnaWFyZW4gaWRhemtldGEtbWV0b2RvcmEAGhpB
bGRhdHUgaHVycmVuZ28gaGlsYWJldGVyYQAdHUFsZGF0dSB0ZXN0dWEgaWRhenRla28gbW9kdXJh
AAwMQW1haWVyYS1kYXRhAAsLQW1haXR1IGRlaWEAGxtBcnJhc3RhdHpla28ga29udHJvbC1wdW50
dWEADg5BdWtlcmEgZ2VoaWFnbwAWFkF1a2VyYXR1IGFwbGlrYXppbyBiYXQAExNCYXJydXRpYXJl
biBhbWFpZXJhABMTQmFycnV0aWFyZW4gaGFzaWVyYQAKCkJhdCBlcmUgZXoACAhCYXp0ZXJ0dQAz
M0JhenRlcnR1IHBhbnRhaWxhcmVuIGJlaGVhbGRlYW4gYWluZ3VyYXR1dGFrbyBvcnJpYQAQEEJp
ZGFsaSBrb250c3VsdGEABgZCaWRlb2EACAhCaWxha2V0YQASEkJpbGFrZXRhLWtvbnRzdWx0YQAG
BkJpbGF0dQAHCUJpbGF0deKApgALC0RFU0FLVElCQVRVAC4uRGF0YSBleiBkYXRvciBiYXQgZXNw
ZXJvIGRlbiBlcmVkdWFyZWtpbjogJTEkcwANDURlaWEgYWJpYW4gZGEADQ1EZXNha3RpYmF0dXRh
AC0tRWdpbiBnb3JhL2JlaGVyYSBhdXJyZWtvIGhpbGFiZXRlYSBlcmFrdXN0ZWtvAC8vRWdpbiBn
b3JhL2JlaGVyYSBldG9ya2l6dW5la28gdXJ0ZWFrIGVyYWt1c3Rla28ALi5FZ2luIGdvcmEvYmVo
ZXJhIGh1cnJlbmdvIGhpbGFiZXRlYSBlcmFrdXN0ZWtvACwsRWdpbiBnb3JhL2JlaGVyYSBpcmFn
YW5la28gdXJ0ZWFrIGVyYWt1c3Rla28ABgZFZ2luZGEADQ1FaHVuZWtvICUxJGQuABAQRXJha3V0
c2kgYWhvbGt1YQAICEVyYW50enVuAA4ORXJkaS1tYXJrYXR1dGEANDRFc3Blcm8gZGVuIHVydGUg
dGFydGV0aWsgKCUxJHMtJTIkcykga2FucG8gZGFnbyBkYXRhABkZRXogZGEgb25hcnR6ZW4gZGF0
YTogJTEkcwAFBUZpdHhhAAoKRnVudHppb2EgKwAREUdhcmJpdHUga29udHN1bHRhAAQER2F1cgAT
E0dvaXRpYmVoZXJha28gbWVudWEADAxIYXNpZXJhLWRhdGEAERFIYXV0YXR1IEFNIGVkbyBQTQAQ
EEhhdXRhdHUgZGF0YSBiYXQADQ1IYXV0YXR1IGRhdGFrAAwMSGF1dGF0dSBnYWJlABAQSGF1dGF0
dSBtaW51dHVhawANDUhhdXRhdHUgb3JkdWEACQlIYXV0YXR1dGEAEBBIYXV0YXR1dGFrbyBkYXRh
AAwMSWRhdHppIGRhdGFrAA8PSWRhdHppdGFrbyBkYXRhACMjSWRhdHppdGFrbyBkYXRhIHRhcnRl
YWsgZXogZHUgYmFsaW8AFRVJZGF0eml0YWtvIGRhdGE6ICUxJHMADQ1Ja3VzaSBndXp0aWFrABkZ
SXJhZG9raXp1bmFrIGRhdWRlIGJlaGVhbgAUFEl0eGkgbmFiaWdhemlvLW1lbnVhAAoKSXR4aSBv
cnJpYQAcHEphc290YWtvIGRlaSBiYXQgYmlzdGFyYXR6ZW4ADQ1KYXNvdGFrbyBkZWlhABAQSm9h
biAlMSRzIHVydGVyYQAJCUpvYW4gZ29yYQASEkpvYW4gb3JyaSBuYWd1c2lyYQAXF0pvYW4gdXJ0
ZS1oYXV0YXR6YWlsZXJhAAYGS3RybCArABISTGVpaG8gZ2FpbmVyYWtvcnJhAAYGTGVpaG9hAAcH
TWFpdXMgKwAHB01lbnVhICsACAhNaW51dHVhawAPD05hYmlnYXppby1tZW51YQAXF09yYWluZ28g
aGF1dGFwZW5hOiAlMSRzAAYGT3JkdWFrABwcUGFydGVrYXR1ICVzIGFwbGlrYXppb2FyZWtpbgAR
EVBhcnRla2F0dSBob25la2luAF1dUGFzYXR1IGhhdHphIHVydGUgYmF0IGhhdXRhdHpla28uIEJl
c3RlbGEsIHNha2F0dSBoYXUgZWd1bmEgaGF1dGF0emVrbyBwYW50YWlsYXJhIGl0enVsdHpla28u
ABQUU2FycmVyYWsgZXogZHUgYmFsaW8ABwdUYXJ0ZWFuAAcHVG9sZXN0dQAyMlRvbGVzdHUgcGFu
dGFpbGFyZW4gYmVoZWFsZGVhbiBhaW5ndXJhdHV0YWtvIG9ycmlhAAkJVG9sZXN0dXRhAB4eVXJ0
ZS1oYXV0YXR6YWlsZWEgaWt1c2dhaSBkYWdvADIyWmFiYWxkdSBwYW50YWlsYXJlbiBiZWhlYWxk
ZWFuIGFpbmd1cmF0dXRha28gb3JyaWEACQlaYWJhbGR1dGEABwdlemFiYXR1AA0NbWludXR1ZXRh
cmFrbwAICG9yZHVyYWtvAAUFc2FydHUACAh6dXJpdW5lYQAKFCUxJGQg4KqV4Kqy4Kq+4KqV4KuH
AAkPJTEkZCDgqp/gqpXgqr4uAAoUJTEkZCDgqq7gqr/gqqjgqr/gqp8ACxclMSRkIOCqteCqvuCq
l+CrjeCqr+CrhwARKSVz4Kqo4KuAIOCquOCqvuCqpeCrhyDgqrbgq4fgqrAg4KqV4Kqw4KuLABEj
QU0g4KqV4KuHIFBNIOCqquCquOCqguCqpiDgqpXgqrDgq4sAJGLgqoXgqpfgqr7gqongqqjgqr4g
4Kq14Kqw4KuN4Kq34KuLIOCqrOCqpOCqvuCqteCqteCqviDgqq7gqr7gqp/gq4cg4Kq44KuN4KqV
4KuN4Kqw4KuL4KqyIOCqleCqsOCriwAxc+CqheCqquCrh+CqleCrjeCqt+Cqv+CqpCDgqrXgqrDg
q43gqrfgqqjgq4Ag4Kq24KuN4Kqw4KuH4Kqj4KuAICUxJHMgLSAlMiRz4Kqo4KuAIOCqrOCqueCq
vuCqsOCqqOCrgCDgqqTgqr7gqrDgq4DgqpYADCLgqoXgqq7gqr7gqqjgq43gqq8g4KqH4Kqo4Kqq
4KuB4KqfABo84KqGIOCqpOCqvuCqsOCrgOCqluCqqOCrgCDgqq7gqoLgqpzgq4LgqrDgq4Ag4Kqo
4Kql4KuAOiAlMSRzABxM4KqG4KqC4Kq24Kq/4KqVIOCqsOCrgOCqpOCrhyDgqprgq4fgqpUg4KqV
4Kqw4KuH4Kqy4Kq+IOCqteCqv+CqleCqsuCrjeCqquCriwAiXOCqhuCql+CqsuCriyDgqq7gqrng
qr/gqqjgq4sg4Kqs4Kqk4Kq+4Kq14Kq14Kq+IOCqruCqvuCqn+CrhyDgqrjgq43gqpXgq43gqrDg
q4vgqrIg4KqV4Kqw4KuLAAMJ4KqG4Kqc4KuHABAq4KqG4Kqo4KuAIOCquOCqvuCqpeCrhyDgqrbg
q4fgqrAg4KqV4Kqw4KuLAAsf4KqH4Kqo4KqV4Kqu4Kq/4KqC4KqXIOCqleCrieCqsgAgWOCqh+Cq
qOCqleCqruCqv+CqguCqlyDgqpXgq4ngqrLgqqjgq4HgqoIg4Kq44KuN4KqV4KuN4Kqw4KuA4Kqo
4Kq/4KqC4KqXIOCqpeCqvuCqryDgqpvgq4cADyngqongqqrgqrAg4Kqo4KuF4Kq14Kq/4KqX4KuH
4KqfIOCqleCqsOCriwASMuCqjeCqquCrjeCqsuCqv+CqleCrh+CqtuCqqCDgqqrgqrjgqoLgqqYg
4KqV4Kqw4KuLAAkZ4KqP4KqV4Kqq4KqjIOCqqOCqueCrgOCqggAZR+CqkeCqrOCrjeCqnOCrh+Cq
leCrjeCqnyDgqpbgq4fgqoLgqprgqrXgqr7gqqjgq4HgqoIg4Kq54KuF4Kqo4KuN4Kqh4KqyAAQM
4KqV4Kqy4Kq+4KqVAA0j4KqV4Kqy4Kq+4KqVIOCqquCquOCqguCqpiDgqpXgqrDgq4sACRngqpXg
qrLgqr7gqpUg4Kqu4Kq+4Kqf4KuHAB9T4KqV4KuF4Kqy4KuH4Kqo4KuN4Kqh4KqwIOCqh+CqqOCq
quCrgeCqnyDgqq7gq4vgqqEg4Kqq4KqwIOCquOCrjeCqteCqv+CqmiDgqpXgqrDgq4sAECzgqpXg
q43gqrXgq4fgqrDgq4Ag4Kq44Kqs4Kqu4Kq/4KqfIOCqleCqsOCriwAOJuCqleCrjeCqteCrh+Cq
sOCrgCDgqrjgqr7gqqsg4KqV4Kqw4KuLABAs4KqY4Kqw4Kqo4KuLIOCqsOCquOCrjeCqpOCriyDg
qqzgqqTgqr7gqrXgq4sABAzgqprgqr7gqrLgq4EACBbgqprgqr7gqrLgq4Eg4KqV4KuJ4KqyAAcT
4Kqa4Kq+4Kqy4KuBIOCqm+CrhwAHE+Cqm+Cri+CqoeCrgCDgqqbgq4sABAzgqpzgqrXgqr7gqqwA
BhLgqp/gq4LgqrLgqp/gqr/gqqoADCLgqp/gq4LgqrLgqp/gqr/gqqog4Kqs4Kqk4Kq+4Kq14KuL
AAMJ4Kqf4KuF4KqsAB5Q4Kqf4KuH4KqV4KuN4Kq44KuN4KqfIOCqh+CqqOCqquCrgeCqnyDgqq7g
q4vgqqEg4Kqq4KqwIOCquOCrjeCqteCqv+CqmiDgqpXgqrDgq4sADijgqqHgq43gqrDgq4ngqqrg
qqHgqr7gqongqqgg4Kqu4KuH4Kqo4KuCAAUP4Kqk4Kq+4Kqw4KuA4KqWAC1v4Kqk4Kq+4Kqw4KuA
4KqWIOCqheCqquCrh+CqleCrjeCqt+Cqv+CqpCDgqqrgq4Xgqp/gqrDgq43gqqgg4Kq44Kq+4Kql
4KuHIOCqruCrh+CqsyDgqpbgqr7gqqTgq4Ag4Kqo4Kql4KuAOiAlMSRzAA4m4Kqk4Kq+4Kqw4KuA
4KqWIOCqquCquOCqguCqpiDgqpXgqrDgq4sAHlTgqqTgqr7gqrDgq4Dgqpbgqqjgq4Ag4Kq24KuN
4Kqw4KuH4Kqj4KuA4Kqo4KuB4KqCIOCqheCqruCqvuCqqOCrjeCqryDgqofgqqjgqqrgq4Hgqp8A
DyngqqTgqr7gqrDgq4Dgqpbgq4sg4Kqm4Kq+4KqW4KqyIOCqleCqsOCriwAPKeCqpOCqvuCqsOCr
gOCqluCriyDgqqrgqrjgqoLgqqYg4KqV4Kqw4KuLAAcT4Kql4KqIIOCql+Cqr+CrgeCqggAQLOCq
puCqvuCqluCqsiDgqpXgqrDgq4fgqrLgq4Ag4Kqk4Kq+4Kqw4KuA4KqWABYy4Kqm4Kq+4KqW4Kqy
IOCqleCqsOCrh+CqsuCrgCDgqqTgqr7gqrDgq4DgqpY6ICUxJHMABQ/gqqjgqpXgqr7gqrDgq4sA
Chzgqqjgqr7gqqjgq4Ag4KqV4Kqw4KuH4Kqy4KuAAA0l4Kqo4KuF4Kq14Kq/4KqX4KuH4Kq24Kqo
IOCqruCrh+CqqOCrggAVOeCqqOCrheCqteCqv+Cql+Crh+CqtuCqqCDgqq7gq4fgqqjgq4Ig4Kqs
4KqC4KqnIOCqleCqsOCriwAjX+CqquCqm+CrgOCqqOCqviDgqrXgqrDgq43gqrfgq4sg4Kqs4Kqk
4Kq+4Kq14Kq14Kq+IOCqruCqvuCqn+CrhyDgqrjgq43gqpXgq43gqrDgq4vgqrIg4KqV4Kqw4KuL
ABAs4Kqq4Kq44KqC4KqmIOCqleCqsOCrh+CqsuCrgCDgqqTgqr7gqrDgq4DgqpYAChzgqqrgqrjg
qoLgqqbgqpfgq4Ag4KqV4Kqw4KuAAA4m4Kqq4Kq44KqC4Kqm4KqX4KuAIOCqleCqsOCrgCDgqqjg
qqXgq4AAI1/gqqrgqr7gqpvgqrLgq4sg4Kqu4Kq54Kq/4Kqo4KuLIOCqrOCqpOCqvuCqteCqteCq
viDgqq7gqr7gqp/gq4cg4Kq44KuN4KqV4KuN4Kqw4KuL4KqyIOCqleCqsOCriwANI+CqquCrieCq
qi3gqoXgqqog4Kq14Kq/4Kqo4KuN4Kqh4KuLAA8r4Kqq4KuN4Kqw4KqV4KuN4Kqw4Kq/4Kqv4Kq+
4Kqu4Kq+4KqCIOCqm+CrhwANJeCqquCrjeCqsOCqvuCqsOCqguCqrSDgqqTgqr7gqrDgq4DgqpYA
AwngqqzgqoLgqqcABhDgqqzgqoLgqqcg4Kqb4KuHABpG4Kqs4Kqm4Kqy4KuA4Kqo4KuHIOCqhuCq
l+CqsuCriyDgqq7gqrngqr/gqqjgq4sg4Kqq4Kq44KqC4KqmIOCqleCqsOCriwAbSeCqrOCqpuCq
suCrgOCqqOCrhyDgqqrgqr7gqpvgqrLgq4sg4Kqu4Kq54Kq/4Kqo4KuLIOCqquCquOCqguCqpiDg
qpXgqrDgq4sABxPgqqzgqqfgq4Ag4Kqc4KuB4KqTABAq4Kqs4KuL4Kqf4KquIOCqtuCrgOCqnyDg
qpvgq4vgqqHgq4Ag4Kqm4KuLABEt4Kqs4KuL4Kqf4KquIOCqtuCrgOCqnyDgqqjgqr7gqqjgq4Ag
4KqV4Kqw4KuLABEt4Kqs4KuL4Kqf4KquIOCqtuCrgOCqnyDgqq7gq4vgqp/gq4Ag4KqV4Kqw4KuL
AAUP4Kqu4Kq/4Kqo4Kq/4KqfAA4m4Kqu4Kq/4Kqo4Kq/4KqfIOCqquCquOCqguCqpiDgqpXgqrDg
q4sAChzgqq7gqr/gqqjgqr/gqp8g4Kqu4Kq+4Kqf4KuHAAoc4Kqu4KuL4Kqf4KuAIOCqleCqsOCr
h+CqsuCrgAAMIuCqsOCrh+CqguCqnOCqqOCrgCDgqrbgqrDgq4LgqobgqqQADijgqrDgq4fgqoLg
qpzgqqjgq4Ag4Kq44Kqu4Kq+4Kqq4KuN4Kqk4Kq/AAsf4Kqw4KuH4Kqo4KuN4Kqc4Kqu4Kq+4KqC
IOCqm+CrhwALH+CqteCqp+CrgSDgqrXgqr/gqpXgqrLgq43gqqrgq4sAGDjgqrXgqrDgq43gqrcg
JTEkcyDgqqrgqrAg4Kqo4KuF4Kq14Kq/4KqX4KuH4KqfIOCqleCqsOCriwBRgNXgqrXgqrDgq43g
qrcg4Kqq4Kq44KqC4KqmIOCqleCqsOCqteCqviDgqq7gqr7gqp/gq4cg4Kq44KuN4Kq14Kq+4KqH
4KqqIOCqleCqsOCriyDgqoXgqqXgqrXgqr4g4Kqm4Kq/4Kq14Kq44Kqo4KuAIOCqquCquOCqguCq
puCql+CrgCDgqqrgqrAg4Kqq4Kq+4Kqb4Kq+IOCquOCrjeCqteCqv+CqmiDgqpXgqrDgqrXgqr4g
4Kqu4Kq+4Kqf4KuHIOCqn+CrheCqqiDgqpXgqrDgq4sAJGDgqrXgqrDgq43gqrcg4Kqq4Kq44KqC
4KqmIOCqleCqsOCqteCqvuCqqOCqviDgqrXgqr/gqpXgqrLgq43gqqog4Kqq4KqwIOCquOCrjeCq
teCqv+CqmiDgqpXgqrDgq4sAHU/gqrXgqrDgq43gqrcg4Kqu4Kq+4Kqf4KuH4Kqo4KuB4KqCIOCq
quCqv+CqleCqsCDgqqbgq4Pgqrbgq43gqq/gqq7gqr7gqqgg4Kqb4KuHAAYS4Kq14KuA4Kqh4Kq/
4Kqv4KuLAAgW4Kq14KuJ4KqH4Kq4IOCqtuCri+CqpwALHeCqtuCrgOCqnyDgqqzgqoLgqqcg4KqV
4Kqw4KuLAAoc4Kq24KuL4KqnIOCqleCrjeCqteCrh+CqsOCrgAAEDOCqtuCri+Cqp+CriwAFD+Cq
tuCri+Cqp+Cri+KApgALH+CquOCqguCqleCrgeCqmuCqv+CqpCDgqpXgqrDgq4sACx/gqrjgqoLg
qrXgqr7gqqYg4Kqs4KuJ4KqV4KuN4Kq4AAoc4Kq44Kqu4Kq+4Kqq4KuN4KqkIOCqleCqsOCriwAN
JeCquOCqruCqvuCqquCrjeCqpOCqvyDgqqTgqr7gqrDgq4DgqpYADSPgqrjgq4Lgqprgqqjgq4sg
4Kqo4KuA4Kqa4KuHIOCqm+CrhwAFD+CquOCrjeCqteCqv+CqmgASKOCqueCqvuCqsuCqqOCrgCDg
qqrgqrjgqoLgqqbgqpfgq4A6ICUxJHMACQklMSRkIHBlcmMADhAlMSRkIHN6w6F6YWzDqWsuAAgJ
JTEkZCDDs3JhADY+QSBkw6F0dW0gYSB2w6FydCBpZMWRdGFydG9tw6FueW9uICglMSRzIOKAkyAl
MiRzKSBrw612w7xsIGVzaWsALjFBIGTDoXR1bSBuZW0gZmVsZWwgbWVnIGEgdsOhcnQgZm9ybcOh
dHVtbmFrOiAlMSRzABQWQXogYWxzw7MgbGFwIGVsdmV0w6lzZQAVF0F6IGFsc8OzIGxhcCBraWJv
bnTDoXNhABgbQXogYWxzw7MgbGFwIMO2c3N6ZWNzdWvDoXNhABYYQXogw7Zzc3plcyBtZWd0ZWtp
bnTDqXNlAAICQkUAAgJCZQAJCkJlZmVqZXrDqXMAEBJCZWZlamV6w6lzIGTDoXR1bWEADBBCZWrD
tnbFkSBow612w6FzABQaQmVqw7Z2xZEgaMOtdsOhcyBzesWxcsOpc2UAYm1Dc8O6c3p0YXTDoXNz
YWwga2l2w6FsYXN6dGhhdGphIGEga8OtdsOhbnQgw6l2ZXQsIHZhZ3kga29wcGludMOhc3NhbCB2
aXNzemF2w6FsdGhhdCBhIG5hcCBraXbDoWxhc3p0w6Fzw6Fob3ouAAUGRMOhdHVtABIVRMOhdHVt
IGtpdsOhbGFzenTDoXNhABASRMOhdHVtb2sgbWVnYWTDoXNhAAoMRWxlbWxlw61yw6FzABgcRWxl
bWxlw61yw6FzIG1lZ2plbGVuw610w6lzZQAKDEVsdXRhc8OtdMOhcwAHCEVsdmV0w6lzAA0PRWzF
kXVncsOzIGFibGFrAAMDRmVsAAcIRm9nYWTDoXMACAlGb2fDs3BvbnQACwtGb2x5YW1hdGJhbgAp
L0fDtnJnZXNzZW4gYSBrb3LDoWJiaSDDqXZlayBtZWdqZWxlbsOtdMOpc8OpaGV6ACkwR8O2cmdl
c3NlbiBhIGvDqXPFkWJiaSDDqXZlayBtZWdqZWxlbsOtdMOpc8OpaGV6ACwzR8O2cmdlc3NlbiBh
IGvDtnZldGtlesWRIGjDs25hcCBtZWdqZWxlbsOtdMOpc8OpaGV6ACkwR8O2cmdlc3NlbiBheiBl
bMWResWRIGjDs25hcCBtZWdqZWxlbsOtdMOpc8OpaGV6ABETSGFuZ2FsYXDDuiBrZXJlc8OpcwAP
E0hhdMOza8O2csO2biBiZWzDvGwAERNIw612w6FzIGZvbHlhbWF0YmFuABARSmF2YXNsYXRvayBh
bMOhYmIAGhtKZWxlbmxlZyBraXbDoWxhc3p0dmE6ICUxJHMAAgJLSQAICUthcGNzb2zDswAHCEtl
cmVzw6lzABMWS2VyZXPDqXNpIGxla8OpcmRlesOpcwAIC0tlcmVzw6lz4oCmAAsNS2V6ZMWRIGTD
oXR1bQACAktpAAgIS2lib250dmEACQpLaWplbMO2bHZlABIUS2l2w6FsYXN6dG90dCBkw6F0dW0A
BAVLw6lzegADA0xhcAAOEkxlZ8O2cmTDvGzFkSBtZW7DvAASFkxla8OpcmRlesOpcyBrw7xsZMOp
c2UAEhZMZWvDqXJkZXrDqXMgdMO2cmzDqXNlABUaTMOhdGhhdMOzIGF6IMOpdnbDoWxhc3p0w7MA
AgJNYQAOD01lZ2Fkb3R0IGTDoXR1bQAUFU1lZ2Fkb3R0IGTDoXR1bTogJTEkcwAnK01lZ29zenTD
oXMgYSBrw7Z2ZXRrZXrFkSBhbGthbG1hesOhc3NhbDogJXMAGRxNZWdvc3p0w6FzIGEga8O2dmV0
a2V6xZF2ZWw6ABETTXVua2FsYXAgYmV6w6Fyw6FzYQAPEk5hdmlnw6FjacOzcyBtZW7DvAAYHU5h
dmlnw6FjacOzcyBtZW7DvCBiZXrDoXLDoXNhACEmTmF2aWfDoWzDoXMgYSBrw7Z2ZXRrZXrFkSDD
qXZoZXo6ICUxJHMAHR9OZW0gZW5nZWTDqWx5ZXpldHQgZMOhdHVtOiAlMSRzAAUFTmluY3MADxBO
aW5jcyBraWplbMO2bHZlAAQEUGVyYwARE1BlcmMga2l2w6FsYXN6dMOhc2EADhBQw6FyYmVzesOp
ZGFibGFrABcZUsOpc3psZWdlc2VuIGVsbGVuxZFyaXp2ZQAGCFN6w7Nrw7Z6ABESVGFydG9tw6Fu
eSBrZXpkZXRlAA4QVGFydG9tw6FueSB2w6lnZQATFlRvdsOhYmJpIGxlaGV0xZFzw6lnZWsAERNV
Z3LDoXMgYSBmxZFvbGRhbHJhAAUGVmlkZcOzAB4iVsOhbGFzc3phIGtpIGEga8OtdsOhbnQgZMOh
dHVtb2thdAAnLFbDoWxhc3N6YSBraSwgaG9neSBkw6lsZWzFkXR0IHZhZ3kgZMOpbHV0w6FuABUX
VsOhbGFzc3pvbiBhbGthbG1hesOhc3QAIypWw6FsdHNvbiBhIGvDrXbDoW50IMOpdiBraXbDoWxh
c3p0w6Fzw6Fob3oAGh9Ww6FsdMOhcyBhIGvDtnZldGtlesWRIGjDs25hcHJhABccVsOhbHTDoXMg
YXogZWzFkXrFkSBow7NuYXByYQAbH1bDoWx0w6FzIG5hcHTDoXJiZXZpdGVsaSBtw7NkcmEAGx9W
w6FsdMOhcyBzesO2dmVnYmV2aXRlbGkgbcOzZHJhAAMDZGUuAAMDZHUuAAYGcGVyY3JlABwfw4ly
dsOpbnl0ZWxlbiBhIG1lZ2Fkb3R0IGTDoXR1bQAQEsOJcnbDqW55dGVsZW4gYWRhdAADBMOTcmEA
EBPDk3JhIGtpdsOhbGFzenTDoXNhAAsMw5Zzc3plY3N1a3ZhAAsNw5Zzc3plY3N1a8OhcwAFB8Oz
csOhcmEACQwlMSRkINC80LjQvS4ABwglMSRkINGHLgADBtCS0JrQmwAECNCS0KvQmtCbAA4b0JLQ
stC10LTQtdC90L3QsNGPINC00LDRgtCwABQh0JLQstC10LTQtdC90L3QsNGPINC00LDRgtCwOiAl
MSRzAAwX0JLQstC10LTQuNGC0LUg0LTQsNGC0YsADhvQktCy0LXQtNC40YLQtSDQt9Cw0L/RgNC+
0YEABAjQktCy0L7QtAAHDtCS0LrQu9Cw0LTQutCwAAgQ0JLQutC70Y7Rh9C10L3QvgAQH9CS0YHQ
v9C70YvQstCw0Y7RidC10LUg0L7QutC90L4ADhvQktGF0L7QtNGP0YnQuNC5INCy0YvQt9C+0LIA
DRnQktGL0LHQtdGA0LjRgtC1INC00LDRgtGDAA0Z0JLRi9Cx0LXRgNC40YLQtSDQtNCw0YLRiwAT
JdCS0YvQsdC10YDQuNGC0LUg0L/RgNC40LvQvtC20LXQvdC40LUAChPQktGL0LHQvtGAINC00LDR
gtGLAA4b0JLRi9Cx0YDQsNC90L3QsNGPINC00LDRgtCwAAcO0JLRi9Cx0YDQsNC90L4ALk3QktGL
0LHRgNCw0YLRjCBBTSAo0LTQviDQv9C+0LvRg9C00L3Rjykg0LjQu9C4IFBNICjQv9C+0YHQu9C1
INC/0L7Qu9GD0LTQvdGPKQAOG9CS0YvQsdGA0LDRgtGMINC80LjQvdGD0YLRiwALFdCS0YvQsdGA
0LDRgtGMINGH0LDRgQALFtCS0YvQv9C+0LvQvdGP0LXRgtGB0Y8ADx3Qk9C+0LvQvtGB0L7QstC+
0Lkg0L/QvtC40YHQugALFdCU0LDRgtCwINC90LDRh9Cw0LvQsAAvUNCU0LDRgtCwINC90LUg0LLR
hdC+0LTQuNGCINCyINC00L7Qv9GD0YHRgtC40LzRi9C5INC00LjQsNC/0LDQt9C+0L06ICUxJHPi
gJMlMiRzAC9U0JTQsNGC0LAg0L3QtSDRgdC+0L7RgtCy0LXRgtGB0YLQstGD0LXRgiDQtNC+0L/R
g9GB0YLQuNC80L7QvNGDINGI0LDQsdC70L7QvdGDOiAlMSRzAA4b0JTQsNGC0LAg0L7QutC+0L3R
h9Cw0L3QuNGPABQl0JTQtdC90Ywg0LIg0LTQuNCw0L/QsNC30L7QvdC1INC00LDRggAPHdCU0LjQ
sNC70L7Qs9C+0LLQvtC1INC+0LrQvdC+AAMG0JXRidGRAAkS0JfQsNCy0LXRgNGI0LjRgtGMAAcO
0JfQsNC60YDRi9GC0YwADBfQl9Cw0LrRgNGL0YLRjCDQu9C40YHRggAWKtCX0LDQutGA0YvRgtGM
INC80LXQvdGOINC90LDQstC40LPQsNGG0LjQuAAUJtCX0LDQutGA0YvRgtGMINC90LjQttC90LjQ
uSDRjdC60YDQsNC9AA8d0JrQvtC90LXRhiDQtNC40LDQv9Cw0LfQvtC90LAAEiPQnNCw0YDQutC1
0YAg0L/QtdGA0LXQvNC10YnQtdC90LjRjwAOG9Cc0LXQvdGOINC90LDQstC40LPQsNGG0LjQuAAG
DNCc0LjQvdGD0YLRiwAQH9Cd0LDRh9Cw0LvQviDQtNC40LDQv9Cw0LfQvtC90LAAChPQndC1INCy
0YvQsdGA0LDQvdC+ABcn0J3QtdC00L7Qv9GD0YHRgtC40LzQsNGPINC00LDRgtCwOiAlMSRzABEh
0J3QtdC/0YDQsNCy0LjQu9GM0L3Ri9C5INCy0LLQvtC0AAMG0J3QtdGCAAgQ0J7RgtCy0LXRgtC4
0YLRjAAJEtCe0YLQutC70L7QvdC40YLRjAAJEtCe0YLQutC70Y7Rh9C10L3QvgARIdCe0YLQvNC1
0YfQtdC90L4g0YfQsNGB0YLQuNGH0L3QvgAXLNCe0YLQvtCx0YDQsNC20LDQtdC80YvQuSDQstGL
0LHQvtGAINCz0L7QtNCwABAf0J7RgtC/0YDQsNCy0LjRgtGMINC30LDQv9GA0L7RgQAcNNCf0LXR
gNC10LnRgtC4INCyINGA0LXQttC40Lwg0LLQstC+0LTQsCDRgtC10LrRgdGC0LAAGzLQn9C10YDQ
tdC50YLQuCDQsiDRgNC10LbQuNC8INCy0YvQsdC+0YDQsCDQtNCw0YLRiwANGdCf0LXRgNC10LnR
gtC4INCy0LLQtdGA0YUAFSfQn9C10YDQtdC50YLQuCDQuiDQstGL0LHQvtGA0YMg0LPQvtC00LAA
HDXQn9C10YDQtdC50YLQuCDQuiDQv9GA0LXQtNGL0LTRg9GJ0LXQvNGDINC80LXRgdGP0YbRgwAb
M9Cf0LXRgNC10LnRgtC4INC6INGB0LvQtdC00YPRjtGJ0LXQvNGDINC80LXRgdGP0YbRgwAYLdCf
0LXRgNC10LnRgtC4INC90LAg0LPQu9Cw0LLQvdGL0Lkg0Y3QutGA0LDQvQANGtCf0LXRgNC10LrQ
u9GO0YfQsNGC0LXQu9GMABMf0J/QtdGA0LXRhdC+0LQg0LogJTEkcyDQs9C+0LTRgwAUJtCf0L7Q
tNC10LvQuNGC0YzRgdGPINGBINC/0L7QvNC+0YnRjNGOABcp0J/QvtC00LXQu9C40YLRjNGB0Y8g
0YEg0L/QvtC80L7RidGM0Y4gJXMAFyzQn9C+0LTRgdC60LDQt9C60Lgg0L/QvtC60LDQt9Cw0L3R
iyDQvdC40LbQtQAFCtCf0L7QuNGB0LoAEB/Qn9C+0LjRgdC60L7QstGL0Lkg0LfQsNC/0YDQvtGB
AAwX0J/QvtC60LDQt9Cw0YLRjCDQstGB0LUAEiPQn9C+0LrQsNC30LDRgtGMINC/0L7QtNGB0LrQ
sNC30LrRgwAGDNCf0YDQvtCx0LXQuwBSgJTQn9GA0L7QstC10LTQuNGC0LUg0L/QviDRjdC60YDQ
sNC90YMsINGH0YLQvtCx0Ysg0LLRi9Cx0YDQsNGC0Ywg0LPQvtC0LCDQuNC70Lgg0L3QsNC20LzQ
uNGC0LUsINGH0YLQvtCx0Ysg0LLQtdGA0L3Rg9GC0YzRgdGPINC6INCy0YvQsdC+0YDRgyDQtNC9
0Y8uAB860J/RgNC+0LrRgNGD0YLQuNGC0LUg0LTQviDQsdC+0LvQtdC1INC/0L7Qt9C00L3QuNGF
INC70LXRggAeONCf0YDQvtC60YDRg9GC0LjRgtC1INC00L4g0LHQvtC70LXQtSDRgNCw0L3QvdC4
0YUg0LvQtdGCACA90J/RgNC+0LrRgNGD0YLQuNGC0LUg0LTQviDQv9GA0LXQtNGL0LTRg9GJ0LXQ
s9C+INC80LXRgdGP0YbQsAAfO9Cf0YDQvtC60YDRg9GC0LjRgtC1INC00L4g0YHQu9C10LTRg9GO
0YnQtdCz0L4g0LzQtdGB0Y/RhtCwABAZ0J/RgNC+0YbQtdC90YLQvtCyOiAlMSRkLgAKFNCg0LDQ
t9Cy0LXRgNC90YPRgtC+ABcs0KDQsNC30LLQtdGA0L3Rg9GC0Ywg0L3QuNC20L3QuNC5INGN0LrR
gNCw0L0AEyXQoNCw0YHQutGA0YvQstCw0Y7RidC10LXRgdGPINC80LXQvdGOAAgQ0KHQstC10YDQ
vdGD0YLQvgAIENCh0LLQtdGA0L3Rg9GC0YwAFSjQodCy0LXRgNC90YPRgtGMINC90LjQttC90LjQ
uSDRjdC60YDQsNC9AAcO0KHQtdCz0L7QtNC90Y8ADRnQodGC0YDQvtC60LAg0L/QvtC40YHQutCw
ABMf0KLQtdC60YPRidC40Lkg0LLRi9Cx0L7RgDogJTEkcwANGdCi0LXQutGD0YnQuNC5INCy0YvQ
t9C+0LIADhvQo9C00LDQu9C40YLRjCDQt9Cw0L/RgNC+0YEAIT7Qo9C60LDQt9Cw0L0g0L3QtdC0
0L7Qv9GD0YHRgtC40LzRi9C5INC00LjQsNC/0LDQt9C+0L0g0LTQsNGCLgAbNNCk0LjQu9GM0YLR
gNCw0YbQuNGPINCy0YXQvtC00Y/RidC10LPQviDQstGL0LfQvtCy0LAABAjQp9Cw0YHRiwAGDNC8
0LjQvdGD0YLRiwAECNGH0LDRgdGLABERJTEkZCBhbWFwaGVzZW50aS4AERFBbWFob3JhIGFuZ3Ut
JTEkZAALC0F5aWtoZXRoaXdlABMTQm9uaXNhIGl0aHVsaXRoaXBodQAKCkJ1a2Ega29ua2UABgZD
aGl0aGEAFxdDaGl0aGEgaXNoaWRpIGVsaXBoYW5zaQAQEEV6aW55ZSBpemlua2V0aG8ADQ1GYWth
IGl6aW5zdWt1ABERRnVuYSBrdW55YWthICUxJHMABARHb3FhABUVR29xYSBpc2hpZGkgZWxpcGhh
bnNpAA8PSHVkdWxhIGlzaWJhbWJpAAgISWJob2tpc2kABQVJaG9yYQAPD0lraG9saSBlbmdlbmF5
bwAREUlraG9saSBlcWh1YmVrYXlvABERSW1lbnl1IGV5YSBwaGFuc2kAExNJbWVueXUgeW9rdXp1
bGF6dWxhAAcHSW1lbnl1KwAREUltaXp1enUgZW5ndS0lMSRkAB4eSXNpa2hldGhpIHNvbnlha2Eg
c2l5YWJvbmFrYWxhAAcHSXRoZWJodQAMDEl0aHVsaXRoaXBodQAHB0l2aWRpeW8AExNJd2luZGkg
TGVzaWtoYXNoYW5hABUVSXppcGhha2FtaXNvIG5nZXphbnNpAAwMS2hldGhhIGlob3JhAA4OS2hl
dGhhIGltaXp1enUADQ1LaGV0aGEgaW5zaXphAA8PS2hldGhhIGl6aW5zdWt1ABUVS2hldGhhIHUt
QU0gbm9tYSB1LVBNAAwMS2hldGhhIHVzdWt1AAcHS3ViYW5nYQAICEt1Z29xaXdlABAQS3VobG9s
d2Uga2FuY2FuZQALC0t1bndldHNoaXdlAAsLS3V5YXFodWJla2EACAhLd2Vueml3ZQAFBUx1dGhv
AAcHTmFtdWhsYQAWFk53ZWJhIGlzaGlkaSBlbGlwaGFuc2kAKipPa29rdWZha2Ega3dlYmFuZ2Eg
bG9zdWt1IG9rdW5nYXZ1bWVsZWtpbGUAGBhPa3VmYWt3YXlvIG9rdW5nYWx1bmdpbGUACwtPa3Vr
aGV0aGl3ZQAICFBoZW5kdWxhAAUFU2VzaGEADAxTZXNoYSB1bWJ1em8ABghTZXNoYeKApgAICFNo
aW50c2hhAB0dU2hpbnRzaGVsYSBla3VraGV0aGVuaSB1bnlha2EAGhpTaGludHNoZWxhIGt1bnlh
bmdhIGVkbHVsZQAeHlNoaW50c2hlbGEga3VueWFuZ2EgZWxhbmRlbGF5bwAmJlNoaW50c2hlbGEg
a3dpbW9kaSB5b2t1ZmFrYSB5ZWtoYWxlbmRhACQkU2hpbnRzaGVsYSBrd2ltb2RpIHlva3VmYWth
IHlvbWJoYWxvACYmU2tyb2xhIHVrdXplIHVib25pc2UgaW1pbnlha2EgeWFrYW11dmEALS1Ta3Jv
bGEgdWt1emUgdWJvbmlzZSBpbWlueWFrYSB5YW5nYXBoYW1iaWxpbmkAIyNTa3JvbGEgdWt1emUg
dWJvbmlzZSBpbnlhbmdhIGVkbHVsZQAnJ1Nrcm9sYSB1a3V6ZSB1Ym9uaXNlIGlueWFuZ2EgZWxh
bmRlbGF5bwAMDFN1bGEgaW5raW5nYQBKSlN3YXlpcGhhIHVrdXplIHVraGV0aGUgdW55YWthLCBu
b21hIHRoZXBoYSB1a3V6ZSB1YnV5ZWxlIGVrdWtoZXRoZW5pIHVzdWt1AA4OVGh1bWVsYSB1bWJ1
em8AGBhVa3VraGV0aGEga3dhbWFuamU6ICUxJHMAERFVa3VxYWxhIGtvYnViYW56aQAPD1VrdXNl
c2hhIG5nZXp3aQAXF1VrdXZlemEgaWtob2xpIGVuZ2VuYXlvABMTVW1raGF3dWxvIHdvYnViYW56
aQAGBlVtenV6dQAFBVVzdWt1ACsrVXN1a3UgYWx1ZmFuaSBuZXBoZXRoaW5pIGVsaW5kZWxla2ls
ZTogJTEkcwAXF1VzdWt1IGFsdXZ1bnllbHdlOiAlMSRzAA8PVXN1a3UgbG9rdXBoZWxhAA4OVXN1
a3UgbG9rdXFhbGEAPj5Vc3VrdSBsdW5nYXBoYW5kbGUga3dlYmFuZ2EgbG9ueWFrYSBlbGlsaW5k
ZWxla2lsZSAlMSRzIC0gJTIkcwAPD1VzdWt1IG9sdWZha2l3ZQAVFVVzdWt1IG9sdWZha2l3ZTog
JTEkcwAEBFZBTEEABARWVUxBAAsLVmFsYSBVY2luZ28AGBhWYWxhIGltZW55dSB5b2t1enVsYXp1
bGEACwtWYWxhIGlzaGlkaQAGBlZhbGl3ZQAGBlZ1bGl3ZQAODllhYmVsYW5hIG5lLSVzAAsLWWFi
ZWxhbmEgbm8ABwdZZW5xYWJhABERWnVsYXp1bGVsYSBla2hheWEAEhJadWxhenVsZWxhIHBoZXp1
bHUABwduZ2Vob3JhAAkJbmdlbWl6dXp1AAkKKG1pbsWrdGVzKQAJCShzdHVuZGFzKQASFEFpenbE
k3J0IGl6a2zEgWpsYXB1ABseQWl6dsSTcnQgbmF2aWfEgWNpamFzIGl6dsSTbG5pABccQWx0ZXJu
xJPFoWFuYXMgdGF1c3RpxYbFocKgKwAICUF0YmlsZMSTdAAQEEF0bGFzaWV0IGRhdHVtdXMADg9B
dGxhc8SrdCBkYXR1bXUADxFBdGxhc8SrdCBtaW7Fq3RlcwAOD0F0bGFzxKt0IHN0dW5kdQA0QUF0
bGFzxKt0IOKAnEFN4oCdIChwcmlla8WhcHVzZGllbsSBKSB2YWkg4oCcUE3igJ0gKHDEk2NwdXNk
aWVuxIEpABESQXRsYXPEq3RhaXMgZGF0dW1zABQXQXRsYXPEq3RhasSBIGRpYXBhem9uxIEACAlB
dGxhc8SrdHMADAxCZWlndSBkYXR1bXMABQVDaWxuZQANDUNpdGFzIG9wY2lqYXMABgZEYXR1bXMA
GBlEYXR1bXMgbmF2IGF0xLxhdXRzOiAlMSRzADY8RGF0dW1zIG5hdiBwYXJlZHrEk3RhasSBIGdh
ZHUgZGlhcGF6b27EgSAoJTEkcy7igJMlMiRzLsKgZy4pACwuRGF0dW1zIG5lYXRiaWxzdCBwYXJl
ZHrEk3RhamFtIGZvcm3EgXRhbTogJTEkcwAPE0RhxLzEk2ppIGF0esSrbcSTdGEADQ9EaWFsb2ds
b2R6acWGxaEAEBBEaWFwYXpvbmEgYmVpZ2FzABARRGlhcGF6b25hIHPEgWt1bXMAFBdGdW5rY2lq
YXMgdGF1c3RpxYbFocKgKwAGBkdhdGF2cwAHCElFU0zEkkdUAAcISVpTTMSSR1QAEBJJZW7EgWtv
xaFhaXMgenZhbnMAGR5JZW7EgWtvxaHEgSB6dmFuYSBmaWx0csSTxaFhbmEACAlJZXNsxJNndHMA
EhNJZXNuaWVndCB2YWljxIFqdW11ABAQSWV2YWRpZXQgZGF0dW11cwAREklldmFkxKt0YWlzIGRh
dHVtcwAXGElldmFkxKt0YWlzIGRhdHVtczogJTEkcwAjJUlldmFkxKt0cyBuZWRlcsSrZ3MgZGF0
dW11IGRpYXBhem9ucy4ACAlJenNsxJNndHMAFBVJenbEk2xpZXRpZXMgbGlldG90bmkAHiJJenbE
k3JzdCBla3LEgW5hIGFwYWvFoWRhxLxhcyBsYXB1AAgJSXp2xJNyc3RzAB8gS29wxKtnb3QgYXIg
bGlldG9qdW1wcm9ncmFtbXUgJXMACwxLb3DEq2dvdCBhcjoAJyxMYWkgcsSBZMSrdHUgaWVwcmll
a8WhxJNqbyBtxJNuZXNpLCByaXRpbmlldAAnK0xhaSByxIFkxKt0dSBpZXByaWVrxaHEk2pvcyBn
YWR1cywgcml0aW5pZXQAIiZMYWkgcsSBZMSrdHUgbsSBa2FtbyBtxJNuZXNpLCByaXRpbmlldAAi
JUxhaSByxIFkxKt0dSBuxIFrYW1vcyBnYWR1cywgcml0aW5pZXQAHCBNYWluxKt0IHV6IGllcHJp
ZWvFocSTam8gbcSTbmVzaQAXGk1haW7Eq3QgdXogbsSBa2FtbyBtxJNuZXNpAAoNTWVrbMSTamll
dOKApgAGB01la2zEk3QADxBNZWtsxJN0IGFyIGJhbHNpAAkLTWVrbMSTxaFhbmEAFBdNZWtsxJPF
oWFuYXMgdmFpY8SBanVtcwAPEk1ldGEgdGF1c3RpxYbFocKgKwAHCE1pbsWrdGVzAA0OTWluxat0
ZXM6ICUxJGQAAwNOYXYADA1OYXYgYXRsYXPEq3RzABMVTmF2aWfEgWNpamFzIGl6dsSTbG5lAA8Q
TmVkZXLEq2dhIGlldmFkZQARFE5vbGFpxb5hbcSBIGl6dsSTbG5lAAgJTm9yYWlkxKt0AB8jTm9y
YWlkxKt0IGVrcsSBbmEgYXBha8WhZGHEvGFzIGxhcHUADxBOb3RpZWsgYXBzdHLEgWRlABEUTm90
xKtyxKt0IHZhaWPEgWp1bXUAEhRQYcWhcmVpesSTamFpcyB6dmFucwAXGlBhxaFyZWl6xJNqxIEg
YXRsYXNlOiAlMSRzAA4QUG9nYSBJenbEk2xuZcKgKwAPEFByb2NlbnRpOsKgJTEkZC4AFBZQxIFy
aWV0IHV6ICUxJHMuwqBnYWR1ABUWUMSBcmlldCB1eiBnYWRhIGF0bGFzaQAnLFDEgXJzbMSTZ3Rp
ZXMgdXoga2FsZW5kxIFyYSBpZXZhZGVzIHJlxb7Eq211ACQoUMSBcnNsxJNndGllcyB1eiB0ZWtz
dGEgaWV2YWRlcyByZcW+xKttdQAXHVDEgXJzbMSTZ8WhYW5hcyB0YXVzdGnFhsWhwqArAAkKUMSB
cnRyYXVrdAAVF1DEgXJ2aWV0b3RpZXMgdXogYXVnxaF1AB0gUMSBcnZpZXRvdGllcyB1eiBzxIFr
dW1hIGVrcsSBbnUAFxlSZWR6YW1zIGdhZGEgYXRsYXPEq3TEgWpzABEUUsSBZMSrdCByxKtrYSBw
YWRvbXUACwxSxKtrYSBwYWRvbXMABwhTYWvEvGF1dAAeIlNha8S8YXV0IGVrcsSBbmEgYXBha8Wh
ZGHEvGFzIGxhcHUACAlTYWvEvGF1dHMAEhVTaW1ib2x1IHRhdXN0acWGxaHCoCsACwxTa2F0xKt0
IHZpc3UABwhTbMSTZHppcwAHB1N0dW5kYXMADQ5TxIFrdW1hIGRhdHVtcwAaHFTEgWzEgWsgaXIg
c25pZWd0aSBpZXRlaWt1bWkAERJVem5pcnN0b8WhYWlzIGxvZ3MAFBlWYWTEq8WhYW5hcyB0YXVz
dGnFhsWhwqArAFVYVmVsY2lldCwgbGFpIGF0bGFzxKt0dSBnYWR1LCB2YWkgcGllc2thcmlldGll
cywgbGFpIHDEgXJpZXR1IGF0cGFrYcS8IHBpZSBkaWVuYXMgYXRsYXNlcwAPEFZpbGvFoWFuYXMg
dHVyaXMAEhRhdHN0YXJwZXMgdGF1c3RpxYbFoQARFWR6xJPFoWFuYXMgdGF1c3RpxYbFoQAUGGll
dmFkxKvFoWFuYXMgdGF1c3RpxYbFoQAGB8Wgb2RpZW4ADAwlMSRkIG1pbnV0ZXIACwslMSRkIHRp
bW1hcgASEkFrdHVlbGx0IHZhbDogJTEkcwAGCEFsdMKgK8KgAAoKQW5nZSBkYXR1bQAKCkFuZ2Ug
dGltbWUADQ1BbmdpdmV0IGRhdHVtABMTQW5naXZldCBkYXR1bTogJTEkcwAGBkF2dmlzYQALC0Jl
c2tyaXZuaW5nABUXQnl0IHRpbGwgYXR0IHbDpGxqYSDDpXIAJCVCeXQgdGlsbCBrYWxlbmRlciBz
b20gaW5tYXRuaW5nc2zDpGdlACAhQnl0IHRpbGwgdGV4dCBzb20gaW5tYXRuaW5nc2zDpGdlAAcJ
Q3RybMKgK8KgAD5ERGF0dW1ldCBmYWxsZXIgdXRhbmbDtnIgZGV0IGbDtnJ2w6RudGFkZSDDpXJz
aW50ZXJ2YWxsZXQgJTEkc+KAkyUyJHMAMjREYXR1bWV0IG1hdGNoYXIgaW50ZSBkZXQgZsO2cnbD
pG50YWRlIGZvcm1hdGV0OiAlMSRzAB4gRGF0dW1ldCDDpHIgaW50ZSB0aWxsw6V0ZXQ6ICUxJHMA
CAhEZWxhIG1lZAALC0RlbGEgbWVkICVzAA8PRGVsdmlzIG1hcmtlcmFkAAoKRGlhbG9ncnV0YQAC
AkVNAB8fRXR0IGlua29tbWFuZGUgc2FtdGFsIGZpbHRyZXJhcwAnJ0V0dCBvZ2lsdGlndCBkYXR1
bWludGVydmFsbCBoYXIgYW5nZXR0cwACAkZNAA8PRmxlciBhbHRlcm5hdGl2AAQERmxpawALDUZ1
bmt0aW9uwqArwqAABwdIYW5kdGFnAAUFSW5nZXQAERFJbmtvbW1hbmRlIHNhbXRhbAAODklub20g
aW50ZXJ2YWxsAAkJSW50ZSB2YWxkABMUSW50ZXJ2YWxsZXRzIGLDtnJqYW4AERFJbnRlcnZhbGxl
dHMgc2x1dAAFBknCoGRhZwAEBEtsYXIADAxLbG9ja2FuICUxJGQACgpLb21wcmltZXJhACosS29t
cHJpbWVyYSBhcmtldCBww6UgbmVkcmUgZGVsZW4gYXYgc2vDpHJtZW4ACwtLb21wcmltZXJhZAAH
CUzDpGdnIHDDpQAHCU1lbnnCoCvCoAAHCU1ldGHCoCvCoAAMDE5hdmlnZXJhIGhlbQASEk5hdmln
ZXJhIHRpbGwgJTEkcwAOD05hdmlnZXJhIHVwcMOldAAPD05hdmlnZXJpbmdzbWVueQAPD09naWx0
aWdhIGluZGF0YQANDlBvcHVwLWbDtm5zdGVyAA8RUMOlZ8OlZW5kZSBzYW10YWwABwdSZWdsYWdl
AA8PUnVsbGdhcmRpbnNtZW55AAsNUsO2c3Rzw7ZrbmluZwAlKVNjcm9sbGEgZsO2ciBhdHQgdmlz
YSBmw7ZyZWfDpWVuZGUgbcOlbmFkACImU2Nyb2xsYSBmw7ZyIGF0dCB2aXNhIGbDtnJlZ8OlZW5k
ZSDDpXIAICNTY3JvbGxhIGbDtnIgYXR0IHZpc2EgbsOkc3RhIG3DpW5hZAAeIFNjcm9sbGEgZsO2
ciBhdHQgdmlzYSBzZW5hcmUgw6VyABARU2UgZsO2cnNsYWcgbmVkYW4ADA1Ta2lja2EgZnLDpWdh
AAgKU2tpZnTCoCvCoAAJCVNsdXRkYXR1bQAFBlN0w6RuZwAlKFN0w6RuZyBhcmtldCBww6UgbmVk
cmUgZGVsZW4gYXYgc2vDpHJtZW4AERJTdMOkbmcga2Fsa3lsYXJrZXQAFhdTdMOkbmcgbmF2aWdl
cmluZ3NtZW55bgBKUVN2ZXAgZsO2ciBhdHQgdsOkbGphIGV0dCDDpXIgZWxsZXIgdHJ5Y2sgZsO2
ciBhdHQgw6V0ZXJnw6UgdGlsbCBhdHQgdsOkbGphIGVuIGRhZwAJC1N5bWJvbMKgK8KgAAMEU8O2
awAFCFPDtmsg4oCmAAgKU8O2a2Zyw6VnYQAOD1RhIGJvcnQgZnLDpWdhbgAFBVRpbW1lACUoVXTD
tmthIGFya2V0IHDDpSBuZWRyZSBkZWxlbiBhdiBza8Okcm1lbgAGB1V0w7ZrYWQABARWYWx0AAoK
VmFsdCBkYXR1bQAJCVZpc2EgYWxsYQAQEFZpc2EgYmVza3Jpdm5pbmcACgtWw6RsaiBkYXR1bQAL
DFbDpGxqIGVuIGFwcAAVFlbDpGxqIG1lbGxhbiBGTSBvY2ggRU0ADA1Ww6RsaiBtaW51dGVyAAkJ
YmxhbmtzdGVnAAsMZsO2ciBtaW51dGVyAAoLZsO2ciB0aW1tYXIABQVyZXR1cgAbH8OEbmRyYSB0
aWxsIGbDtnJlZ8OlZW5kZSBtw6VuYWQAFhnDhG5kcmEgdGlsbCBuw6RzdGEgbcOlbmFkABQXw4Vy
dsOkbGphcmVuIMOkciBzeW5saWcADBIlMSRkINeQ15fXldeW15nXnS4ABghDdHJsK+KAjgAOGteR
15XXqNeoINeU16nXoNeUINeS15zXldeZAA4b15HXl9eZ16jXqiDXkNek15zXmden16bXmdeUAAoT
15HXl9eZ16jXqiDXk9en15XXqgAJEdeR15fXmdeo16og16nXoteUAAsV15HXl9eZ16jXqiDXqteQ
16jXmdeaAA0Z15HXl9eZ16jXqiDXqteQ16jXmdeb15nXnQAFCteR15jXldeV15cABgzXkdeq15TX
nNeZ15oABQrXk9eX15nXmdeUAAQI15PXp9eV16oADBfXlNeW16DXqiDXqteQ16jXmdeb15nXnQAT
I9eU15fXnNek15Qg15zXkdeX15nXqNeUINep15wg16nXoNeUAAQI15TXmdeV150ACA/XlNeh15HX
qCDXp9em16gACRHXlNem15LXqiDXlNeb15XXnAANGNeU16bXkteqINeU16HXkdeoINen16bXqAAS
IteU16bXoteV16og157Xldek15nXoteV16og15zXnteY15QADBbXlNen15zXmCDXnNeQINeq16fX
mdefABQm15TXqNeX15HXqiDXlNeS15nXnNeZ15XXnyDXlNeq15fXqteV158ADBfXlNeq15DXqNeZ
15og15TXoNeR15fXqAAMF9eU16rXkNeo15nXmiDXqdeU15XXltefAAUK15XXmdeT15DXlQAFCteX
15nXpNeV16kAChPXl9eZ16TXldepINen15XXnNeZAAYN15fXmdek15XXqeKApgAJEdeX15zXldef
INen15XXpNelADdj15nXqSDXnNeU15fXnNeZ16cg15vXk9eZINec15HXl9eV16gg16nXoNeULCDX
kNeVINec15TXp9eZ16kg15vXk9eZINec15fXlteV16gg15zXkdeX15nXqNeqINeU15nXldedAAQI
15vXkdeV15kABQrXm9eZ15XXldelABQm15vXmdeV15XXpSDXlNeS15nXnNeZ15XXnyDXlNeq15fX
qteV158ABw3XnNeQINeg15HXl9eoAAMG15zXnNeQAAUK157Xldek16LXnAAFCtee15XXqNeX15EA
BQrXnteX15nXp9eUAA0Z157Xl9eZ16fXqiDXlNep15DXmdec16rXlAAFCtee15vXldeV16UADBfX
nteh15XXnteg16og15fXnNen15nXqgAOGtee16LXkdeoINec15fXldeT16kg15TXkdeQABAe157X
oteR16gg15zXl9eV15PXqSDXlNen15XXk9edABYo157XoteR16gg15zXqdeZ15jXqiDXp9ec15gg
16nXnCDXmNen16HXmAAWKNee16LXkdeoINec16nXmdeY16og16fXnNeYINep15wg15nXldee158A
BAjXntei16DXlAADBtee16rXkgAECNeg15HXl9eoAA4a16DXmdeV15XXmCDXnNeT16Mg15TXkdeZ
16oACxXXoNeZ15XXldeYINec157Xotec15QABQrXoNeZ16rXldenABIi16DXp9eV15PXqiDXkNeX
15nXlteUINec15LXqNeZ16jXlAAFCteh15LXmdeo15QADRnXodeS15nXqNeqINeU15LXmdec15nX
ldefABQm16HXkteZ16jXqiDXlNeS15nXnNeZ15XXnyDXlNeq15fXqteV158AEiLXodeS15nXqNeq
INeq16TXqNeZ15gg15TXoNeZ15XXldeYAAkR16HXldejINeU15jXldeV15cABAjXodeZ15XXnQAQ
Hteh15nXoNeV158g16nXmdeX15Qg16DXm9eg16HXqgAMF9ei15XXkyDXkNek16nXqNeV15nXldeq
AAQI16TXldei15wAITzXpteo15nXmiDXnNeS15zXldecINeb15PXmSDXnNeU16bXmdeSINeQ16og
15TXl9eV15PXqSDXlNeR15AAI0DXpteo15nXmiDXnNeS15zXldecINeb15PXmSDXnNeU16bXmdeS
INeQ16og15TXl9eV15PXqSDXlNen15XXk9edACZG16bXqNeZ15og15zXktec15XXnCDXm9eT15kg
15zXlNem15nXkiDXkNeqINeU16nXoNeZ150g15TXnteQ15XXl9eo15XXqgAlRNem16jXmdeaINec
15LXnNeV15wg15vXk9eZINec15TXpteZ15Ig15DXqiDXlNep16DXmdedINeU16fXldeT157Xldeq
ABgs16fXnNeYINeY15XXldeXINeq15DXqNeZ15vXmdedINec15Ag15fXlden15kABAjXqNeV15XX
lwAMF9ep15DXmdec16rXqiDXl9eZ16TXldepAAoT16nXmdeX15Qg16DXm9eg16HXqgAKE9ep15nX
l9eUINek16LXmdec15QACA/XqdeZ16rXldejINei150ACxLXqdeZ16rXldejINei150gJXMADBfX
qdec15nXl9eqINep15DXmdec16rXlAAECNep16LXldeqAAUK16rXkNeo15nXmgALFdeq15DXqNeZ
15og15TXqteX15zXlAAKE9eq15DXqNeZ15og16HXmdeV150ACxXXqteX15nXnNeqINeU15jXldeV
15cACxTXqteZ15HXqiDXk9eVLdep15nXlwAMF9eq16TXqNeZ15gg15TXoNeZ15XXldeYAAoT16rX
pNeo15nXmCDXoNek16rXlwAGC9eq16TXqNeZ15grAAoQ4oCPJTEkZCDXk9en15XXqgAKEOKAjyUx
JGQg16nXoteV16oAFSTigI/XlNeR15fXmdeo15Qg15TXoNeV15vXl9eZ16o6ICUxJHMALE3igI/X
lNeq15DXqNeZ15og15zXkCDXqteV15DXnSDXnNen15Ug15HXmdeY15XXnCDXlNeg16LXmdec15Qg
15TXptek15XXmTogJTEkcwAvTuKAj9eU16rXkNeo15nXmiDXoNee16bXkCDXnteX15XXpSDXnNeY
15XXldeXINeU16nXoNeZ150g15TXptek15XXmSAlMSRzIC0gJTIkcwATIOKAj9eU16rXkNeo15nX
miDXqdeU15XXltefOiAlMSRzAAgN4oCP157Xp9epIFRhYgAQG+KAj9eg15nXldeV15gg15zXqdeg
16ogJTEkcwAYJ+KAj9em16jXmdeaINec15HXl9eV16gg15EtQU0g15DXlSDXkS1QTQAVI+KAj9eq
15DXqNeZ15og15zXkCDXnteV16jXqdeUOiAlMSRzABAQQWlrb25pIHlhIGJ1cnV0YQAMDEFuZ2Fs
aWEgem90ZQAODkFzaWxpbWlhICUxJGQuAAcHQXN1YnVoaQA5OUJhZGlsaXNoYSBrd2VuZGEgbWlw
YW5naWxpbyB5YSBrdWluZ2l6YSBkYXRhIHlhIG1hYW5kaXNoaQAwMEJhZGlsaXNoYSBtaXBhbmdp
bGlvIHlhIGt1aW5naXphIGRhdGEgeWEga2FsZW5kYQAYGENoYWd1YSBBc3VidWhpIGF1IE1jaGFu
YQANDUNoYWd1YSBkYWtpa2EADw9DaGFndWEgcHJvZ3JhbXUACgpDaGFndWEgc2FhAA0NQ2hhZ3Vh
IHRhcmVoZQAMDENoYWd1byB6YWlkaQAGBkRha2lrYQALC0Rha2lrYSAlMSRkAA8PRGlyaXNoYSBJ
YnVraXppAAoKRnVuZ2EgbGFoYQAXF0Z1bmdhIG1lbnl1IHlhIGt1c29nZXphAAkJRnV0YSBob2ph
AAUFSGFtbmEAERFIb2phIHlhIHV0YWZ1dGFqaQAKCkh1amFjaGFndWEACQlJTUVXQVNIV0EACAhJ
TUVaSU1XQQAZGUlsaXlvY2hhZ3VsaXdhIHNhc2E6ICUxJHMAHBxJbWVrYWd1bGl3YSBrd2Ega2lh
c2kgZnVsYW5pAAkJSW1la3VuandhAAsLSW1lcGFudWxpd2EACQlJbWV3YXNod2EACAhJbWV6aW13
YQAZGUluYWNodWphIHNpbXUgdW5heW9waWdpd2EACgpJbmFlbmRlbGVhAAoKSXBvIGthcmlidQAE
BEppYnUACQlLYXRhIHNpbXUABQVLYXRhYQAHB0tpY2h1cG8AFhZLaWRpcmlzaGEgY2hhIHZpZG9r
ZXpvAB4eS2lwaW5kaSBraWxpY2hvd2Vrd2Egc2kgc2FoaWhpABgYS2l0ZXVhIG13YWthIGtpbmFv
bmVrYW5hAAUFS3VuamEAExNLdW5qYSBzYWZ1IHlhIGNoaW5pABQUS3V0YWZ1dGEga3dhIGt1dGFt
a2EAAwNMZW8AHR1NYXBlbmRla2V6byB5YWxpeW8gaGFwYSBjaGluaQAKCk1henVuZ3Vtem8ABgZN
Y2hhbmEADQ1NZW55dSBrdW5qdXppABERTWVueXUgeWEga3Vzb2dlemEAEBBNd2Fuem8gd2EgbWFz
YWZhABAQTXdpc2hvIHdhIG1hc2FmYQAXF05lbmRhIGt3ZW55ZSBtd2FrYSAlMSRzABwcTmVuZGEg
a3dlbnllIG13ZXppIHVuYW9mdWF0YQAlJU5lbmRhIGt3ZW55ZSBzZWhlbXUgeWEga3VjaGFndWEg
bXdha2EADAxOZW5kYSBtd2Fuem8ACgpOaW1lbWFsaXphAAUFT25kb2EAExNPbmRvYSBzYWZ1IHlh
IGNoaW5pAB4eT255ZXNoYSBraWRpcmlzaGEgY2hhIHZpZG9rZXpvABMTUGFudWEgc2FmdSB5YSBj
aGluaQAeHlJ1ZGkga3dlbnllIG13ZXppIHVsaW90YW5ndWxpYQADA1NhYQAICFNhYSAlMSRkAA8P
U2FhICUxJGQga2FtaWxpAAoKU2hpcmlraSBuYQATE1NoaXJpa2kgdWtpdHVtaWEgJXMAERFTaW11
IGluYXlvZW5kZWxlYQAQEFNpbXUgdWxpeW9waWdpd2EAJCRTb2dlemEgaWxpIGt1b255ZXNoYSBt
aWFrYSBpbGl5b3BpdGEAJSVTb2dlemEgaWxpIGt1b255ZXNoYSBtaWFrYSB5YSBiYWFkYXllAB8f
U29nZXphIGlsaSBrdW9ueWVzaGEgbXdlemkgdWphbwAjI1NvZ2V6YSBpbGkga3Vvbnllc2hhIG13
ZXppIHVsaW9waXRhAAoKU29nZXphIGp1dQAGBlN3aWNoaQAGBlRhZnV0YQAHCVRhZnV0YeKApgAG
BlRhcmVoZQAuLlRhcmVoZSBoYWlsaW5nYW5pIG5hIG1jaG9ybyB1bGlvdGFyYWppd2E6ICUxJHMA
ERFUYXJlaGUgaWxpeW93ZWt3YQAXF1RhcmVoZSBpbGl5b3dla3dhOiAlMSRzABoaVGFyZWhlIGlz
aXlvcnVodXNpd2E6ICUxJHMAOztUYXJlaGUgbmplIHlhIGtpcGluZGkgY2hhIG13YWthIGtpbGlj
aG90YXJhaml3YSAlMSRzIC0gJTIkcwASElRhcmVoZSB1bGl5b2NoYWd1YQAQEFRhcmVoZSB5YSBr
dWFuemEAEBBUYXJlaGUgeWEgbXdpc2hvAENDVGVsZXplc2hhIGlsaSB1Y2hhZ3VlIG13YWthIGF1
IGd1c2EgaWxpIHVyZWplZSBrd2VueWUga3VjaGFndWEgc2lrdQAUFFVsaWNob3dla2Egc2kgc2Fo
aWhpAAkJVW1lY2hhZ3VhAA4OV2FzaWxpc2hhIGhvamEACwtXZWthIHRhcmVoZQAKCmt3YSBkYWtp
a2EADAxrd2Egc2FhIG1vamEACAslMSRkINWq1aHVtAALESUxJGQg1b/VuNWv1bjVvdaJAAkNJTEk
ZCDWgNW41brVpQAHDtSx1YbVi9Sx1Y/UtdS8AAcO1LHVtNW91aHVqdWr1b4AHTPUsdW01b3VodWp
1avVvtWoINWp1bjWgtW11azVodW/1oDVvtWh1a4g1bnVp9WdICUxJHMANF7UsdW01b3VodWp1avV
vtWoINW51asg1bDVodW01ajVttWv1bbVuNaC1bQg1anVuNaC1bXVrNWh1b/WgNWl1azVqyDVsdaH
1aHVudWh1oPVqyDVsNWl1b/VnSAlMSRzAD9t1LHVtNW91aHVqdWr1b7VqCDVv9Wh1oDVpdWp1b7V
pdaA1asg1anVuNaC1bXVrNWh1b/WgNWl1azVqyDVtNWr1bvVodWv1aHVtdaE1avWgSAoJTEkcyDi
gJMgJTIkcykg1aTVuNaC1oDVvSDVpwAOG9Sx1bXVrCDVqNW21b/WgNWh1bbWhNW21aXWgAAFCtSx
1bXVvdaF1oAAChPUsdW21bvVodW/1b7VodWuINWnABIe1LHVttaB1bbVpdWsICUxJHMg1anVvtWh
1a/VodW2ABEg1LHVttaB1bbVpdWsINWj1azVrdWh1b7VuNaAINWn1bsAFCbUsdW21oHVttWl1awg
1bDVodW71bjWgNWkINWh1bTVvdW+1aHVtgAUJtSx1bbWgdW21aXVrCDVttWh1a3VuNaA1aQg1aHV
tNW91b7VodW2AAsV1LHVttaB1bbVpdWsINW+1aXWgNaHABgu1LHVttaB1bbVpdWsINW/1aHWgNW+
1aEg1ajVttW/1oDVuNaC1anVtdWh1bbVqAAhP9Sx1bbWgdW21aXVrCDVv9Wl1oTVvdW/1asg1bTV
uNaC1b/WhNWh1aPWgNW01aHVtiDVvNWl1arVq9W01avVtgAiQdSx1bbWgdW21aXVrCDWhdaA1aHW
gdW41oLVtdaB1asg1bTVuNaC1b/WhNWh1aPWgNW01aHVtiDVvNWl1arVq9W0AB031LHVvNWh1bvV
odaA1a/VttWl1oDVqCDVsNWh1b3VodW21aXVrNWrINWl1bYg1b3Vv9W41oDWhwAHDtSx1b7VodaA
1b/VpdWsAA4b1LHVvtWh1oDVv9WrINWh1bTVvdWh1anVq9W+AA4b1LXVrNW21bjVsiDVutWh1b/V
uNaC1bDVodW2ABUp1LXWgNWv1a3VuNW91bjWgtWp1bXVodW2INW61aHVv9W41oLVsNWh1bYAESHU
uNW21aTVo9aA1a/VuNaC1bXVqdWrINW91a/Vq9Wm1aIAEB/UuNW21aTVo9aA1a/VuNaC1bXVqdWr
INW+1aXWgNW7AAwX1LjVttWp1aHWgdWr1a8g1abVodW21aMAGi7UuNW21anVodaB1avVryDVqNW2
1b/WgNW41oLVqdW11bjWgtW21ajVnSAlMSRzAAsV1LjVttWp1aHWgdaE1bjWgtW0INWnABAZ1LjV
ttW/1oDVpdWsIEFNINWv1aHVtCBQTQALFdS41bbVv9aA1aXVrCDVqtWh1bTVqAAPHdS41bbVv9aA
1aXVrCDVsNWh1b7VpdWs1b7VodWuAAwX1LjVttW/1oDVpdWsINaA1bjVutWl1bYADx3UuNW21b/W
gNWl1oQg1aHVtNW91aHVqdWr1b7VqAAPHdS41bbVv9aA1aXWhCDVodW01b3VodWp1b7VpdaAAA8d
1LjVttW/1oDVvtWh1a4g1aHVtNW91aHVqdWr1b4ACRHUuNW21b/WgNW+1aHVriDVpwAKE9S41bbV
v9aA1b7VodWuINW51acAEyTUuNW21b/WgNW+1aHVriDVv9Wh1oDWgNWl1oAg1bnVr9Wh1bYAAwbU
utWh1bQAChPUu9W71bbVuNWyINaB1aHVttWvAAUK1L7VodWs1aXVrAATJNS+1aHVrNWl1awg1bbV
pdaA1oTWh9WrINWn1a/WgNWh1bbVqAAID9S+1aHVrNW+1aHVriDVpwAVKNS+1aHVvtWh1azVpdWs
INW21aXWgNaE1ofVqyDVp9Wv1oDVodW21agAChPUvtWh1b7VodWs1b7VodWuINWnABsx1L/Vq9W9
1b7VpdWsICVzINWw1aHVvtWl1azVvtWh1a7VqyDVtNWr1bvVuNaB1bjVvgAHD9S/1avVvdW+1aXV
rOKApgAGDNWA1bjWgtW31aHVrwAQH9WB1aHVtdW21aHVtdWr1bYg1bjWgNW41bbVuNaC1bQABw7V
hNS71LHVkdWG1LXUvAANGdWE1aHVvdW21aHVr9WrINW21bfVvtWh1a4ABgzVhNWl1oDVqtWl1awA
CRHVhNWr1aHWgdW+1aHVriDVpwALFtWE1avVu9Wh1a/VodW11oTVuNaC1bQAFCfVhNW41oLVv9aE
1aHVo9aA1aXWhCDVodW01b3VodWp1b7VpdaA1agAEyXVhNW41oLVv9aE1aHVo9aA1b7VodWuINWh
1bTVvdWh1anVq9W+ABks1YTVuNaC1b/WhNWh1aPWgNW+1aHVriDVodW01b3VodWp1avVvtWdICUx
JHMAKU7VhNW41oLVv9aE1aHVo9aA1b7VodWuINWh1bTVvdWh1anVvtWl1oDVqyDVtNWr1bvVodWv
1aHVtdaE1bYg1aHVttW+1aHVvtWl1oAg1acADhvVhNW41oLVv9aE1aHVtdWr1bYg1abVodW21aMA
FSjVhNW41oLVv9aE1aHVtdWr1bYg1abVodW21aPVqyDVptW/1bjWgtW0ABUp1YbVodW+1avVo9Wh
1oHVq9Wh1bXVqyDVqNW21b/WgNWh1oHVodW21a8ABgzVhtWl1oDVpNWr1oAAJkjViNWs1bjWgNWl
1oTVnSDVsNWh1bvVuNaA1aQg1aHVtNWr1b3VqCDWgdW41oLWgdWh1aTWgNWl1azVuNaCINWw1aHV
tNWh1oAAJkjViNWs1bjWgNWl1oTVnSDVttWh1a3VuNaA1aQg1aHVtNWr1b3VqCDWgdW41oLWgdWh
1aTWgNWl1azVuNaCINWw1aHVtNWh1oAAKU7ViNWs1bjWgNWl1oTVnSDVttWh1a3VuNaA1aQg1b/V
odaA1avVttWl1oDVqCDWgdW41oLWgdWh1aTWgNWl1azVuNaCINWw1aHVtNWh1oAAKU7ViNWs1bjW
gNWl1oTVnSDVvtWl1oDVu9Wr1bYg1b/VodaA1avVttWl1oDVqCDWgdW41oLWgdWh1aTWgNWl1azV
uNaCINWw1aHVtNWh1oAABw3ViNW5INW01aXVr9WoAAYM1YjWgNW41bbVpdWsAA8d1YjWgNW41bbV
tNWh1bYg1bDVodaA1oHVuNaC1bQABw7ViNaA1bjVttW41oLVtAAIEdWI1oDVuNW21bjWgtW04oCm
ABEh1YjWgtWy1aHWgNWv1aXVrCDVsNWh1oDWgdW41oLVtNWoAAoU1YrVodW/1aHVvdWt1aHVttWl
1awACRHVitWh1b/WgNWh1b3VvyDVpwAOG9WL1bbVu9Wl1awg1bDVodaA1oHVuNaC1bTVqABPgJTV
jdWh1bDVpdaB1oDVpdaE1Z0g1b/VodaA1aXVqdWr1b4g1ajVttW/1oDVpdWs1bjWgiDVsNWh1bTV
odaALCDVr9Wh1bQg1bDVutWl1oTVnSDWhdaA1b7VoSDVqNW21b/WgNW41oLVqdW11aHVttWoINW+
1aXWgNWh1aTVodW81bbVodWs1bjWgiDVsNWh1bTVodaAAA0Z1Y3VrdWh1awg1bbVpdaA1aHVrtW4
1oLVtAANGdWN1a/VptWi1asg1aHVtNW91aHVqdWr1b4AGTDVj9Wh1oDVpdWp1b7VqyDWgdW41oLW
gdWh1aTWgNW+1bjVsiDVqNW21b/WgNWr1bkADx3Vj9Wl1bLVodaD1bjVrdW01aHVtiDVttW31avV
uQAIENWP1aXVvdWh1abVodW21aMADRnVj9Wl1b3VttWl1awg1aLVuNWs1bjWgNWoAAQI1ZDVuNW6
1aUAESHVkdW41oLWgdWh1aTWgNWl1awg1bDVuNaC1bfVuNaC1bQABQrVk9Wh1a/VpdWsAAsV1ZPV
odWv1aXVrCDVqdWl1oDVqdWoABw21ZPVodWv1aXVrCDVttWh1b7Vq9Wj1aHWgdWr1aHVtdWrINWo
1bbVv9aA1aHWgdWh1bbVr9WoABMk1ZPVodWv1aXVrCDVttWl1oDWhNaH1asg1afVr9aA1aHVttWo
AAoU1ZPVuNWt1aHVttW71aHVv9Wr1bkABQrVotWh1oHVodW/AAUK1arVodW01aXWgAAHDtaA1bjV
utWl1bbVpdaAAAoPJTEkZCDQvNKv0L3TqdGCAAkNJTEkZCDRgdCw0LDRggAPGCUxJHMt0LbRi9C7
0LPQsCDTqdGC0q/SrwASICVzINCw0YDQutGL0LvRg9GDINCx06nQu9Kv0YjSr9KvAAsV0JDQudGC
0YvQvyDQuNC30LTTqdOpAAsW0JDRgtC60LDRgNGL0LvRg9GD0LTQsAALFdCQ0Y/QutGC0L7QviDQ
utKv0L3SrwAMF9CR0LDQsNGA0YvQvSDQutOp0YDSr9KvAA0Z0JHQsNGA0LDQutGC0Ysg0LbQsNCx
0YPRgwAUJtCR0LDRiNC60Ysg0LHQtdGC0LrQtSDRh9Cw0LHRi9GC0YLQvtC+AA0Z0JHQsNGI0YLQ
sNC70YPRgyDQutKv0L3SrwAFCtCR0q/Qs9Kv0L0ABQrQkdKv0YLRgtKvAAUK0JLQuNC00LXQvgAQ
H9CU0LDQs9GLINC/0LDRgNCw0LzQtdGC0YDQu9C10YAAJUbQlNCw0YLQsNC70LDRgCDQtNC40LDQ
v9Cw0LfQvtC90YMg0YLRg9GD0YDQsCDRjdC80LXRgSDRgtCw0L3QtNCw0LvQtNGLAAYM0JTQuNCw
0LvQvtCzABAf0JTQuNCw0L/QsNC30L7QvdC00YPQvSDQsNGP0LPRiwAQH9CU0LjQsNC/0LDQt9C+
0L3QtNGD0L0g0LHQsNGI0YsABQrQltCw0LHRg9GDABIj0JbQsNC50YvQu9GL0L8g0LrTqdGA0YHT
qdGC0q/Qu9C00q8AGTDQltCw0YDRi9C8LdC20LDRgNGC0YvQu9Cw0Lkg0YLQtdC60YjQtdGA0LjQ
u9C00LgAAwbQltC+0LoAChPQltC+0L7QvyDQsdC10YDSr9KvAAoU0JbRi9C50YvRiNGC0YvRgNGD
0YMADBjQltGL0LnRi9GI0YLRi9GA0YvQu9C00YsAFirQltGL0Lsg0YLQsNC90LTQvtC+0LPQviDQ
utC+0YLQvtGA0YPQu9GD0YMATYCP0JbRi9C70LTRiyDRgtCw0L3QtNC+0L4g0q/Rh9Kv0L0g0Y3Q
utGA0LDQvdC00Ysg0YHSr9GA0q/So9Kv0Lcg0LbQtSDQutKv0L3QtNKvINGC0LDQvdC00L7QvtCz
0L4g0LrQsNC50YLRg9GDINKv0YfSr9C9INGC0LDQv9GC0LDQvyDQutC+0Y7So9GD0LcAJknQltGL
0LvQvdCw0LDQvNCw0LPQsCDQutC40YDQs9C40LfSr9KvINGA0LXQttC40LzQuNC90LUg0LrQvtGC
0L7RgNGD0LvRg9GDAA4b0JjQt9C00LXQu9Cz0LXQvSDRgdGD0YDQsNC8AAUK0JjQt9C006nTqQAG
DdCY0LfQtNOp06nigKYADhvQmtCw0LvQutGL0LzQsCDRgtC10YDQtdC30LUAFCbQmtCw0LvQutGL
0L8g0YfRi9Cz0YPRg9GH0YMg0LrQtdKj0LXRiAAfO9Ca0LDQu9C60YvQvyDRh9GL0LPRg9GD0YfR
gyDQutC10qPQtdGI0YLQuCDQutOp0YDRgdOp0YLSr9KvABUo0JrQuNC50LjQvdC60Lgg0LDQudCz
0LAg06nQt9Cz06nRgNGC0q/SrwAhPtCa0LjQudC40L3QutC4INCw0LnQtNGLINC606nRgNKv0q8g
0q/Rh9Kv0L0g0YHRi9C00YvRgNGL0qPRi9C3ACVG0JrQuNC50LjQvdC60Lgg0LbRi9C70LTQsNGA
0LTRiyDQutOp0YDSr9KvINKv0YfSr9C9INGB0YvQtNGL0YDRi9Kj0YvQtwAPHdCa0LjRgNCz0LjQ
t9C40LvQs9C10L0g0LrSr9C9ABUj0JrQuNGA0LPQuNC30LjQu9Cz0LXQvSDQutKv0L06ICUxJHMA
HTjQmtC40YDQs9C40LfQuNC70LPQtdC9INC80LDQsNC70YvQvNCw0YIg0LbQsNGA0LDQutGB0YvQ
twANGdCa0LjRgNKv0q/Rh9KvINGH0LDQu9GD0YMAFSjQmtC40YDSr9Kv0YfSryDRh9Cw0LvRg9GD
0L3RgyDQuNGA0LPTqdOpAA8d0JrQvtC70LTQvtC90LzQviDRgtCw0L3QtNC+0L4ACBDQmtC+0YLQ
vtGA0LPRg9GHAAUK0JrSrtCZ0q7QmgAFCtCa0q/QudKv0LoAP27QmtKv0L0gJTEkcyDigJQgJTIk
cyDQtNC10L8g0LHQtdC70LPQuNC70LXQvdCz0LXQvSDQttGL0LvQtNCw0YAg0LTQuNCw0L/QsNC3
0L7QvdGD0L3QsCDQutC40YDQsdC10Lkg0LrQsNC70LTRiwAMF9Ca0q/QvdC00q8g0YLQsNC90LTQ
vtC+AC9U0JrSr9C90LTSr9C9INC80YvQvdC00LDQuSDRhNC+0YDQvNCw0YLRi9C9INC60L7Qu9C0
0L7QvdGD0YPQs9CwINCx0L7Qu9Cx0L7QudGCOiAlMSRzACpJ0JrSr9C90LTSr9C9INGE0L7RgNC8
0LDRgtGLINKv0LvQs9Kv0LPTqSDQtNCw0Lsg0LrQtdC70LPQtdC9INC20L7QujogJTEkcwARIdCa
0q/QvdC006nRgNC00q8g0LrQuNGA0LPQuNC30q/SrwAPHdCa0q/QvdC006nRgNC00q8g0YLQsNC9
0LTQvtC+AAQI0JrSr9C90q8AGC7QmtOp0YDRgdOp0YLSr9C70LPTqdC9INC20YvQuyDRgtCw0L3Q
tNCw0LPRi9GHABUo0JzRg9GA0YPQvdC60YMg0LDQudCz0LAg06nQt9Cz06nRgNGC0q/SrwAhPtCc
0YPRgNGD0L3QutGDINCw0LnQtNGLINC606nRgNKv0q8g0q/Rh9Kv0L0g0YHRi9C00YvRgNGL0qPR
i9C3ACVG0JzRg9GA0YPQvdC60YMg0LbRi9C70LTQsNGA0LTRiyDQutOp0YDSr9KvINKv0YfSr9C9
INGB0YvQtNGL0YDRi9Kj0YvQtwAUJtCc0YPRgNGD0L3QutGDINGN0LrRgNCw0L3Qs9CwINOp0YLS
r9KvAAUK0JzSr9C906nRggARIdCc0q/QvdOp0YLRgtOp0YDQtNKvINGC0LDQvdC00L7QvgAECNCh
0LDQsNGCAAsV0KHQsNCw0YIg0YLQsNC90LTQvtC+ABs00KHRg9C90YPRiNGC0LDRgCDRgtOp0LzT
qdC90LTTqSDQutC10LvRgtC40YDQuNC70LTQuAAOG9Ch0YPRgNCw0Lwg0YLQsNC/0YjRi9GA0YPR
gwAOG9Ch0YPRgNCw0LzQtNGLINOp0YfSr9GA0q/SrwANGdCi0LDQvdC00LDQu9Cz0LDQvSDQttC+
0LoADRnQotCw0L3QtNCw0LvQs9Cw0L0g0LrSr9C9AAgQ0KLQsNC90LTQsNC70LTRiwAhP9Ci0LXQ
utGB0YIg0LrQuNGA0LPQuNC30q/SryDRgNC10LbQuNC80LjQvdC1INC60L7RgtC+0YDRg9C70YPR
gwAlRtCi0LjQt9C80LXQvdC40L0g0LrQtdGA0LXQutGC0q/SryDQttC10YDQuNC90LUg0YHSr9C5
0YDTqdC/INCx0LDRgNGD0YMADBfQotKv0YDSr9C70LzTqSDQvNC10L3RjgAvWNCi0q/RiNC606kg
0YfQtdC50LjQvdC60Lgg0LbQtSDRgtKv0YjRgtOp0L0g0LrQuNC50LjQvdC60Lgg0YPQsdCw0LrR
i9GC0YLRiyDRgtCw0L3QtNC+0L4AFSjQotOp0LzTqdC90LrSryDQvNC10L3QtdC9INCx06nQu9Kv
0YjSr9KvAB870KLTqdC806nQvdC60q8g0YPQsdCw0LrRi9GCINCw0YDQsNC70YvQs9GL0L3QtNCw
0LPRiyDQutKv0L0AFCLQo9GH0YPRgNC00LAgJTEkcyDRgtCw0L3QtNCw0LvQtNGLAA4b0KPRh9GD
0YDQtNCw0LPRiyDRh9Cw0LvRg9GDAA8d0KfQsNCx0YvRgtGC0L7QviDQvNC10L3RjtGB0YMAFirQ
p9Cw0LHRi9GC0YLQvtC+INC80LXQvdGO0YHRg9C9INC20LDQsdGD0YMADx3Qp9Cw0LvRg9GD0L3R
gyDQsdKv0YLSr9GA0q/SrwALFdCn0LXRgtC60LUg0LrQsNCz0YPRgwAVKNCr0LvQtNGL0LnQutGL
INGN0LrRgNCw0L3QtNGLINC20LDQsdGD0YMAHjnQq9C70LTRi9C50LrRiyDRjdC60YDQsNC90LTR
iyDQttCw0LnRi9C/INC606nRgNGB06nRgtKv0q8AGjLQq9C70LTRi9C50LrRiyDRjdC60YDQsNC9
0LTRiyDQttGL0LnRi9GI0YLRi9GA0YPRgwAGDNCx0L7RiNGC0YPQugAHDtC80q/QvdOp0YLQutOp
AAYM0YHQsNCw0YLQutCwAAsV0YLSr9GI0LrTqSDRh9C10LnQuNC9AAwX0YLSr9GI0YLTqdC9INC6
0LjQudC40L0ABAjTqNCn0q7QmgAFCtOo0YLQvNOp0LoABAjTqNGH0q/QugAJESUxJGQg4YCU4YCs
4YCb4YCuAAoUJTEkZCDhgJnhgK3hgJThgIXhgLoAEy8lMSRkIOGAm+GArOGAgeGAreGAr+GAhOGA
uuGAlOGAvuGAr+GAlOGAuuGAuOGBiwAXOSUxJHMg4YCB4YCv4YCU4YC+4YCF4YC64YCe4YCt4YCv
4YC3IOGAnuGAveGArOGAuOGAm+GAlOGAugARKyVzIOGAluGAvOGAhOGAt+GAuiDhgJnhgLvhgL7h
gJ3hgLHhgJvhgJThgLoAFCpBTSAo4YCe4YCt4YCv4YC3KSBQTSDhgJvhgL3hgLHhgLjhgJvhgJTh
gLoARoDE4YCB4YCv4YCU4YC+4YCF4YC64YCb4YC94YCx4YC44YCB4YC74YCa4YC64YCb4YCU4YC6
IOGAleGAveGAkOGAuuGAhuGAveGAsuGAleGAqyAo4YCe4YCt4YCv4YC3KSDhgJvhgIDhgLrhgJvh
gL3hgLHhgLjhgIHhgLvhgJrhgLrhgIHhgLzhgIThgLrhgLjhgJ7hgK3hgK/hgLcg4YCV4YC84YCU
4YC64YCb4YCU4YC6IOGAkOGAreGAr+GAt+GAleGAqwAhYeGAgeGAr+GAlOGAvuGAheGAuuGAm+GA
veGAseGAuOGAgeGAu+GAmuGAuuGAm+GAseGAuOGAheGAlOGAheGAuuGAgOGAreGAryDhgJnhgLzh
gIThgLrhgJvhgJ7hgIrhgLoACyHhgIHhgLHhgKvhgIDhgLrhgJHhgKzhgLjhgJ7hgIrhgLoACh7h
gIHhgLvhgLLhgLfhgJHhgKzhgLjhgJ7hgIrhgLoACyHhgIThgLzhgIThgLrhgLjhgJXhgJrhgLrh
gJvhgJThgLoABxXhgIXhgJDhgIThgLrhgJvhgIDhgLoAETHhgIXhgKzhgJnhgLvhgIDhgLrhgJTh
gL7hgKwg4YCV4YCt4YCQ4YC64YCb4YCU4YC6ABpM4YCF4YCs4YCb4YCt4YCv4YCA4YC64YCU4YCK
4YC64YC44YCe4YCt4YCv4YC3IOGAleGAvOGAseGArOGAhOGAuuGAuOGAm+GAlOGAugANJ+GAhuGA
seGArOGAhOGAuuGAm+GAveGAgOGAuuGAlOGAseGAhuGAsgAKHuGAhuGAveGAsuGAgeGAu+GAmeGA
ruGAlOGAsOGAuAAaTOGAkOGAheGAuuGAneGAgOGAuuGAkOGAheGAuuGAleGAu+GAgOGAuiDhgIXh
gIXhgLrhgIbhgLHhgLjhgJHhgKzhgLjhgJ7hgIrhgLoAAwnhgJDhgJjhgLoAETHhgJHhgIrhgLfh
gLrhgJHhgKzhgLjhgJ7hgLHhgKwg4YCb4YCA4YC64YCF4YC94YCyABc34YCR4YCK4YC34YC64YCR
4YCs4YC44YCe4YCx4YCsIOGAm+GAgOGAuuGAheGAveGAsi0gJTEkcwAXQ+GAkeGAiuGAt+GAuuGA
nuGAveGAhOGAuuGAuOGAmeGAvuGAryDhgJnhgJnhgL7hgJThgLrhgIDhgJThgLrhgJXhgKsACyHh
gJLhgK3hgK/hgIThgLrhgJrhgKzhgJzhgLHhgKzhgLcAJWvhgJLhgLHhgJDhgKzhgKHhgJXhgK3h
gK/hgIThgLrhgLjhgKHhgIHhgLzhgKzhgLgg4YCR4YCK4YC34YC64YCe4YC94YCE4YC64YC44YCZ
4YC+4YCvIOGAmeGAmeGAvuGAlOGAuuGAleGAqwAEDOGAlOGArOGAm+GArgAMIuGAlOGArOGAm+GA
riDhgJvhgL3hgLHhgLjhgJvhgJThgLoABxXhgJThgKzhgJvhgK7hgIDhgLzhgKwAFDrhgJThgLHh
gKzhgIDhgLrhgJHhgJXhgLog4YCb4YC94YCx4YC44YCF4YCb4YCs4YCZ4YC74YCs4YC4ACJi4YCU
4YCx4YCs4YCA4YC64YCV4YCt4YCv4YCE4YC64YC44YCU4YC+4YCF4YC64YCZ4YC74YCs4YC4IOGA
leGAvOGAm+GAlOGAuiDhgJzhgL7hgK3hgJnhgLfhgLrhgJXhgKsAFT3hgJThgLHhgKzhgIDhgLrh
gJzhgJ7hgK3hgK/hgLcg4YCV4YC84YCx4YCs4YCE4YC64YC44YCb4YCU4YC6AA4o4YCU4YC+4YCE
4YC34YC6IOGAmeGAu+GAvuGAneGAseGAm+GAlOGAugAcUuGAlOGAvuGAheGAuuGAm+GAveGAseGA
uOGAgeGAvOGAhOGAuuGAuOGAnuGAreGAr+GAtyDhgJXhgLzhgLHhgKzhgIThgLrhgLjhgJvhgJTh
gLoABhLhgJXhgJrhgLrhgJvhgJThgLoABAzhgJXhgK3hgJDhgLoABxXhgJXhgK3hgJDhgLrhgJvh
gJThgLoAEjThgJXhgLHhgKvhgLfhgJXhgLrhgKHhgJXhgLog4YCd4YCE4YC64YC44YCS4YCt4YCv
4YC4AC2Ag+GAleGAvOGAgOGAueGAgeGAkuGAreGAlOGAuiDhgJzhgIDhgLrhgIDhgL3hgIDhgLrh
gJHhgIrhgLfhgLrhgJ7hgL3hgIThgLrhgLjhgJThgIrhgLrhgLjhgJ7hgK3hgK/hgLcg4YCV4YC8
4YCx4YCs4YCE4YC64YC44YCb4YCU4YC6AAsh4YCV4YC84YCu4YC44YCG4YCv4YC24YC44YCb4YCA
4YC6AAcV4YCV4YC84YCu4YC44YCV4YC84YCuAAoe4YCV4YC84YCx4YCs4YCE4YC64YC44YCb4YCU
4YC6AAsh4YCW4YCt4YCG4YC94YCy4YCh4YCR4YCt4YCU4YC64YC4AA0n4YCW4YCv4YCU4YC64YC4
4YCA4YCt4YCv4YCE4YC64YCb4YCU4YC6AAoe4YCW4YCv4YCU4YC64YC44YCB4YC74YCb4YCU4YC6
AAUP4YCW4YC94YCE4YC34YC6AAgY4YCW4YC94YCE4YC34YC64YCb4YCU4YC6AAcV4YCX4YCu4YCS
4YCu4YCa4YCt4YCvAAQM4YCZ4YCb4YC+4YCtAAUP4YCZ4YCt4YCU4YCF4YC6AA0l4YCZ4YCt4YCU
4YCF4YC6IOGAm+GAveGAseGAuOGAm+GAlOGAugAIGOGAmeGAreGAlOGAheGAuuGAgOGAvOGArAAW
QOGAmeGAsOGAnOGAlOGAseGAm+GArOGAgOGAreGAryDhgJXhgLzhgJThgLrhgJ7hgL3hgKzhgLjh
gJvhgJThgLoAG03hgJrhgIHhgIThgLrhgJThgL7hgIXhgLrhgJnhgLvhgKzhgLgg4YCV4YC84YCb
4YCU4YC6IOGAnOGAvuGAreGAmeGAt+GAuuGAleGAqwAXQeGAmuGAgeGAhOGAuuGAnOGAgOGAreGA
ryDhgJXhgLzhgJvhgJThgLog4YCc4YC+4YCt4YCZ4YC34YC64YCV4YCrABQ64YCa4YCB4YCE4YC6
4YCc4YCe4YCt4YCv4YC3IOGAleGAvOGAseGArOGAhOGAuuGAuOGAm+GAlOGAugAEDOGAmuGAlOGA
seGAtwAGEuGAm+GAgOGAuuGAheGAveGAsgAeTOGAm+GAgOGAuuGAheGAveGAsuGAgOGAreGAryDh
gIHhgL3hgIThgLfhgLrhgJXhgLzhgK/hgJnhgJHhgKzhgLjhgJXhgKstICUxJHMAEDDhgJvhgIDh
gLrhgIXhgL3hgLLhgJnhgLvhgKzhgLjhgJHhgIrhgLfhgLrhgJXhgKsAEDDhgJvhgIDhgLrhgIXh
gL3hgLLhgJnhgLvhgKzhgLjhgJvhgL3hgLHhgLjhgJXhgKsADSfhgJvhgIDhgLrhgIXhgL3hgLLh
gJvhgL3hgLHhgLjhgJvhgJThgLoARoCy4YCb4YCA4YC64YCF4YC94YCy4YCe4YCK4YC6IOGAmeGA
u+GAvuGAseGArOGAuuGAmeGAvuGAlOGAuuGAuOGAkeGArOGAuOGAnuGAseGArCDhgJThgL7hgIXh
gLrhgKHhgJXhgK3hgK/hgIThgLrhgLjhgKHhgIHhgLzhgKzhgLggJTEkcyAtICUyJHMg4YCQ4YC9
4YCE4YC6IOGAmeGAleGAq+GAneGAhOGAuuGAleGAqwA3gJPhgJvhgIDhgLrhgIXhgL3hgLLhgJ7h
gIrhgLog4YCZ4YC74YC+4YCx4YCs4YC64YCZ4YC+4YCU4YC64YC44YCR4YCs4YC44YCe4YCx4YCs
IOGAleGAr+GAtuGAheGAtuGAlOGAvuGAhOGAt+GAuiDhgJnhgIDhgK3hgK/hgIDhgLrhgIrhgK7h
gJXhgKstICUxJHMAEjThgJvhgL3hgLHhgLjhgJHhgKzhgLjhgJ7hgIrhgLfhgLog4YCb4YCA4YC6
4YCF4YC94YCyAAoe4YCb4YC94YCx4YC44YCR4YCs4YC44YCe4YCK4YC6AAoe4YCb4YC94YCx4YC4
4YCZ4YCR4YCs4YC44YCV4YCrACFf4YCb4YC+4YCs4YCW4YC94YCx4YCF4YCb4YCsIOGAoeGAgeGA
u+GAgOGAuuGAoeGAnOGAgOGAuuGAgOGAreGAryDhgJXhgLHhgLjhgJXhgK3hgK/hgLfhgJvhgJTh
gLoACRvhgJvhgL7hgKzhgJbhgL3hgLHhgJnhgL7hgK8AF0PhgJvhgL7hgKzhgJbhgL3hgLHhgJnh
gL7hgK/hgIDhgK3hgK8g4YCW4YCa4YC64YCb4YC+4YCs4YC44YCb4YCU4YC6AAkb4YCb4YC+4YCs
4YCW4YC94YCx4YCb4YCU4YC6ABI04YCb4YC+4YCs4YCW4YC94YCx4YCb4YCU4YC6IOGAmeGAseGA
uOGAgeGAveGAlOGAuuGAuAAKHuGAm+GAvuGArOGAluGAveGAseGAm+GAlOGAuuKApgAGEuGAm+GA
vuGArOGAm+GAlOGAugAYOuGAnOGAgOGAuuGAm+GAvuGArSDhgJvhgL3hgLHhgLjhgIHhgLvhgJrh
gLrhgJnhgL7hgK8tICUxJHMAEDDhgJzhgIDhgLrhgJvhgL7hgK3hgIHhgLHhgKvhgLrhgIbhgK3h
gK/hgJnhgL7hgK8ADyvhgJzhgJnhgLrhgLjhgIrhgL3hgL7hgJThgLog4YCZ4YCu4YCU4YCw4YC4
ABdB4YCc4YCZ4YC64YC44YCK4YC94YC+4YCU4YC6IOGAmeGAruGAlOGAsOGAuCDhgJXhgK3hgJDh
gLrhgJvhgJThgLoAGUfhgJzhgKzhgJnhgIrhgLfhgLrhgJzhgIDhgK3hgK8g4YCV4YC84YCb4YCU
4YC6IOGAnOGAvuGAreGAmeGAt+GAuuGAleGAqwALIeGAnOGAu+GAvuGAseGArOGAt+GAleGAvOGA
m+GAlOGAugAVPeGAoeGAgOGAuuGAleGAuuGAkOGAheGAuuGAgeGAr+GAgOGAreGAryDhgJvhgL3h
gLHhgLjhgJvhgJThgLoAHlbhgKHhgIDhgLzhgLbhgJXhgLzhgK/hgIHhgLvhgIDhgLrhgJXhgLwg
4YCV4YCx4YCr4YC34YCh4YCV4YC6IOGAneGAhOGAuuGAuOGAkuGAreGAr+GAuAAjZeGAoeGAgOGA
vOGAtuGAleGAvOGAr+GAgeGAu+GAgOGAuuGAleGAvCDhgJXhgLHhgKvhgLfhgKHhgJXhgLrhgJ3h
gIThgLrhgLjhgJLhgK3hgK/hgLgg4YCV4YC84YCb4YCU4YC6AB9b4YCh4YCA4YC84YC24YCV4YC8
4YCv4YCB4YC74YCA4YC64YCZ4YC74YCs4YC4IOGAoeGAseGArOGAgOGAuuGAkOGAveGAhOGAuuGA
m+GAvuGAreGAnuGAiuGAugAPK+GAoeGAleGAreGAr+GAhOGAuuGAuOGAoeGAgeGAvOGArOGAuCDh
gKHhgIUAEjThgKHhgJXhgK3hgK/hgIThgLrhgLjhgKHhgIHhgLzhgKzhgLgg4YCh4YCG4YCv4YC2
4YC4ABI24YCh4YCV4YCt4YCv4YCE4YC64YC44YCh4YCB4YC84YCs4YC44YCh4YCQ4YC94YCE4YC6
4YC4ABI04YCh4YCV4YCx4YCr4YC64YCe4YCt4YCv4YC3IOGAm+GAveGAvuGAseGAt+GAm+GAlOGA
ugAOKuGAoeGAneGAhOGAuuGAgeGAseGAq+GAuuGAhuGAreGAr+GAmeGAvuGArwAdVeGAoeGAneGA
hOGAuuGAgeGAseGAq+GAuuGAhuGAreGAr+GAmeGAvuGAr+GAgOGAreGAryDhgIXhgIXhgLrhgIbh
gLHhgLjhgJThgLHhgJ7hgIrhgLoADyvhgKHhgJ7hgLbhgJbhgLzhgIThgLfhgLog4YCb4YC+4YCs
4YCb4YCU4YC6ABAu4YCh4YCs4YC44YCc4YCv4YC24YC4IOGAgOGAvOGAiuGAt+GAuuGAm+GAlOGA
ugAodOGAoeGAseGArOGAgOGAuuGAgeGAvOGAseGAoeGAleGAreGAr+GAhuGAseGArOGAhOGAuuGA
uCDhgIXhgKzhgJnhgLvhgIDhgLrhgJThgL7hgKzhgIDhgK3hgK8g4YCB4YC74YCv4YC24YC34YCe
4YCK4YC6ACdx4YCh4YCx4YCs4YCA4YC64YCB4YC84YCx4YCh4YCV4YCt4YCv4YCG4YCx4YCs4YCE
4YC64YC4IOGAheGArOGAmeGAu+GAgOGAuuGAlOGAvuGArOGAgOGAreGAryDhgIHhgLvhgLLhgLfh
gJ7hgIrhgLoAJm7hgKHhgLHhgKzhgIDhgLrhgIHhgLzhgLHhgKHhgJXhgK3hgK/hgIbhgLHhgKzh
gIThgLrhgLgg4YCF4YCs4YCZ4YC74YCA4YC64YCU4YC+4YCs4YCA4YCt4YCvIOGAleGAmuGAuuGA
nuGAiuGAugAECuGBieGBieGBiSsACw0lMSRkIGTJmXFpccmZAAoKJTEkZCBmYWl6LgAJCSUxJGQg
c2FhdAAPEiVzIGlsyZkgcGF5bGHFn8SxbgAFBkFLVMSwVgACAkFNAAUFQWt0aXYACgxBbMmZdCBp
emFoxLEABwhBeHRhcsSxbgAHCUF4dGFyxLHFnwAPEkF4dGFyxLHFnyBzb3LEn3VzdQAKDEF4dGFy
xLHFny4uLgASF0HFn2HEn8SxIGHDp8SxbGFuIG1lbnl1AB4mQcWfYcSfxLFkYWvEsSB2yZlyyZlx
aSBnZW5pxZ9syZluZGlyaW4AGiFBxZ9hxJ/EsWRha8SxIHbJmXLJmXFpIHLJmWRkIGVkaW4AHypB
xZ9hxJ/EsWRha8SxIHbJmXLJmXFpIHnEscSfY2FtbGHFn2TEsXLEsW4ADg9CYcWfbGFtYSB0YXJp
eGkADA1CaXRtyZkgdGFyaXhpAAsMQnUgYXJhbMSxcWRhAAYHQnUgZ8O8bgASFEJ1IGlsyZkga2XD
p2luOiAlMSRzABARQ2FyaSBzZcOnaW06ICUxJHMACwtDYXZhYiB2ZXJpbgAHCERFQUtUxLBWAAoK
RGF2YW0gZWRpcgAPEURhdmFtIGVkyZluIHrJmW5nABMURGF4aWwgZWRpbG1pxZ8gdGFyaXgAGRpE
YXhpbCBlZGlsbWnFnyB0YXJpeDogJTEkcwAHB0RlYWt0aXYABgZEaWFsb3EADhFEaWfJmXIgc2XD
p2ltbMmZcgAGCETJmXFpccmZAAwPRMmZcWlxyZkgc2XDp2luAAwPRMmZc3TJmXlpIGFzxLFuAA0R
RMmZc3TJmXlpIMOnyZlraW4ACgxEyZl5acWfZGlyaW4ACQlGdW5rc2l5YSsADxFHZW5pxZ9syZlu
ZGlyaWxpYgAYHUfDvG5kw7x6IHbJmSB5YSBheMWfYW0gc2XDp2luAAoNR8mZbMmZbiB6yZluZwAV
GkfJmWzJmW4gesmZbmcgZ8O2c3TJmXJpbGlyAA4RSGFtxLFzxLFuYSBiYXjEsW4ACApIYXrEsXJk
xLFyAAgJSGXDpyBiaXJpAAYGTWVueXUrAB0hTcmZdG4gZGF4aWxldG3JmSByZWppbWluyZkga2XD
p2luABISTmF2aXFhc2l5YSBtZW55dXN1AB0fTmF2aXFhc2l5YSBtZW55dXN1bnUgYmHEn2xhecSx
bgATF07DtnZiyZl0aSBheWEgZMmZeWnFn2luACUzTsO2dmLJmXRpIGF5xLEgZ8O2c3TJmXJtyZlr
IMO8w6fDvG4gc8O8csO8xZ9kw7xyw7xuAAICUE0ACApQYXlsYcWfxLFuAA8SUG9wYXAgUMmZbmPJ
mXLJmXNpAAcIUWFwYWTEsW4ADxFRaXNtyZluIHlveGxhbsSxYgAEBFNhYXQACgpTYWF0OiAlMSRk
AAsNU2FhdMSxIHNlw6dpbgAHCFNlw6dpbGliAA4QU2XDp2lsbWnFnyB0YXJpeAAKDFNlw6dpbG3J
mXlpYgAoNVNvbnJha8SxIGlsbMmZcmkgZ8O2c3TJmXJtyZlrIMO8w6fDvG4gc8O8csO8xZ9kw7xy
w7xuABATU29yxJ91bnUgZ8O2bmTJmXJpbgANDlNvcsSfdW51IHNpbGluABIYU8SxcmFuxLFuIGJh
xZ9sYW7En8SxY8SxAAwOU8SxcmFuxLFuIHNvbnUAERVTyZloaWbJmW5pIGJhxJ9sYXnEsW4ADRBT
yZlzbGkgYXh0YXLEscWfAAMDVGFiAAUFVGFyaXgANT1UYXJpeCBnw7Z6bMmZbmlsyZluIGlsIGFy
YWzEscSfxLFuZGFuIGvJmW5hcmTEsXI6ICUxJHMgLSAlMiRzACowVGFyaXggZ8O2emzJmW5pbMmZ
biBtb2RlbMmZIHV5xJ91biBnyZlsbWlyOiAlMSRzAAsMVGFyaXggc2XDp2luABQVVGFyaXhsyZly
aSBkYXhpbCBlZGluAA8RVGFyaXhsyZlyaSBzZcOnaW4AGx1UYXJpeMmZIGljYXrJmSB2ZXJpbG1p
cjogJTEkcwAUGlTJmWtsaWZsyZlyIGHFn2HEn8SxZGFkxLFyAB8jVMmZcXZpbSBkYXhpbGV0bcmZ
IHJlamltaW7JmSBrZcOnaW4ADA5UyZl0YmlxIHNlw6dpbgAQE1lhbmzEscWfIGRheGlsZXRtyZkA
ICZZYW5sxLHFnyB0YXJpeCBhcmFsxLHEn8SxIGRheGlsZXRtyZlzaQAMDll1eGFyxLEga2XDp2lu
ABAWWcSxxJ9jYW1sYcWfZMSxcsSxbMSxYgAOE1nEscSfY2FtbGHFn2TEsXLEsW4ACgpkYXhpbCBv
bHVuAAkLZMmZcWlxyZlsaWsABwhzYWF0bMSxcQAFBXNpbGluABMYxLBsIHNlw6dpY2lzaSBnw7Zy
w7xuw7xyABEVxLBsIHNlw6dpbWluyZkga2XDp2luAEJVxLBsIHNlw6dtyZlrIMO8w6fDvG4gc8O8
csO8xZ9kw7xyw7xuIHbJmSB5YSBnw7xuIHNlw6dpbWluyZkgcWF5xLF0bWFxIMO8w6fDvG4gdG94
dW51bgALDMSwbXRpbmEgZWRpbgAOEcSwcHVjdSBnw7ZzdMmZcmluABMYxo9zYXMgc8mZaGlmyZl5
yZkga2XDp2luABMXxo92dsmZbGtpIGF5YSBkyZl5acWfaW4AJTPGj3Z2yZlsa2kgYXnEsSBnw7Zz
dMmZcm3JmWsgw7zDp8O8biBzw7xyw7zFn2TDvHLDvG4AKDbGj3Z2yZlsa2kgaWxsyZlyaSBnw7Zz
dMmZcm3JmWsgw7zDp8O8biBzw7xyw7zFn2TDvHLDvG4ACwslMSRkIGRhcWlxYQAKCiUxJGQgZm9p
ei4ACQklMSRkIHNvYXQAERIlMSRzLXlpbGdhIG/Ku3Rpc2gAEhIlcyBvcnFhbGkgdWxhc2hpc2gA
DAxBbG1hc2h0aXJpc2gAGRpBdnZhbGdpIG95Z2Egb8q7emdhcnRpcmlzaAAWFkF2dmFsZ2kgb3ln
YSB2YXJhcWxhbmcAGhpBdnZhbGdpIHlpbGxhcmdhIHZhcmFxbGFuZwAMDEJhamFyaWxtb3FkYQAO
EEJvc2hpZ2Egb+KAmHRpc2gAERFCb3NobGFuaXNoIHNhbmFzaQAFBUJ1Z3VuAAYGRGFxaXFhABAQ
RGFxaXFhbmkgdGFubGFuZwAHB0hhbW1hc2kACQlIZWNoIGJpcmkADw9JbG92YW5pIHRhbmxhbmcA
DAxKYXZvYiBiZXJpc2gADg5Kb3JpeSBjaGFxaXJ1dgASEkpvcml5IHRhbmxvdjogJTEkcwAZGktl
eWluZ2kgb3lnYSBvyrt6Z2FydGlyaXNoABYWS2V5aW5naSBveW5hIHZhcmFxbGFuZwAaGktleWlu
Z2kgeWlsbGFyZ2EgdmFyYXFsYW5nABcXS2lyaXRpbGdhbiBheGJvcm90IHhhdG8AGhpLaXJpdGls
Z2FuIG11ZGRhdCB5YXJvcXNpegAPD0tpcml0aWxnYW4gc2FuYQAVFUtpcml0aWxnYW4gc2FuYTog
JTEkcwAREUtpcnV2Y2hpIGNoYXFpcnV2AB0dS2lydXZjaGkgY2hhcWlydXZuaSBmaWx0cmxhc2gA
Dw9NYXNsYWhhdCBveW5hc2kAHB1NYXNsYWhhdCBveW5hc2luaSBrb8q7cnNhdGlzaAAdHk1hdG4g
a2lyaXRpc2ggcmVqaW1pZ2Egb8q7dGlzaAAODk11bG9xb3Qgb3luYXNpABMTTmF2aWdhdHNpeWEg
bWVueXVzaQAcHE5hdmlnYXRzaXlhIG1lbnl1c2luaSB5b3Bpc2gADAxPcmFsaXEgYm9zaGkADAxP
cmFsaXEgb3hpcmkADg5Pdm96bGkgcWlkaXJ1dgAGB0/Ku2NoaXEAFxdQYXN0Z2Egb2NoaWx1dmNo
aSBtZW55dQAGBlByb2JlbAAVFVFhbHFpYiBjaGlxdXZjaGkgb3luYQAJC1FpZGlyaXNo4oCmAAcH
UWlkaXJ1dgAPEVFpZGlydXYgc2/igJhyb3ZpABERUWlzbWFuIGJlbGdpbGFuZGkAFBVRdXlpIGVr
cmFubmkgeWlnyrtpc2gAExNRdXlpIGVrcmFubmkgeW9waXNoABMTUXV5aSBla3Jhbm5pIHlveWlz
aAAJCVJhZCBldGlzaAAEBFNhbmEALjFTYW5hIGt1dGlsZ2FuIHlpbCBvcmFsaWfKu2lkYSBlbWFz
OiAlMSRzIOKAkyAlMiRzACcnU2FuYSBtYXZqdWQgbmFtdW5hZ2EgbW9zIGtlbG1heWRpOiAlMSRz
AA8PU2FuYSB4YXRvOiAlMSRzABISU2FuYWxhcm5pIGtpcml0aW5nABERU2FuYWxhcm5pIHRhbmxh
bmcADg5TYW5hbmkgdGFubGFuZwAEBFNvYXQADg5Tb2F0bmkgdGFubGFuZwAPEVNv4oCYcm92IHlh
cmF0aXNoABIWU2/igJhyb3ZuaSBv4oCYY2hpcmlzaAAODlN1cmlzaCBkYXN0YWdpAAICVEsAAgJU
TwAQEFRha2xpZmxhciBxdXlpZGEACQlUYW5sYW5nYW4ADg5UYW5sYW5nYW4gc2FuYQAWF1Rhbmxh
bmdhbiB5aWxnYSBvyrt0aXNoAAsLVGFubGFubWFnYW4AHyBUYXF2aW0ga2lyaXRpc2ggcmVqaW1p
Z2Egb8q7dGlzaAANDVR1Z2FzaCBzYW5hc2kACAhUdWdhdGlzaAAmJlR1c2hkYW4gb2xkaW4geW9r
aSBrZXlpbmxpZ2luaSB0YW5sYW5nAAgIVWxhc2hpc2gABQVWYXJhcQAODlZhcmFxbmkgeW9waXNo
ABAQWGl6bWF0IGRvaXJhc2lkYQAFBVlPTklRAAoKWU9RSUxNQUdBTgAEBFlhbmEACQpZaWfKu2ls
Z2FuAAcJWWln4oCYaXNoABMTWWlsIHRhbmxhZ2ljaCBvY2hpcQBGRllpbG5pIHRhbmxhc2ggdWNo
dW4gc3VyaW5nIHlva2kga3VubmkgdGFubGFzaGdhIHFheXRpc2ggdWNodW4gdGVnaW5pbmcABQVZ
b25pcQAGBllvcGlzaAAICFlveWlsZ2FuAAQFWW/Ku3EACgpiaXIgZGFxaXFhAAgIYmlyIHNvYXQA
DQ0lMSRkIHBlcmNlbnQuACsrRGF0ZSBvdXQgb2YgZXhwZWN0ZWQgeWVhciByYW5nZSAlMSRzIC0g
JTIkcwAGBkRpYWxvZwANDURyb3Bkb3duIG1lbnUABwdIYW5nIFVwAAwMT25nb2luZyBjYWxsABER
UGFydGlhbGx5IGNoZWNrZWQADQ1Qb3AtVXAgV2luZG93AA8PU2VsZWN0IEFNIG9yIFBNAA8PJTEk
ZCBwb3VyIGNlbnQuAAwNJTEkZMKgbWludXRlcwAHB0FDVElWRVIABgdBY3RpdsOpABYWQWZmaWNo
ZXIgdW5lIGluZm9idWxsZQAODkFwcGVsIGVuIGNvdXJzAA0NQXBwZWwgZW50cmFudAAGBkF1Y3Vu
ZQALC0F1am91cmQnaHVpAA4OQXV0cmVzIG9wdGlvbnMAZ2xCYWxheWV6IGwnw6ljcmFuIHBvdXIg
c8OpbGVjdGlvbm5lciB1bmUgYW5uw6llLCBvdSB0b3VjaGV6IHBvdXIgcmV2ZW5pciBlbiBhcnJp
w6hyZSBldCBzw6lsZWN0aW9ubmVyIHVuIGpvdXIACAhCYXNjdWxlcgANDkRhdGUgZGUgZMOpYnV0
AAsLRGF0ZSBkZSBmaW4ACwxEYXRlIGVudHLDqWUAEhREYXRlIGVudHLDqWXCoDogJTEkcwAZG0Rh
dGUgbm9uIGF1dG9yaXPDqWXCoDogJTEkcwBCRkRhdGUgbm9uIGNvbXByaXNlIGRhbnMgbGEgZm91
cmNoZXR0ZSBwcsOpdnVlIGRlcyBhbm7DqWVzwqAlMSRzIMOgICUyJHMAERNEYXRlIHPDqWxlY3Rp
b25uw6llAAoLRMOJU0FDVElWRVIADg9Ew6lidXQgZGUgcGxhZ2UACQtEw6lzYWN0aXbDqQA0NkTD
qXZlbG9wcGVyIGxhIHpvbmUgZGUgY29udGVudSBkYW5zIGxlIGJhcyBkZSBsJ8OpY3JhbgAJC0TD
qXZlbG9wcMOpABITRWZmYWNlciBsYSByZXF1w6p0ZQAJC0VuIGNvdXJz4oCmABAQRW50cmVyIGxl
cyBkYXRlcwAcHkVudHLDqWUgZGUgcMOpcmlvZGUgaW5jb3JyZWN0ZQAREkVudHLDqWUgaW5jb3Jy
ZWN0ZQASE0Vudm95ZXIgbGEgcmVxdcOqdGUALjFGYWl0ZXMgZMOpZmlsZXIgcG91ciBhZmZpY2hl
ciBsZSBtb2lzIHByw6ljw6lkZW50ACwtRmFpdGVzIGTDqWZpbGVyIHBvdXIgYWZmaWNoZXIgbGUg
bW9pcyBzdWl2YW50ADM3RmFpdGVzIGTDqWZpbGVyIHBvdXIgYWZmaWNoZXIgbGVzIGFubsOpZXMg
cHLDqWPDqWRlbnRlcwAxM0ZhaXRlcyBkw6lmaWxlciBwb3VyIGFmZmljaGVyIGxlcyBhbm7DqWVz
IHN1aXZhbnRlcwAUFUZlbsOqdHJlIGNvbnRleHR1ZWxsZQAGBkZlcm1lcgAREUZlcm1lciBsYSBm
ZXVpbGxlADAxRmVybWVyIGxhIHpvbmUgZGUgY29udGVudSBkYW5zIGxlIGJhcyBkZSBsJ8OpY3Jh
bgAcHEZlcm1lciBsZSBtZW51IGRlIG5hdmlnYXRpb24AGBhGaWx0cmVyIHVuIGFwcGVsIGVudHJh
bnQADAxGaW4gZGUgcGxhZ2UACQlGb25jdGlvbisABQVIZXVyZQAJCUluZm9idWxsZQAwM0xhIGRh
dGUgbmUgY29ycmVzcG9uZCBwYXMgYXUgc2Now6ltYSBwcsOpdnXCoDogJTEkcwASEk1lbnUgZGUg
bmF2aWdhdGlvbgAOD01lbnUgZMOpcm91bGFudAAFBk3DqXRhKwAdIE5hdmlndWV6IGp1c3F1J8Og
IGwnYW5uw6llwqAlMSRzAA8RTm9uIHPDqWxlY3Rpb25uw6kABgZPbmdsZXQADQ1QYXJ0YWdlciBh
dmVjABAQUGFydGFnZXIgYXZlYyAlcwAVF1BhcnRpZWxsZW1lbnQgdsOpcmlmacOpACMkUGFzc2Vy
IGF1IG1vZGUgZCdlbnRyw6llIGRlIGwnQWdlbmRhACAhUGFzc2VyIGF1IG1vZGUgZCdlbnRyw6ll
IGRlIHRleHRlABgaUGFzc2VyIGF1IG1vaXMgcHLDqWPDqWRlbnQAFhZQYXNzZXIgYXUgbW9pcyBz
dWl2YW50ACEkUGFzc2VyIMOgIGxhIHPDqWxlY3Rpb24gZCd1bmUgYW5uw6llABYYUG9pZ27DqWUg
ZGUgZMOpcGxhY2VtZW50AAoKUmFjY3JvY2hlcgAJCVJlY2hlcmNoZQAQEFJlY2hlcmNoZSB2b2Nh
bGUACgpSZWNoZXJjaGVyAAsNUmVjaGVyY2hlcuKApgAHB1JlZnVzZXIAFBVSZXF1w6p0ZSBkZSBy
ZWNoZXJjaGUAEhNSZXZlbmlyIGVuIGFycmnDqHJlABMUUmV2ZW5pciDDoCBsJ2FjY3VlaWwABwhS
w6lkdWlyZQAxM1LDqWR1aXJlIGxhIHpvbmUgZGUgY29udGVudSBkYW5zIGxlIGJhcyBkZSBsJ8Op
Y3JhbgAGB1LDqWR1aXQACAlSw6lwb25kcmUAFhZTdWdnZXN0aW9ucyBjaS1kZXNzb3VzABkbU8Op
bGVjdGV1ciBkJ2FubsOpZSB2aXNpYmxlABkbU8OpbGVjdGlvbiBhY3R1ZWxsZcKgOiAlMSRzABUW
U8OpbGVjdGlvbm5lciBBTSBvdSBQTQAUFVPDqWxlY3Rpb25uZXIgbCdoZXVyZQAWF1PDqWxlY3Rp
b25uZXIgbGVzIGRhdGVzABgZU8OpbGVjdGlvbm5lciBsZXMgbWludXRlcwAcHVPDqWxlY3Rpb25u
ZXIgdW5lIGFwcGxpY2F0aW9uABUWU8OpbGVjdGlvbm5leiB1bmUgZGF0ZQALDVPDqWxlY3Rpb25u
w6kABwhUZXJtaW7DqQANDVRvdXQgYWZmaWNoZXIABQZWaWTDqW8ABgdlbnRyw6llAAYGZXNwYWNl
AAwMcG91ciBsJ2hldXJlABAQcG91ciBsZXMgbWludXRlcwAJCXN1cHByaW1lcgAICsOAIHBvcnTD
qWUAZYEf4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO
4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCP
4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCO
4oCO4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO
4oCO4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCP4oCOU2VsZWN0ZWTigI7igI/igI7i
gI7igI/igI4AfYE94oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO
4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP
4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO
4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCO4oCO4oCP
4oCP4oCO4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCO4oCOU2Ny
b2xsIHRvIHNob3cgdGhlIG5leHQgbW9udGjigI7igI/igI7igI7igI/igI4AeoE64oCO4oCP4oCO
4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP
4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCP
4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCO
4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP
4oCP4oCP4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCOU2NyZWVuaW5nIGFuIGluY29taW5nIGNh
bGzigI7igI/igI7igI7igI/igI4AgKKBZuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KA
j+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KA
j+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAj+KAjuKAj+KAj+KAj+KAjuKA
j+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAjuKA
j+KAj+KAjuKAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKA
juKAj+KAjuKAj+KAj+KAjlN3aXBlIHRvIHNlbGVjdCBhIHllYXIsIG9yIHRhcCB0byBzd2l0Y2gg
YmFjayB0byBzZWxlY3RpbmcgYSBkYXnigI7igI/igI7igI7igI/igI4AbIEy4oCO4oCP4oCO4oCO
4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO
4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCP
4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO
4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO
4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCORnVuY3Rpb24r4oCO4oCP4oCO
4oCO4oCP4oCOAHiBPuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKA
juKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAjuKAj+KAj+KA
j+KAjuKAj+KAj+KAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAj+KA
juKAjuKAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAjuKAj+KAjuKAjuKAj+KA
j+KAj+KAjuKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAj+KAjuKAjuKAjuKAj+KAjuKAj+KAjuKAj+KA
juKAjuKAjkNsb3NlIG5hdmlnYXRpb24gbWVudeKAjuKAj+KAjuKAjuKAj+KAjgBygTjigI7igI/i
gI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7i
gI/igI7igI7igI7igI7igI/igI/igI/igI/igI7igI/igI/igI/igI/igI/igI/igI7igI7igI7i
gI7igI/igI7igI/igI/igI7igI7igI/igI/igI7igI7igI7igI/igI7igI/igI7igI7igI/igI/i
gI7igI/igI7igI/igI7igI7igI/igI/igI7igI7igI/igI/igI/igI/igI7igI/igI/igI/igI/i
gI7igI/igI7igI7igI/igI7igI7igI7igI/igI/igI/igI/igI7igI7igI5OYXZpZ2F0aW9uIG1l
bnXigI7igI/igI7igI7igI/igI4AcIE44oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP
4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP
4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCO4oCP4oCO
4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCO
4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCO
4oCO4oCP4oCP4oCO4oCO4oCP4oCOU2VsZWN0IGRhdGVz4oCO4oCP4oCO4oCO4oCP4oCOAHCBOOKA
juKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KA
juKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAjuKAj+KAj+KA
juKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAjuKA
j+KAjuKAj+KAjuKAjuKAj+KAj+KAj+KAjuKAj+KAj+KAjuKAj+KAjuKAjuKAjuKAj+KAj+KAjuKA
juKAjuKAjuKAjuKAjuKAj+KAj+KAjuKAjuKAj+KAj+KAjuKAj+KAj+KAjuKAj+KAj+KAjlNlYXJj
aCBxdWVyeeKAjuKAj+KAjuKAjuKAj+KAjgBqgTLigI7igI/igI7igI7igI7igI7igI7igI/igI7i
gI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/i
gI/igI/igI/igI7igI7igI/igI7igI/igI/igI/igI7igI/igI7igI7igI7igI7igI/igI7igI7i
gI/igI7igI/igI/igI7igI/igI/igI7igI/igI7igI/igI/igI/igI/igI/igI7igI/igI/igI7i
gI7igI/igI7igI/igI7igI7igI/igI/igI/igI7igI/igI/igI/igI/igI/igI/igI7igI7igI7i
gI7igI/igI/igI/igI7igI/igI7igI7igI5kZWxldGXigI7igI/igI7igI7igI/igI4AZ4Ev4oCO
4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO
4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCO
4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCO
4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCO
4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCOT2Zm4oCO
4oCP4oCO4oCO4oCP4oCOAGqBMuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KA
juKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KA
juKAjuKAj+KAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAjuKAj+KAj+KAjuKAj+KAj+KAjuKAjuKA
j+KAjuKAj+KAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKA
j+KAjuKAjuKAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKA
j+KAjuKAj+KAjuKAjuKAjkFuc3dlcuKAjuKAj+KAjuKAjuKAj+KAjgBmgS7igI7igI/igI7igI7i
gI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7i
gI7igI7igI7igI/igI/igI/igI/igI/igI7igI7igI/igI/igI7igI7igI7igI/igI7igI7igI/i
gI7igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7i
gI/igI7igI7igI7igI7igI7igI7igI7igI/igI7igI7igI7igI7igI/igI7igI7igI7igI/igI/i
gI/igI/igI/igI7igI7igI/igI/igI7igI/igI/igI7igI7igI7igI5PTuKAjuKAj+KAjuKAjuKA
j+KAjgBvgTfigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7i
gI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI7igI7igI/igI/i
gI7igI/igI/igI/igI7igI7igI/igI7igI/igI/igI/igI/igI7igI7igI7igI7igI7igI7igI7i
gI/igI7igI7igI7igI/igI7igI7igI/igI7igI/igI7igI7igI/igI7igI/igI/igI7igI7igI/i
gI/igI7igI/igI7igI7igI7igI/igI7igI/igI7igI7igI7igI/igI7igI/igI/igI7igI/igI7i
gI/igI5mb3IgbWludXRlc+KAjuKAj+KAjuKAjuKAj+KAjgBsgTbigI7igI/igI7igI7igI7igI7i
gI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7i
gI7igI/igI/igI/igI/igI/igI7igI/igI/igI7igI7igI7igI7igI/igI7igI7igI7igI7igI7i
gI/igI7igI/igI/igI/igI7igI7igI7igI/igI7igI7igI7igI7igI/igI/igI7igI/igI/igI/i
gI7igI7igI7igI7igI/igI/igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI7igI/i
gI/igI7igI/igI7igI/igI7igI/igI7igI7igI7igI7igI/igI5TZWUgYWxs4oCO4oCP4oCO4oCO
4oCP4oCOAHGBO+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKA
juKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KA
juKAj+KAjuKAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAj+KAj+KAj+KAjuKA
juKAjuKAjuKAj+KAjuKAj+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKAj+KAj+KA
j+KAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAjuKAjuKAj+KAj+KAjuKAj+KAj+KA
j+KAj+KAj+KAjlN1Ym1pdCBxdWVyeeKAjuKAj+KAjuKAjuKAj+KAjgB+gUjigI7igI/igI7igI7i
gI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7i
gI7igI7igI7igI/igI/igI/igI/igI/igI7igI/igI/igI7igI/igI7igI7igI/igI/igI7igI7i
gI7igI/igI7igI/igI/igI7igI7igI7igI7igI/igI/igI7igI/igI7igI/igI/igI7igI/igI/i
gI7igI7igI7igI7igI/igI/igI/igI7igI/igI/igI/igI/igI7igI7igI7igI/igI/igI7igI7i
gI/igI/igI7igI7igI/igI7igI7igI7igI/igI/igI7igI/igI/igI7igI5Td2l0Y2ggdG8gdGV4
dCBpbnB1dCBtb2Rl4oCO4oCP4oCO4oCO4oCP4oCOAG2BN+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKA
j+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKA
j+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAjuKAj+KAj+KAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KA
juKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAj+KAjuKAj+KAj+KAj+KAjuKA
j+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAj+KAj+KAjuKAjuKAjuKAjuKAj+KA
juKAjuKAjuKAj+KAj+KAjuKAj+KAjuKAjuKAj+KAjuKAjkNvbGxhcHNl4oCO4oCP4oCO4oCO4oCP
4oCOAGiBMuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKA
juKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAjuKA
j+KAj+KAj+KAjuKAjuKAj+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAjuKAjuKA
j+KAj+KAjuKAj+KAjuKAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAj+KAj+KAj+KAjuKA
juKAjuKAjuKAj+KAj+KAjuKAjuKAjuKAj+KAj+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKA
j+KAjuKAjlRhYuKAjuKAj+KAjuKAjuKAj+KAjgBygTzigI7igI/igI7igI7igI7igI7igI7igI/i
gI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/i
gI/igI/igI/igI/igI7igI/igI/igI/igI7igI/igI7igI7igI7igI/igI/igI/igI7igI/igI/i
gI7igI/igI7igI/igI/igI/igI7igI/igI/igI7igI7igI/igI7igI7igI/igI7igI/igI7igI/i
gI/igI7igI/igI/igI7igI7igI7igI/igI7igI/igI7igI7igI7igI7igI7igI/igI/igI7igI7i
gI/igI/igI/igI/igI7igI7igI/igI/igI7igI/igI5Ecm9wZG93biBtZW514oCO4oCP4oCO4oCO
4oCP4oCOAH2BR+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKA
juKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KA
j+KAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKA
j+KAjuKAj+KAj+KAjuKAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKA
j+KAjuKAjuKAj+KAjuKAj+KAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAj+KAj+KAjuKAj+KAjuKA
juKAjuKAj+KAjkludmFsaWQgZGF0ZSByYW5nZSBpbnB1dOKAjuKAj+KAjuKAjuKAj+KAjgB5gUPi
gI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/i
gI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI7igI/igI/igI/igI7igI/igI7i
gI/igI7igI7igI/igI/igI/igI/igI/igI7igI7igI/igI7igI/igI7igI7igI/igI7igI/igI7i
gI/igI7igI/igI7igI/igI7igI7igI7igI7igI/igI/igI/igI7igI7igI7igI7igI/igI/igI7i
gI7igI/igI7igI7igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI/igI7igI7igI7igI5E
aXNtaXNzIGJvdHRvbSBzaGVldOKAjuKAj+KAjuKAjuKAj+KAjgBygTzigI7igI/igI7igI7igI7i
gI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7i
gI7igI7igI/igI/igI/igI/igI/igI7igI/igI/igI/igI/igI/igI7igI7igI7igI7igI7igI/i
gI/igI/igI7igI7igI/igI/igI7igI7igI/igI7igI/igI7igI7igI/igI/igI7igI/igI/igI7i
gI/igI/igI/igI/igI/igI/igI7igI7igI/igI7igI7igI/igI/igI7igI7igI/igI7igI/igI7i
gI7igI/igI7igI/igI7igI7igI7igI7igI7igI7igI7igI7igI7igI5DaG9vc2UgYW4gYXBw4oCO
4oCP4oCO4oCO4oCP4oCOAGqBNOKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KA
juKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KA
juKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAjuKAj+KAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKA
juKAjuKAjuKAj+KAjuKAj+KAjuKAj+KAjuKAjuKAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAjuKA
juKAj+KAjuKAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAjuKA
j+KAjuKAj+KAjuKAj+KAjuKAjkN0cmwr4oCO4oCP4oCO4oCO4oCP4oCOAGeBMeKAjuKAj+KAjuKA
juKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KA
juKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KA
j+KAj+KAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAj+KAj+KAjuKAj+KAj+KAjuKAjuKAjuKA
juKAjuKAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KA
j+KAjuKAj+KAj+KAjuKAj+KAj+KAjuKAj+KAjuKAj+KAjuKAjuKAj+KAjuKAjlBN4oCO4oCP4oCO
4oCO4oCP4oCOAHGBO+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKA
juKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KA
j+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAj+KAj+KAjuKAj+KAj+KA
juKAj+KAj+KAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAjuKAjuKAjuKA
j+KAj+KAjuKAj+KAj+KAjuKAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKAjuKAj+KAjuKAjuKAj+KA
juKAj+KAj+KAj+KAjlZvaWNlIHNlYXJjaOKAjuKAj+KAjuKAjuKAj+KAjgBxgT3igI7igI/igI7i
gI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/i
gI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI7igI/igI7igI7igI7igI7igI7igI/igI/i
gI7igI/igI7igI/igI/igI/igI7igI7igI/igI7igI/igI/igI/igI/igI7igI/igI7igI7igI7i
gI/igI/igI/igI7igI7igI/igI7igI/igI7igI7igI/igI7igI/igI7igI7igI/igI7igI/igI7i
gI/igI/igI/igI/igI/igI/igI/igI/igI7igI/igI/igI/igI/igI/igI/igI7igI5FbnRlciBk
YXRlc+KAjuKAj+KAjuKAjuKAj+KAjgBsgTjigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/i
gI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/i
gI/igI/igI/igI7igI/igI7igI7igI7igI/igI/igI/igI7igI7igI7igI/igI7igI/igI/igI7i
gI7igI/igI/igI7igI7igI/igI/igI7igI/igI7igI/igI/igI/igI/igI7igI/igI/igI7igI7i
gI/igI/igI7igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI7igI/igI/igI7igI7igI/i
gI7igI/igI/igI/igI/igI/igI/igI7igI/igI5Td2l0Y2jigI7igI/igI7igI7igI/igI4AbYE5
4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP
4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCO
4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCO4oCP4oCP
4oCP4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCO
4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP
4oCOSGFuZyBVcOKAjuKAj+KAjuKAjuKAj+KAjgBygT7igI7igI/igI7igI7igI7igI7igI7igI/i
gI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/i
gI/igI/igI/igI/igI/igI7igI/igI7igI7igI/igI7igI/igI/igI/igI/igI7igI/igI/igI7i
gI7igI/igI/igI7igI/igI/igI/igI/igI/igI7igI7igI/igI/igI/igI/igI/igI/igI/igI7i
gI7igI7igI/igI7igI/igI7igI/igI7igI/igI7igI7igI/igI7igI/igI7igI7igI7igI7igI/i
gI/igI7igI/igI/igI/igI7igI/igI/igI/igI7igI/igI5TaG93IHRvb2x0aXDigI7igI/igI7i
gI7igI/igI4Ac4E/4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO
4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP
4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCP4oCP
4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCO
4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCO4oCP4oCO
4oCO4oCO4oCO4oCP4oCOU2VsZWN0ZWQgZGF0ZeKAjuKAj+KAjuKAjuKAj+KAjgBxgT3igI7igI/i
gI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7i
gI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI7igI/igI7igI/igI7igI7igI/igI/i
gI/igI7igI7igI7igI/igI/igI/igI7igI7igI7igI/igI7igI7igI/igI/igI/igI/igI7igI/i
gI7igI/igI7igI7igI7igI7igI7igI7igI7igI/igI/igI7igI/igI7igI/igI7igI/igI7igI/i
gI7igI/igI/igI/igI/igI7igI7igI/igI/igI7igI7igI7igI7igI/igI7igI7igI7igI5TZWxl
Y3QgZGF0ZeKAjuKAj+KAjuKAjuKAj+KAjgBygT7igI7igI/igI7igI7igI7igI7igI7igI/igI7i
gI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/i
gI/igI/igI/igI/igI7igI/igI7igI/igI/igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/i
gI/igI7igI/igI/igI/igI7igI/igI7igI/igI7igI/igI7igI/igI/igI7igI7igI7igI7igI7i
gI7igI/igI7igI/igI7igI7igI7igI/igI/igI7igI/igI7igI/igI7igI7igI/igI7igI7igI7i
gI/igI7igI/igI7igI7igI/igI/igI/igI7igI/igI4lMSRkIG1pbnV0ZXPigI7igI/igI7igI7i
gI/igI4AgICBTOKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKA
juKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KA
juKAj+KAj+KAjuKAjuKAj+KAj+KAjuKAjuKAjuKAj+KAj+KAjuKAjuKAj+KAjuKAjuKAjuKAj+KA
juKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAj+KAjuKA
juKAj+KAj+KAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAjuKA
j+KAj+KAj+KAjuKAjlNjcm9sbCB0byBzaG93IGxhdGVyIHllYXJz4oCO4oCP4oCO4oCO4oCP4oCO
AG2BOeKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKA
juKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KA
j+KAjuKAjuKAj+KAj+KAjuKAj+KAjuKAjuKAjuKAj+KAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKA
j+KAj+KAj+KAjuKAj+KAjuKAjuKAj+KAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAj+KAjuKA
juKAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKA
j+KAjuKAjkRlY2xpbmXigI7igI/igI7igI7igI/igI4AgICBTOKAjuKAj+KAjuKAjuKAjuKAjuKA
juKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKA
juKAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAj+KA
juKAj+KAj+KAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAj+KAj+KAj+KAjuKAj+KAjuKAjuKA
juKAjuKAjuKAj+KAj+KAjuKAj+KAj+KAjuKAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKA
j+KAj+KAjuKAjuKAj+KAj+KAj+KAjuKAj+KAj+KAj+KAjuKAj+KAjlN3aXRjaCB0byBzZWxlY3Rp
bmcgYSB5ZWFy4oCO4oCP4oCO4oCO4oCP4oCOAGyBOOKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KA
juKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KA
j+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAj+KAj+KAj+KAjuKAj+KAj+KAjuKAj+KAj+KAjuKA
j+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAj+KAjuKAjuKA
juKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAj+KAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAj+KAj+KA
j+KAj+KAj+KAjuKAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjlNlYXJjaOKAjuKAj+KAjuKAjuKAj+KA
jgBygT7igI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7i
gI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI7igI/igI/igI7i
gI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI/igI7igI7igI/igI/igI/igI7igI/igI/i
gI/igI7igI7igI7igI/igI7igI/igI7igI7igI/igI7igI7igI/igI7igI7igI7igI/igI/igI/i
gI7igI/igI/igI/igI7igI/igI7igI/igI/igI7igI/igI7igI/igI7igI7igI7igI7igI7igI/i
gI/igI7igI5FbnRlcmVkIGRhdGXigI7igI/igI7igI7igI/igI4AcYE94oCO4oCP4oCO4oCO4oCO
4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO
4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCO
4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCP4oCO
4oCO4oCO4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCO
4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCP4oCP4oCOQ2xlYXIgcXVlcnni
gI7igI/igI7igI7igI/igI4AcoE+4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP
4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP
4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP
4oCO4oCO4oCO4oCP4oCO4oCP4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP
4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP
4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCOTW9yZSBvcHRpb25z4oCO4oCP4oCO4oCO4oCP4oCOAG2B
OeKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKA
j+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAjuKAj+KA
j+KAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKA
j+KAj+KAjuKAjuKAjuKAj+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KAjuKA
j+KAj+KAjuKAjuKAj+KAj+KAjuKAj+KAjuKAjuKAj+KAjuKAj+KAj+KAj+KAj+KAj+KAj+KAjuKA
j+KAjkRpc21pc3PigI7igI/igI7igI7igI/igI4AbIE44oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP
4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP
4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCO4oCO4oCO
4oCO4oCP4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCP
4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCP4oCO4oCP4oCO
4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCORGlhbG9n4oCO4oCP4oCO4oCO4oCP
4oCOAHCBPOKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKA
juKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KA
j+KAjuKAjuKAj+KAj+KAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKA
juKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KA
juKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAjuKAj+KAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KA
j+KAj+KAj+KAjiUxJGQgaG91cnPigI7igI/igI7igI7igI/igI4Aa4E34oCO4oCP4oCO4oCO4oCO
4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO
4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCP4oCO
4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCO
4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP
4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCOTWV0YSvigI7igI/i
gI7igI7igI/igI4AaYE14oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO
4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCO
4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCP
4oCO4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP
4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCP
4oCP4oCP4oCO4oCP4oCP4oCOT0ZG4oCO4oCP4oCO4oCO4oCP4oCOAHmBReKAjuKAj+KAjuKAjuKA
juKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKA
juKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKA
juKAjuKAjuKAj+KAj+KAjuKAj+KAj+KAj+KAj+KAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KA
j+KAjuKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKA
j+KAj+KAjuKAj+KAjuKAjuKAjuKAj+KAj+KAj+KAjuKAj+KAj+KAjuKAj+KAjkV4cGFuZCBib3R0
b20gc2hlZXTigI7igI/igI7igI7igI/igI4AgIeBU+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KA
juKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KA
j+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAj+KAjuKAj+KAjuKAj+KA
juKAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KA
juKAj+KAj+KAjuKAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKA
juKAjuKAj+KAj+KAjuKAjuKAj+KAj+KAj+KAjuKAjuKAjlNjcm9sbCB0byBzaG93IHRoZSBwcmV2
aW91cyBtb250aOKAjuKAj+KAjuKAjuKAj+KAjgB+gUzigI7igI/igI7igI7igI7igI7igI7igI/i
gI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/i
gI/igI/igI/igI/igI/igI/igI/igI7igI7igI7igI7igI7igI7igI7igI7igI/igI/igI7igI/i
gI/igI/igI7igI/igI/igI/igI/igI/igI/igI/igI7igI7igI7igI/igI7igI7igI/igI/igI7i
gI7igI/igI/igI/igI7igI/igI7igI/igI7igI/igI/igI/igI/igI/igI7igI7igI/igI/igI7i
gI7igI/igI/igI/igI/igI7igI/igI/igI/igI/igI7igI/igI5DdXJyZW50IHNlbGVjdGlvbjog
JTEkc+KAjuKAj+KAjuKAjuKAj+KAjgBrgTnigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/i
gI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/i
gI/igI/igI/igI/igI/igI7igI7igI7igI7igI7igI/igI7igI7igI7igI/igI/igI/igI/igI7i
gI7igI7igI7igI7igI7igI7igI7igI7igI7igI/igI/igI7igI/igI/igI/igI7igI7igI/igI/i
gI7igI/igI7igI7igI/igI/igI/igI7igI7igI7igI7igI/igI7igI7igI7igI/igI/igI/igI7i
gI7igI/igI7igI7igI7igI/igI7igI7igI7igI7igI5Eb25l4oCO4oCP4oCO4oCO4oCP4oCOAG2B
O+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKA
j+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAjuKA
juKAjuKAj+KAj+KAj+KAjuKAjuKAj+KAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAjuKAjuKA
j+KAj+KAjuKAjuKAjuKAjuKAj+KAjuKAjuKAjuKAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAjuKA
juKAjuKAjuKAj+KAj+KAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAj+KAj+KAjuKAjuKAjuKAjuKA
j+KAj+KAjlNoaWZ0K+KAjuKAj+KAjuKAjuKAj+KAjgBvgT3igI7igI/igI7igI7igI7igI7igI7i
gI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7i
gI/igI/igI/igI/igI/igI/igI/igI/igI7igI7igI7igI7igI/igI7igI7igI7igI/igI7igI7i
gI/igI7igI/igI7igI7igI/igI/igI7igI7igI7igI/igI/igI/igI/igI/igI7igI/igI7igI7i
gI/igI/igI/igI/igI/igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI7igI/igI/igI/i
gI/igI7igI/igI/igI/igI/igI/igI/igI/igI7igI/igI7igI7igI5FbmQgZGF0ZeKAjuKAj+KA
juKAjuKAj+KAjgBsgTrigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7i
gI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/i
gI/igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI/igI/igI/igI7igI7igI7igI7i
gI/igI/igI/igI/igI7igI/igI7igI7igI7igI/igI7igI/igI/igI7igI7igI/igI7igI/igI/i
gI7igI/igI7igI7igI/igI/igI7igI7igI/igI/igI/igI7igI/igI/igI/igI/igI/igI7igI7i
gI7igI/igI/igI7igI7igI/igI5Ub2RheeKAjuKAj+KAjuKAjuKAj+KAjgBpgTfigI7igI/igI7i
gI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/i
gI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/igI/igI7igI7igI7igI/igI/igI7igI/i
gI7igI/igI/igI/igI7igI7igI/igI7igI7igI/igI7igI7igI/igI7igI7igI/igI7igI7igI7i
gI/igI/igI7igI7igI/igI7igI/igI/igI7igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/i
gI/igI7igI/igI/igI7igI7igI/igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI5BTeKA
juKAj+KAjuKAjuKAj+KAjgB8gUrigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/i
gI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/i
gI/igI/igI/igI7igI7igI7igI/igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7i
gI/igI7igI7igI/igI/igI7igI/igI7igI7igI/igI7igI/igI7igI7igI/igI7igI7igI7igI7i
gI/igI7igI/igI/igI7igI/igI/igI/igI/igI/igI7igI/igI/igI/igI7igI7igI/igI7igI/i
gI7igI7igI/igI7igI/igI/igI7igI7igI5OYXZpZ2F0ZSB0byB5ZWFyICUxJHPigI7igI/igI7i
gI7igI/igI4Aa4E54oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO
4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP
4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCP
4oCO4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCO
4oCP4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCO4oCO
4oCP4oCO4oCO4oCP4oCO4oCORGF0ZeKAjuKAj+KAjuKAjuKAj+KAjgCAkYFf4oCO4oCP4oCO4oCO
4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO
4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCP
4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCO4oCO
4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP
4oCP4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCP4oCORGF0ZSBk
b2VzIG5vdCBtYXRjaCBleHBlY3RlZCBwYXR0ZXJuOiAlMSRz4oCO4oCP4oCO4oCO4oCP4oCOAG+B
PeKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKA
j+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KA
juKAjuKAj+KAj+KAjuKAjuKAjuKAj+KAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KA
juKAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKAj+KAj+KAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKA
juKAj+KAjuKAjuKAj+KAjuKAj+KAjuKAj+KAjuKAj+KAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKA
j+KAjuKAjmZvciBob3Vy4oCO4oCP4oCO4oCO4oCP4oCOAHCBPuKAjuKAj+KAjuKAjuKAjuKAjuKA
juKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKA
juKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKA
j+KAjuKAj+KAj+KAj+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAj+KAj+KAjuKAj+KAj+KAj+KAjuKA
j+KAj+KAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAj+KAjuKAjuKAjuKAj+KA
juKAj+KAjuKAjuKAj+KAj+KAjuKAjuKAjuKAj+KAj+KAj+KAjuKAjuKAjkNvbGxhcHNlZOKAjuKA
j+KAjuKAjuKAj+KAjgBsgTrigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7i
gI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/i
gI/igI/igI7igI7igI/igI7igI/igI/igI/igI/igI/igI/igI7igI/igI/igI/igI7igI7igI7i
gI/igI7igI7igI/igI/igI/igI7igI/igI/igI7igI7igI7igI7igI7igI7igI7igI/igI/igI7i
gI/igI/igI7igI7igI7igI/igI/igI7igI7igI/igI7igI7igI7igI/igI/igI7igI/igI7igI7i
gI7igI7igI/igI7igI/igI/igI7igI5zcGFjZeKAjuKAj+KAjuKAjuKAj+KAjgBsgTrigI7igI/i
gI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7i
gI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/igI/igI7igI7igI/igI/igI7igI7i
gI/igI7igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI/igI/igI7igI/igI/igI/i
gI/igI7igI7igI7igI7igI7igI/igI7igI7igI7igI/igI7igI/igI/igI/igI/igI7igI/igI7i
gI/igI/igI/igI7igI7igI7igI7igI/igI/igI/igI/igI7igI/igI/igI/igI/igI/igI7igI5N
ZW51K+KAjuKAj+KAjuKAjuKAj+KAjgBrgTnigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/i
gI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/i
gI/igI/igI/igI/igI/igI7igI7igI/igI/igI/igI/igI7igI/igI/igI7igI/igI7igI/igI/i
gI/igI/igI/igI7igI/igI/igI/igI/igI/igI7igI7igI7igI7igI/igI7igI7igI7igI7igI7i
gI/igI/igI/igI/igI/igI/igI7igI/igI7igI/igI7igI7igI7igI/igI7igI7igI7igI/igI7i
gI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI5Ob25l4oCO4oCP4oCO4oCO4oCP4oCOAGuB
OeKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKA
j+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KA
j+KAj+KAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAj+KAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKA
j+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAj+KAjuKAj+KA
juKAjuKAjuKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAjuKAjuKAj+KAj+KAj+KAjuKAjuKAj+KAjuKA
j+KAj+KAjk5vbmXigI7igI/igI7igI7igI/igI4AcYE/4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP
4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP
4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP
4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCP
4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO
4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCOU3RhcnQgZGF0ZeKAjuKAj+KA
juKAjuKAj+KAjgBwgT7igI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7i
gI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/i
gI/igI7igI/igI7igI7igI/igI7igI7igI/igI/igI/igI7igI/igI7igI7igI7igI7igI7igI/i
gI7igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI7igI7igI7igI7igI/i
gI/igI7igI/igI/igI/igI7igI/igI/igI7igI7igI7igI/igI7igI7igI7igI/igI/igI/igI7i
gI7igI7igI7igI/igI7igI/igI5SYW5nZSBlbmTigI7igI/igI7igI7igI/igI4AgIOBb+KAjuKA
j+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKA
juKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAjuKAj+KA
juKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAjuKAj+KAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKA
j+KAj+KAj+KAj+KAj+KAjuKAjuKAjuKAj+KAjuKAj+KAj+KAjuKAj+KAj+KAj+KAjuKAj+KAj+KA
j+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAj+KAjuKAj+KAj+KAj+KA
juKAjuKAj+KAjuKAjuKAj+KAj+KAjiUxJGTigI7igI/igI7igI7igI/igI/igI/igI4gcGVyY2Vu
dC7igI7igI/igI7igI7igI/igI4Ab4E94oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP
4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCP
4oCO4oCO4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCO4oCO
4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO
4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCP4oCORXhwYW5kZWTigI7igI/igI7igI7igI/igI4A
dIFC4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO
4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCO
4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCP
4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCO
4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCP
4oCP4oCO4oCOTmF2aWdhdGUgaG9tZeKAjuKAj+KAjuKAjuKAj+KAjgBygUDigI7igI/igI7igI7i
gI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7i
gI7igI7igI7igI/igI/igI/igI/igI/igI/igI/igI/igI7igI/igI7igI/igI7igI7igI7igI/i
gI/igI7igI7igI/igI/igI7igI7igI/igI/igI/igI7igI/igI7igI7igI7igI/igI7igI/igI/i
gI/igI7igI7igI/igI7igI7igI/igI7igI/igI7igI7igI/igI7igI7igI/igI7igI/igI7igI/i
gI/igI/igI/igI/igI7igI7igI7igI7igI/igI7igI7igI7igI/igI/igI7igI7igI5TZWxlY3Qg
aG91cuKAjuKAj+KAjuKAjuKAj+KAjgB0gULigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/i
gI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/i
gI/igI/igI/igI/igI/igI7igI/igI7igI/igI7igI7igI/igI/igI7igI7igI7igI7igI/igI7i
gI7igI/igI7igI/igI7igI7igI7igI7igI/igI7igI7igI7igI7igI/igI7igI/igI/igI7igI7i
gI7igI/igI/igI/igI7igI/igI/igI7igI7igI7igI/igI7igI7igI7igI/igI/igI7igI/igI7i
gI7igI7igI/igI7igI/igI/igI7igI/igI/igI/igI5JbmNvbWluZyBjYWxs4oCO4oCP4oCO4oCO
4oCP4oCOAH2BS+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKA
juKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KA
juKAj+KAjuKAj+KAjuKAjuKAj+KAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAj+KAj+KA
juKAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAjuKAj+KA
juKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAj+KAj+KAjuKAjuKAjuKAj+KAjuKAjuKA
juKAjuKAjuKAj+KAj+KAjkRhdGUgbm90IGFsbG93ZWQ6ICUxJHPigI7igI/igI7igI7igI/igI4A
bYE74oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO
4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCO
4oCP4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCO
4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO
4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCO
4oCO4oCP4oCOTWludXRl4oCO4oCP4oCO4oCO4oCP4oCOAHyBSuKAjuKAj+KAjuKAjuKAjuKAjuKA
juKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKA
juKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKA
j+KAj+KAj+KAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKA
juKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KA
j+KAj+KAj+KAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjkNvbGxhcHNlIGJvdHRv
bSBzaGVldOKAjuKAj+KAjuKAjuKAj+KAjgBrgTnigI7igI/igI7igI7igI7igI7igI7igI/igI7i
gI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/i
gI/igI/igI/igI/igI/igI/igI7igI/igI7igI/igI7igI/igI/igI/igI7igI7igI7igI/igI7i
gI/igI/igI7igI/igI/igI/igI7igI/igI/igI/igI7igI/igI/igI7igI/igI7igI7igI/igI/i
gI/igI/igI/igI7igI/igI7igI7igI7igI7igI7igI7igI7igI7igI7igI7igI7igI/igI7igI7i
gI7igI/igI7igI7igI/igI/igI7igI/igI/igI/igI7igI5TeW0r4oCO4oCP4oCO4oCO4oCP4oCO
AG2BO+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKA
juKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KA
juKAj+KAj+KAjuKAj+KAj+KAj+KAjuKAj+KAj+KAj+KAjuKAj+KAj+KAj+KAj+KAj+KAjuKAjuKA
juKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAj+KAjuKAj+KAjuKA
juKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAj+KAjuKAj+KAjuKAj+KA
j+KAjuKAjuKAjlNlYXJjaOKAjuKAj+KAjuKAjuKAj+KAjgBrgTnigI7igI/igI7igI7igI7igI7i
gI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7i
gI7igI/igI/igI/igI/igI/igI/igI/igI/igI7igI/igI7igI/igI/igI/igI7igI7igI7igI/i
gI/igI/igI/igI7igI7igI/igI7igI7igI/igI/igI7igI/igI7igI/igI/igI7igI7igI/igI7i
gI/igI/igI7igI7igI7igI/igI7igI7igI7igI7igI7igI7igI7igI/igI7igI7igI7igI7igI/i
gI7igI/igI7igI/igI7igI7igI7igI7igI/igI7igI7igI7igI7igI7igI45OTkr4oCO4oCP4oCO
4oCO4oCP4oCOAHSBQuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKA
juKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KA
j+KAjuKAj+KAjuKAj+KAj+KAj+KAj+KAjuKAjuKAj+KAj+KAjuKAj+KAj+KAjuKAj+KAjuKAjuKA
j+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAjuKAj+KAj+KAjuKA
j+KAj+KAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KA
j+KAjuKAj+KAjuKAj+KAjuKAjlBvcC1VcCBXaW5kb3figI7igI/igI7igI7igI/igI4AbYE74oCO
4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO
4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCO4oCO
4oCP4oCO4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCP
4oCO4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCP
4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCP4oCO
4oCOU2VhcmNo4oCO4oCP4oCO4oCO4oCP4oCOAHOBQeKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KA
juKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KA
j+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAjuKAj+KAj+KAj+KAjuKAj+KAj+KAj+KAj+KA
juKAj+KAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAjuKAj+KA
juKAjuKAjuKAjuKAj+KAj+KAjuKAjuKAj+KAjuKAj+KAj+KAjuKAj+KAjuKAj+KAj+KAjuKAj+KA
j+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAj+KAj+KAjk5vdCBzZWxlY3RlZOKAjuKAj+KA
juKAjuKAj+KAjgBygUDigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7i
gI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/i
gI/igI7igI/igI/igI/igI/igI7igI/igI/igI7igI7igI7igI7igI7igI/igI7igI/igI7igI7i
gI/igI/igI/igI/igI/igI/igI/igI/igI7igI7igI/igI7igI7igI/igI/igI7igI/igI/igI/i
gI/igI/igI/igI7igI/igI7igI/igI7igI7igI7igI/igI/igI7igI/igI/igI/igI7igI/igI/i
gI/igI/igI/igI7igI/igI/igI5JbiBwcm9ncmVzc+KAjuKAj+KAjuKAjuKAj+KAjgBzgUHigI7i
gI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7i
gI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/igI/igI/igI7igI7igI7igI7i
gI7igI7igI/igI/igI/igI/igI7igI/igI7igI/igI7igI7igI/igI7igI/igI7igI7igI/igI/i
gI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI/igI7igI/igI7igI/igI/igI/igI7igI/i
gI/igI/igI7igI/igI/igI7igI7igI7igI7igI7igI/igI7igI7igI7igI/igI7igI7igI7igI7i
gI4lMSRkIG8nY2xvY2vigI7igI/igI7igI7igI/igI4AcoFA4oCO4oCP4oCO4oCO4oCO4oCO4oCO
4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO
4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCP
4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCO4oCO
4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCO4oCOUmFuZ2Ugc3RhcnTigI7i
gI/igI7igI7igI/igI4AeIFG4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO
4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCO
4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCP
4oCP4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCP
4oCO4oCO4oCP4oCP4oCP4oCP4oCO4oCOU3VnZ2VzdGlvbnMgYmVsb3figI7igI/igI7igI7igI/i
gI4AboE+4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO
4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO
4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCO4oCP
4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP
4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCO
4oCP4oCO4oCO4oCOU2VhcmNo4oCm4oCO4oCP4oCO4oCO4oCP4oCOAGuBOeKAjuKAj+KAjuKAjuKA
juKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKA
juKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAj+KAjuKAjuKAjuKAj+KA
j+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAj+KAj+KAjuKAj+KAj+KAj+KA
juKAj+KAj+KAjuKAj+KAj+KAjuKAjuKAjuKAj+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAj+KA
juKAjuKAj+KAjuKAjuKAj+KAj+KAj+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjkhvdXLigI7i
gI/igI7igI7igI/igI4AdoFE4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO
4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCP
4oCO4oCP4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCP
4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO
4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCOU2VsZWN0IEFNIG9yIFBN4oCO4oCP4oCO4oCO4oCP4oCO
AHKBQOKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKA
juKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKA
j+KAjuKAjuKAj+KAjuKAjuKAjuKAj+KAj+KAjuKAjuKAj+KAjuKAjuKAj+KAj+KAj+KAj+KAjuKA
j+KAj+KAjuKAj+KAj+KAjuKAj+KAjuKAjuKAj+KAjuKAjuKAj+KAjuKAj+KAj+KAj+KAj+KAj+KA
juKAj+KAjuKAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKA
j+KAj+KAj+KAjkNsb3NlIHNoZWV04oCO4oCP4oCO4oCO4oCP4oCOAH+BTeKAjuKAj+KAjuKAjuKA
juKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKA
juKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAjuKAj+KAjuKAj+KA
j+KAjuKAj+KAjuKAj+KAj+KAjuKAj+KAj+KAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAj+KA
juKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAj+KAj+KAjuKAjuKAj+KAj+KAj+KAjuKAj+KAj+KAjuKA
juKAj+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjkNoYW5nZSB0
byBwcmV2aW91cyBtb250aOKAjuKAj+KAjuKAjuKAj+KAjgBygUDigI7igI/igI7igI7igI7igI7i
gI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7i
gI7igI/igI/igI/igI/igI/igI/igI/igI/igI/igI7igI/igI7igI/igI/igI/igI/igI7igI/i
gI/igI/igI7igI7igI/igI/igI7igI/igI7igI/igI7igI/igI/igI7igI7igI7igI/igI7igI7i
gI/igI/igI/igI7igI/igI7igI/igI/igI/igI/igI7igI7igI7igI7igI/igI/igI7igI7igI/i
gI7igI7igI/igI/igI/igI7igI/igI/igI/igI7igI/igI/igI7igI7igI5EcmFnIGhhbmRsZeKA
juKAj+KAjuKAjuKAj+KAjgB4gUbigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/i
gI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/i
gI/igI/igI/igI/igI7igI/igI/igI/igI7igI7igI7igI7igI/igI/igI7igI7igI/igI7igI/i
gI7igI7igI/igI/igI/igI7igI7igI7igI7igI7igI/igI7igI7igI7igI/igI7igI7igI7igI/i
gI7igI/igI/igI/igI/igI/igI7igI/igI7igI/igI/igI/igI7igI/igI7igI7igI7igI/igI7i
gI/igI/igI7igI7igI/igI/igI7igI7igI5QYXJ0aWFsbHkgY2hlY2tlZOKAjuKAj+KAjuKAjuKA
j+KAjgBsgTrigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7i
gI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/igI/igI/i
gI7igI/igI/igI/igI7igI/igI/igI7igI/igI7igI/igI7igI/igI/igI/igI7igI/igI7igI/i
gI/igI/igI/igI/igI/igI/igI7igI/igI/igI7igI7igI7igI7igI/igI/igI7igI7igI/igI/i
gI7igI/igI/igI7igI/igI/igI/igI/igI/igI7igI/igI/igI/igI7igI/igI7igI/igI7igI7i
gI7igI7igI/igI/igI5lbnRlcuKAjuKAj+KAjuKAjuKAj+KAjgB0gULigI7igI/igI7igI7igI7i
gI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7i
gI7igI7igI/igI/igI/igI/igI/igI/igI/igI/igI/igI7igI/igI/igI/igI/igI/igI7igI7i
gI7igI/igI/igI7igI/igI/igI7igI7igI/igI/igI/igI/igI/igI/igI7igI/igI7igI7igI/i
gI/igI7igI7igI7igI/igI/igI/igI/igI7igI7igI/igI7igI7igI7igI7igI/igI7igI/igI7i
gI/igI7igI/igI/igI/igI/igI7igI7igI7igI7igI/igI/igI/igI7igI7igI5JbnZhbGlkIGlu
cHV04oCO4oCP4oCO4oCO4oCP4oCOAHqBSOKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KA
j+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KA
j+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAjuKAjuKA
juKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAjuKAjuKAj+KAj+KAjuKAjuKAj+KAjuKAj+KAjuKAjuKA
juKAj+KAj+KAjuKAj+KAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAj+KAjuKAjuKAj+KAj+KAj+KA
juKAj+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAjuKAjlllYXIgcGlja2VyIHZpc2libGXigI7igI/i
gI7igI7igI/igI4AboE84oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO
4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCO
4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO
4oCO4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCO4oCP
4oCP4oCO4oCO4oCP4oCO4oCP4oCOVG9vbHRpcOKAjuKAj+KAjuKAjuKAj+KAjgB7gUnigI7igI/i
gI7igI7igI7igI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7i
gI/igI7igI7igI7igI7igI/igI/igI/igI/igI/igI/igI/igI/igI/igI/igI7igI7igI/igI/i
gI7igI/igI/igI7igI7igI7igI7igI7igI7igI/igI/igI/igI/igI/igI7igI/igI/igI/igI7i
gI7igI7igI7igI/igI7igI/igI/igI7igI/igI7igI/igI/igI7igI7igI/igI/igI/igI/igI7i
gI/igI7igI7igI/igI/igI/igI7igI7igI/igI/igI7igI7igI7igI7igI7igI/igI/igI7igI5D
aGFuZ2UgdG8gbmV4dCBtb250aOKAjuKAj+KAjuKAjuKAj+KAjgBygUDigI7igI/igI7igI7igI7i
gI7igI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7i
gI7igI7igI/igI/igI/igI/igI/igI/igI/igI/igI/igI/igI7igI/igI7igI7igI7igI/igI/i
gI7igI/igI7igI7igI7igI/igI/igI7igI7igI7igI/igI/igI/igI/igI7igI/igI7igI7igI7i
gI7igI/igI/igI7igI/igI/igI7igI/igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI7i
gI7igI/igI7igI/igI7igI7igI7igI7igI/igI/igI/igI7igI7igI7igI7igI5OYXZpZ2F0ZSB1
cOKAjuKAj+KAjuKAjuKAj+KAjgCAkoFg4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP
4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP
4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCP
4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO
4oCP4oCO4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCORGF0ZSBvdXQgb2YgZXhwZWN0ZWQgeWVhciBy
YW5nZSAlMSRzIC0gJTIkc+KAjuKAj+KAjuKAjuKAj+KAjgB1gUPigI7igI/igI7igI7igI7igI7i
gI7igI/igI7igI/igI/igI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7i
gI7igI/igI/igI/igI/igI/igI/igI/igI/igI/igI/igI7igI/igI7igI/igI/igI/igI/igI7i
gI7igI7igI/igI/igI/igI7igI7igI7igI7igI7igI/igI/igI7igI7igI7igI7igI/igI7igI7i
gI7igI7igI/igI/igI7igI/igI/igI7igI/igI/igI/igI7igI7igI7igI/igI7igI7igI7igI7i
gI/igI/igI/igI/igI7igI7igI/igI/igI7igI7igI7igI7igI/igI7igI5TZWxlY3QgbWludXRl
c+KAjuKAj+KAjuKAjuKAj+KAjgB5gUfigI7igI/igI7igI7igI7igI7igI7igI/igI7igI/igI/i
gI/igI7igI7igI7igI7igI7igI7igI/igI7igI7igI/igI7igI7igI7igI7igI/igI/igI/igI/i
gI/igI/igI/igI/igI/igI/igI7igI/igI/igI7igI/igI/igI7igI/igI7igI7igI/igI/igI/i
gI7igI7igI/igI/igI7igI7igI/igI/igI7igI7igI/igI7igI/igI7igI/igI/igI7igI7igI7i
gI/igI/igI/igI/igI7igI/igI7igI7igI7igI7igI7igI7igI7igI7igI7igI/igI/igI7igI7i
gI/igI7igI7igI7igI7igI/igI7igI/igI7igI5FbnRlcmVkIGRhdGU6ICUxJHPigI7igI/igI7i
gI7igI/igI4Ac4FB4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO
4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP
4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCP4oCP
4oCP4oCO4oCP4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCO4oCO
4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCP
4oCP4oCP4oCP4oCP4oCO4oCOT25nb2luZyBjYWxs4oCO4oCP4oCO4oCO4oCP4oCOAGmBN+KAjuKA
j+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKA
juKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAjuKA
juKAjuKAjuKAjuKAj+KAj+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAjuKAjuKAjuKAj+KAj+KAj+KA
j+KAjuKAj+KAjuKAj+KAj+KAj+KAj+KAjuKAjuKAjuKAj+KAjuKAjuKAjuKAj+KAjuKAj+KAj+KA
juKAjuKAjuKAjuKAj+KAj+KAjuKAjuKAj+KAj+KAjuKAjuKAjuKAj+KAj+KAjuKAjuKAj+KAjuKA
jk9u4oCO4oCP4oCO4oCO4oCP4oCOAGyBOuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KA
j+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KA
j+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAjuKAj+KA
j+KAj+KAjuKAjuKAjuKAj+KAjuKAjuKAjuKAj+KAjuKAj+KAjuKAj+KAjuKAjuKAj+KAj+KAjuKA
juKAj+KAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAjuKAj+KAjuKAj+KAjuKAjuKAj+KAj+KA
juKAj+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAjlZpZGVv4oCO4oCP4oCO4oCO4oCP4oCOAGuB
OeKAjuKAj+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKA
j+KAjuKAjuKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KA
juKAj+KAjuKAj+KAjuKAjuKAj+KAjuKAj+KAj+KAjuKAjuKAj+KAj+KAjuKAj+KAjuKAj+KAj+KA
juKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAjuKAj+KAj+KAj+KA
juKAj+KAjuKAjuKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAj+KAjuKAjuKAj+KAj+KAj+KAj+KAjuKA
j+KAjuKAjkFsdCvigI7igI/igI7igI7igI/igI4AcYE/4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP
4oCO4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP
4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCO
4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCP
4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCP
4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCOU2hhcmUgd2l0aOKAjuKAj+KA
juKAjuKAj+KAjgCAg4FR4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO
4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCO
4oCP4oCP4oCO4oCO4oCO4oCP4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCP
4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCO4oCO
4oCO4oCP4oCP4oCP4oCP4oCP4oCOU2Nyb2xsIHRvIHNob3cgZWFybGllciB5ZWFyc+KAjuKAj+KA
juKAjuKAj+KAjgCAhIFS4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO
4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCP4oCP4oCP4oCO4oCP4oCP4oCO4oCO
4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCO4oCO4oCP4oCP4oCO
4oCO4oCP4oCP4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCO4oCO
4oCO4oCP4oCP4oCP4oCP4oCP4oCOU3dpdGNoIHRvIGNhbGVuZGFyIGlucHV0IG1vZGXigI7igI/i
gI7igI7igI/igI4Ab4E94oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCO
4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCO4oCO4oCP4oCO4oCO4oCP4oCP4oCO4oCP4oCP4oCO
4oCP4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCO4oCP4oCO4oCP
4oCO4oCO4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCO4oCO4oCO
4oCP4oCP4oCP4oCO4oCO4oCP4oCOSW4gcmFuZ2XigI7igI/igI7igI7igI/igI4AgIOBb+KAjuKA
j+KAjuKAjuKAjuKAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAjuKAjuKAjuKAjuKAj+KAjuKA
juKAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAj+KAjuKA
j+KAj+KAjuKAj+KAjuKAj+KAjuKAj+KAjuKAj+KAj+KAjuKAjuKAjuKAj+KAj+KAjuKAj+KAj+KA
j+KAjuKAjuKAj+KAjuKAj+KAjuKAjuKAj+KAjuKAj+KAj+KAj+KAjuKAjuKAj+KAj+KAj+KAj+KA
j+KAjuKAjuKAj+KAjuKAjuKAj+KAj+KAj+KAj+KAjuKAjuKAjuKAjuKAj+KAj+KAj+KAjuKAjuKA
jlNoYXJlIHdpdGgg4oCO4oCP4oCO4oCO4oCP4oCP4oCOJXPigI7igI/igI7igI7igI/igI/igI/i
gI7igI7igI/igI7igI7igI/igI4AcoFA4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCP4oCP
4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCP4oCP4oCP4oCP
4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP
4oCP4oCP4oCP4oCO4oCO4oCP4oCO4oCP4oCP4oCP4oCP4oCO4oCP4oCP4oCO4oCP4oCO4oCO4oCO
4oCO4oCO4oCP4oCP4oCO4oCP4oCO4oCP4oCO4oCO4oCO4oCO4oCO4oCO4oCP4oCP4oCO4oCP4oCP
4oCO4oCP4oCO4oCO4oCP4oCO4oCO4oCO4oCO4oCOU2VsZWN0IGRhdGXigI7igI/igI7igI7igI/i
gI4ABwslMSRkIOWIhumQmAAGCCUxJGQg6bueAAcJRW50ZXIg6Y21AAUP5LiL5ouJ5byP6YG45Zau
AAsZ5LiN5YWB6Kix55qE5pel5pyf77yaJTEkcwAIFOS9v+eUqOOAjCVz44CN5YiG5LqrAAIG5L6G
6Zu7AAQM5YiG5Lqr5bCN6LGhAAIG5YiG6ZCYAAIG5YiG6aCBAAcV5YiH5o+b54K66YG45Y+W5bm0
5Lu9AAkb5YiH5o+b6Iez5paH5a2X6Ly45YWl5qih5byPAAkb5YiH5o+b6Iez5pel5puG6Ly45YWl
5qih5byPAAIG5Yiq6ZmkAAkP5YmN5b6AICUxJHMg5bm0AAMJ5ZCI5Z+L5ZKXAAQM5ZCR5LiK54CP
6Ka9AAgY5Zyo5oyH5a6a5pel5pyf56+E5ZyN5YWnAAMJ5bCN6Kmx5qGGAAQM5bCO6Ka96YG45Zau
AAIG5bCP5pmCAAMJ5bGV6ZaL5ZKXAAcV5bGV6ZaL5bqV6YOo5Yqf6IO96KGoAAYS5bey6Ly45YWl
55qE5pel5pyfAAsZ5bey6Ly45YWl55qE5pel5pyf77yaJTEkcwAEDOW7uuitsOWmguS4iwAFD+W9
iOWHuuW8j+imlueqlwAEDOaJgOmBuOaXpeacnwAEDOaLluabs+aOp+m7ngAEDOaMiemIleijnee9
rgACBuaOm+aWtwACBuaOpeiBvQACBuaPgOWSlwAEDOaPkOS6pOafpeipogACBuaQnOWwiwADCeaQ
nOWwi+KApgAEDOaQnOWwi+afpeipogABA+aQtQACBuaUtuWQiAAHFeaUtuWQiOW6lemDqOWKn+iD
veihqAALGeaXpeacn+agvOW8j+S4jeespu+8miUxJHMAFy/ml6XmnJ/otoXlh7rpoJDmnJ/nmoTl
ubTku73nr4TlnI3vvJolMSRzIC0gJTIkcwAEDOabtOWkmumBuOmghQACBuacquaPgAAGEuato+Wc
qOmBjua/vuS+humbuwAEDOa4hemZpOafpeipogASNua7keWLleWPr+mBuOWPluW5tOWIhu+8jOaI
luWPr+i8leaMiei/lOWbnumBuOWPluaXpeacnwAEDOeAj+imveS4u+mggQABA+eEoQAJE+ebruWJ
jemBuOmghe+8miUxJHMACBjnoozljrvpoa/npLrkuIrkuIDlgIvmnIgACBjnoozljrvpoa/npLrk
uIvkuIDlgIvmnIgACRvnoozljrvpoa/npLrmlrDllbLlmIXlubTku70ACRvnoozljrvpoa/npLro
iIrllbLlmIXlubTku70AAwnnqbrnmb3pjbUABAznr4TlnI3ntZDmnZ8ABAznr4TlnI3plovlp4sA
BAzntZDmnZ/ml6XmnJ8AAgboppblg48ABAzoqp7pn7PmkJzlsIsABhLorormm7Toh7PkuIrlgIvm
nIgABhLorormm7Toh7PkuIvlgIvmnIgABxXovLjlhaXlmIXos4fmlpnnhKHmlYgABAzovLjlhaXm
l6XmnJ8ACRvovLjlhaXnmoTml6XmnJ/nr4TlnI3nhKHmlYgAAwnpgLLooYzkuK0ABxXpgbjlj5bk
uIrljYjmiJbkuIvljYgABAzpgbjlj5bliIbpkJgABAzpgbjlj5blsI/mmYIABAzpgbjlj5bml6Xm
nJ8ABhLpgbjmk4fmh4nnlKjnqIvlvI8ABAzpg6jliIbliZTlkpcAAQPploIABQ/ploLlsI7opr3p
gbjllq4AAwnploLooajllq4AAQPplosAAgbplovllZ8ABAzplovlp4vml6XmnJ8AAgbpl5zplokA
BxXpl5zplonlupXpg6jlip/og73ooagABxXpoa/npLrlubTliIbmjJHpgbjlmagABAzpoa/npLrm
j5DnpLoABwslMSRkIOWIhumSnwAHCyUxJGQg5bCP5pe2AAYIJTEkZCDngrkACApEZWxldGUg6ZSu
AAcJRW50ZXIg6ZSuAAIG5LiK5Y2IAAIG5LiL5Y2IAAQM5LiL5ouJ6I+c5Y2VAAsZ5LiN5YWB6K64
55qE5pel5pyf77yaJTEkcwAFC+S4jiVz5YiG5LqrAAIG5LuK5aSpAAcV5Lul5LiL5piv5pCc57Si
5bu66K6uAAIG5YWz6ZetAAYS5YWz6Zet5a+86Iiq6I+c5Y2VAAUP5YWz6Zet5bel5L2c6KGoAAcV
5YWz6Zet5bqV6YOo5Yqo5L2c5p2hAAQM5YiG5Lqr5a+56LGhAAcV5YiH5o2i5Lul6YCJ5oup5bm0
5Lu9AAoW5YiH5o2i5Yiw5bm05Lu977yaJTEkcwALIeWIh+aNouWIsOaWh+acrOWtl+autei+k+WF
peaooeW8jwAJG+WIh+aNouWIsOaXpeWOhui+k+WFpeaooeW8jwAEDOWcqOiMg+WbtOWGhQACBuWu
jOaIkAADCeWvueivneahhgAEDOWvvOiIquiPnOWNlQAHFeWxleW8gOW6lemDqOWKqOS9nOadoQAD
CeW3suWFs+mXrQADCeW3suWxleW8gAADCeW3suW8gOWQrwADCeW3suaUtui1twADCeW3sumAieaL
qQAHFeW5tOS7vemAieaLqeWZqOWPr+ingQACBuW8gOWFswACBuW8gOWQrwAEDOW8gOWni+aXpeac
nwAFD+W8ueWHuuW8j+eql+WPowAKFuW9k+WJjeeahOmAieaLqe+8miUxJHMAAgbmi5LmjqUABAzm
i5bliqjmiYvmn4QAAgbmjILmlq0AAgbmjqXlkKwABAzmj5DkuqTmn6Xor6IAAgbmj5DnpLoAAgbm
kJzntKIAAwnmkJzntKLigKYABAzmkJzntKLmn6Xor6IAAgbmlLbotbcABxXmlLbotbflupXpg6jl
iqjkvZzmnaEAAQPml6AAAgbml6XmnJ8ADiLml6XmnJ/kuI3nrKblkIjpooTmnJ/moLzlvI/vvJol
MSRzABYq5pel5pyf6LaF5Ye66aKE5pyf5bm05Lu96IyD5Zu0ICUxJHMgLSAlMiRzAAED5pe2AAQM
5pi+56S65o+Q56S6AAQM5pu05aSa6YCJ6aG5AAMJ5pyq6YCJ5oupAAIG5p2l55S1AAQM5p+l55yL
5YWo6YOoAAMJ5qCH562+6aG1AAYS5q2j5Zyo6L+H5ruk5p2l55S1AAQM5q2j5Zyo6YCa6K+dAAQM
5riF6Zmk5p+l6K+iABI25ruR5Yqo5Y+v6YCJ5oup5bm05Lu977yM54K55oyJ5Y+v5YiH5o2i5Zue
6YCJ5oup5pel5pyfAAcV5rua5Yqo5pi+56S65LiK5Liq5pyIAAcV5rua5Yqo5pi+56S65LiL5Liq
5pyIAAkb5rua5Yqo5pi+56S65LmL5YmN55qE5bm05Lu9AAkb5rua5Yqo5pi+56S65LmL5ZCO55qE
5bm05Lu9AAkR55m+5YiG5LmLICUxJGTjgIIAAwnnqbrmoLzplK4ABAznu5PmnZ/ml6XmnJ8ABAzo
jIPlm7Tnu4jngrkABAzojIPlm7TotbfngrkABAzooajnpLrliIbpkp8ABAzooajnpLrlsI/ml7YA
BAzop4bpopHpgJror50ABAzor63pn7PmkJzntKIABhLovazliLDkuIrkuIDlsYLnuqcABQ/ovazl
iLDkuIrkuKrmnIgABQ/ovazliLDkuIvkuKrmnIgABAzovazliLDpppbpobUABAzovpPlhaXml6Dm
lYgABAzovpPlhaXml6XmnJ8ACRPovpPlhaXml6XmnJ/vvJolMSRzAAkb6L6T5YWl55qE5pel5pyf
6IyD5Zu05peg5pWIAAMJ6L+b6KGM5LitAAUP6YCJ5a6a55qE5pel5pyfAAcV6YCJ5oup5LiK5Y2I
5oiW5LiL5Y2IAAQM6YCJ5oup5YiG6ZKfAAQM6YCJ5oup5bCP5pe2AAQM6YCJ5oup5bqU55SoAAQM
6YCJ5oup5pel5pyfAAQM6YOo5YiG6YCJ5LitAAYGJTEkZCUlAAUFJTEkZGgAOjtBIGRhdGEgZXN0
w6EgZm9yYSBkbyBpbnRlcnZhbG8gZGUgYW5vcyBlc3BlcmFkbyAlMSRzIGEgJTIkcwAoK0EgZGF0
YSBuw6NvIGVzdMOhIG5vIHBhZHLDo28gZXNwZXJhZG86ICUxJHMABwdBVElWQURPAAYGQWJlcnRv
ABUWQWJyaXIgcMOhZ2luYSBpbmZlcmlvcgApKUFsdGVybmFyIHBhcmEgbyBtb2RvIGRlIGVudHJh
ZGEgZGEgYWdlbmRhACgoQWx0ZXJuYXIgcGFyYSBvIG1vZG8gZGUgZW50cmFkYSBkZSB0ZXh0bwAQ
EUFsw6dhIGRlIGFycmFzdGFyAAcHQXRlbmRlcgAHB0F0aXZhZG8AEBFDYWl4YSBkZSBkacOhbG9n
bwAUFENoYW1hZGEgZW0gYW5kYW1lbnRvABAQQ2hhbWFkYSByZWNlYmlkYQAFBUNoYXZlABAQQ29t
cGFydGlsaGFyIGNvbQATE0NvbXBhcnRpbGhhciBjb20gJXMACQpDb25jbHXDrWRvABQUQ29uc3Vs
dGEgZGUgcGVzcXVpc2EACgpERVNBVElWQURPAA4PRGF0YSBkZSBpbsOtY2lvAA8QRGF0YSBkZSB0
w6lybWlubwAYGURhdGEgbsOjbyBwZXJtaXRpZGE6ICUxJHMAEBBEYXRhIHNlbGVjaW9uYWRhABER
RGVudHJvIGRvIGFsY2FuY2UACgpEZXNhdGl2YWRvAAgIRGVzbGlnYXIAREdEZXNsaXplIHBhcmEg
c2VsZWNpb25hciB1bSBhbm8gb3UgdG9xdWUgcGFyYSB2b2x0YXIgw6Agc2VsZcOnw6NvIGRlIGRp
YQAEBERpY2EACQlEaXNwZW5zYXIAGRpEaXNwZW5zYXIgcMOhZ2luYSBpbmZlcmlvcgAMDEVtIGFu
ZGFtZW50bwAQEUVudHJhZGEgaW52w6FsaWRhAAcHRmVjaGFkbwAYGkZlY2hhciBtZW51IGRlIG5h
dmVnYcOnw6NvAA8PRmVjaGFyIHBsYW5pbGhhABYXRmVjaGFyIHDDoWdpbmEgaW5mZXJpb3IAHiBG
aWx0cmFuZG8gdW1hIGxpZ2HDp8OjbyByZWNlYmlkYQAQEEZpbSBkbyBpbnRlcnZhbG8ABARHdWlh
AAQESG9qZQAODkluZm9ybWFyIGRhdGFzABMUSW7DrWNpbyBkbyBpbnRlcnZhbG8ADQ1KYW5lbGEg
cG9wLXVwAA8PTGltcGFyIGNvbnN1bHRhAAsNTWFpcyBvcMOnw7VlcwARE01lbnUgZGUgbmF2ZWdh
w6fDo28ADQ1NZW51IHN1c3BlbnNvAAwMTW9zdHJhciBkaWNhABkaTXVkYXIgcGFyYSBvIG3DqnMg
YW50ZXJpb3IAGBpNdWRhciBwYXJhIG8gcHLDs3hpbW8gbcOqcwAdHk5hdmVnYXIgcGFyYSBhIHDD
oWdpbmEgaW5pY2lhbAAREU5hdmVnYXIgcGFyYSBjaW1hABoaTmF2ZWdhciBwYXJhIG8gYW5vIGRl
ICUxJHMABwdOZW5odW1hAA8QTsOjbyBzZWxlY2lvbmFkbwAYGFBhcmNpYWxtZW50ZSBzZWxlY2lv
bmFkYQAQElBlcsOtb2RvIGludsOhbGlkbwAICFBlc3F1aXNhABAQUGVzcXVpc2EgcG9yIHZvegAJ
CVBlc3F1aXNhcgAKDFBlc3F1aXNhcuKApgAICFJlY29saGVyAAcHUmVjdXNhcgAoKFJvbGUgYSB0
ZWxhIHBhcmEgbW9zdHJhciBhbm9zIGFudGVyaW9yZXMAKSlSb2xlIGEgdGVsYSBwYXJhIG1vc3Ry
YXIgYW5vcyBwb3N0ZXJpb3JlcwAnKFJvbGUgYSB0ZWxhIHBhcmEgbW9zdHJhciBvIG3DqnMgYW50
ZXJpb3IAKClSb2xlIGEgdGVsYSBwYXJhIG1vc3RyYXIgbyBtw6pzIHBvc3RlcmlvcgALC1NlbGVj
aW9uYWRvAA8PU2VsZWNpb25hciBkYXRhABAQU2VsZWNpb25hciBkYXRhcwAREVNlbGVjaW9uYXIg
dW0gYXBwABISU2VsZWNpb25lIEFNIG91IFBNABAQU2VsZWNpb25lIGEgaG9yYQAUFFNlbGVjaW9u
ZSBvcyBtaW51dG9zABYXU2VsZXRvciBkZSBkaWEgdmlzw612ZWwAExVTZWxlw6fDo28gYXR1YWw6
ICUxJHMAEBFTdWdlc3TDtWVzIGFiYWl4bwAcHlRyb2NhciBwYXJhIGEgc2VsZcOnw6NvIGRlIGFu
bwAICFZlciB0dWRvAAYHZXNwYcOnbwANDSUxJGQgZW4gcHVudG8ACgolMSRkIGhvcmFzAAwMJTEk
ZCBtaW51dG9zABAQJTEkZCBwb3IgY2llbnRvLgAHB0FDVElWQVIADw9Cb3JyYXIgY29uc3VsdGEA
BgZCdXNjYXIABwlCdXNjYXLigKYACAlCw7pzcXVlZGEAEBFCw7pzcXVlZGEgcG9yIHZvegAHB0Nh
bWJpYXIAHB1DYW1iaWFyIGEgc2VsZWNjaW9uYXIgdW4gYcOxbwAXF0NhbWJpYXIgYWwgbWVzIGFu
dGVyaW9yABgYQ2FtYmlhciBhbCBtZXMgc2lndWllbnRlACgoQ2FtYmlhciBhbCBtb2RvIGRlIGVu
dHJhZGEgZGUgY2FsZW5kYXJpbwAjI0NhbWJpYXIgYWwgbW9kbyBkZSBlbnRyYWRhIGRlIHRleHRv
ABweQ2VycmFyIGVsIG1lbsO6IGRlIG5hdmVnYWNpw7NuAAsLQ2VycmFyIGhvamEABgZDb2xnYXIA
DQ1Db21wYXJ0aXIgY29uABAQQ29tcGFydGlyIGNvbiAlcwAICENvbnRyYWVyABkZQ29udHJhZXIg
bGEgaG9qYSBpbmZlcmlvcgAJCkNvbnRyYcOtZG8AFxdDb250cm9sYWRvciBkZSBhcnJhc3RyZQAK
CkRFU0FDVElWQVIACQlEZXNjYXJ0YXIAGhpEZXNjYXJ0YXIgbGEgaG9qYSBpbmZlcmlvcgBOUERl
c2xpemEgZWwgZGVkbyBwYXJhIGVsZWdpciB1biBhw7FvIG8gcHJlc2lvbmEgcGFyYSB2b2x2ZXIg
YSBzZWxlY2Npb25hciB1biBkw61hACMkRGVzcGzDoXphdGUgcGFyYSB2ZXIgZWwgbWVzIGFudGVy
aW9yACIkRGVzcGzDoXphdGUgcGFyYSB2ZXIgZWwgcHLDs3hpbW8gbWVzACUnRGVzcGzDoXphdGUg
cGFyYSB2ZXIgbG9zIHByaW1lcm9zIGHDsW9zACQnRGVzcGzDoXphdGUgcGFyYSB2ZXIgbG9zIMO6
bHRpbW9zIGHDsW9zAAcIRGnDoWxvZ28ADg5FbGVnaXIgdW5hIGFwcAAICEVuIGN1cnNvAAsLRW4g
ZWwgcmFuZ28AERJFbnRyYWRhIG5vIHbDoWxpZGEADw9FbnZpYXIgY29uc3VsdGEACQlFeHBhbmRp
ZG8AGRlFeHBhbmRpciBsYSBob2phIGluZmVyaW9yAAUFRmVjaGEAFRZGZWNoYSBkZSBmaW5hbGl6
YWNpw7NuAA8PRmVjaGEgZGUgaW5pY2lvAA8PRmVjaGEgaW5ncmVzYWRhABUVRmVjaGEgaW5ncmVz
YWRhOiAlMSRzABgYRmVjaGEgbm8gcGVybWl0aWRhOiAlMSRzABISRmVjaGEgc2VsZWNjaW9uYWRh
AB4eRmlsdHJhbmRvIHVuYSBsbGFtYWRhIGVudHJhbnRlABISRmluYWwgZGUgaW50ZXJ2YWxvAAgJ
RnVuY2nDs24rAAMDSG95AAsMSW5mb3JtYWNpw7NuAA8PSW5ncmVzYXIgZmVjaGFzABMTSW5pY2lv
IGRlIGludGVydmFsbwA7PUxhIGZlY2hhIGVzdMOhIGZ1ZXJhIGRlbCByYW5nbyBkZSBhw7FvcyBl
c3BlcmFkbzogJTEkcyAtICUyJHMAMTJMYSBmZWNoYSBubyBjb2luY2lkZSBjb24gZWwgcGF0csOz
biBlc3BlcmFkbzogJTEkcwAFBUxpc3RvABAQTGxhbWFkYSBlbiBjdXJzbwAQEExsYW1hZGEgZW50
cmFudGUACgtNYXnDunNjdWxhKwASFE1lbsO6IGRlIG5hdmVnYWNpw7NuAAYGTWludXRvABMUTW9z
dHJhciBpbmZvcm1hY2nDs24ADA1Nw6FzIG9wY2lvbmVzAAQETmFkYQAdHk5hdmVnYXIgYSBsYSBw
w6FnaW5hIHByaW5jaXBhbAATFE5hdmVnYXIgYWwgYcOxbyAlMSRzABQUTmF2ZWdhciBoYWNpYSBh
cnJpYmEABwdOaW5ndW5hAAICTm8ABwhQZXN0YcOxYQAICFJlY2hhemFyAAkJUmVzcG9uZGVyACEj
U2UgaW50cm9kdWpvIHVuIHBlcsOtb2RvIG5vIHbDoWxpZG8AFhZTZWxlY2Npb25hIGEubS4gbyBw
Lm0uAAwMU2VsZWNjaW9uYWRvABERU2VsZWNjaW9uYXIgZmVjaGEAEhJTZWxlY2Npb25hciBmZWNo
YXMAEBBTZWxlY2Npb25hciBob3JhABcXU2VsZWNjaW9uYXIgbG9zIG1pbnV0b3MAFhdTZWxlY2Np
w7NuIGFjdHVhbDogJTEkcwAXGFNlbGVjdG9yIGRlIGHDsW8gdmlzaWJsZQAPD1NpbiBzZWxlY2Np
b25hcgAaG1N1Z2VyZW5jaWFzIGEgY29udGludWFjacOzbgACA1PDrQAREVZlbnRhbmEgZW1lcmdl
bnRlAAkJVmVyIHRvZGFzABcXVmVyaWZpY2FkbyBwYXJjaWFsbWVudGUABARhLm0uAAYGYm9ycmFy
AAcHZXNwYWNpbwAFBWludHJvAAQEcC5tLgAICHBvciBob3JhAAsLcG9yIG1pbnV0b3MALzFBIGRh
dGEgbsOjbyBjb3JyZXNwb25kZSBhbyBwYWRyw6NvIGVzcGVyYWRvOiAlMSRzAB8hQSBmaWx0cmFy
IHVtYSBjaGFtYWRhIHJlY2ViaWRh4oCmABAQQ2hhbWFkYSBlbSBjdXJzbwALC0RhdGEgZGUgZmlt
ADQ2RGF0YSBmb3JhIGRvIGludGVydmFsbyBkZSBhbm9zIGVzcGVyYWRvOiAlMSRzIOKAkyAlMiRz
ABAQRGF0YSBpbnRyb2R1emlkYQAWFkRhdGEgaW50cm9kdXppZGE6ICUxJHMAXmBEZXNsaXplIHJh
cGlkYW1lbnRlIHBhcmEgc2VsZWNpb25hciB1bSBhbm8gb3UgdG9xdWUgcGFyYSBtdWRhciBub3Zh
bWVudGUgcGFyYSBhIHNlbGXDp8OjbyBkbyBkaWEALi9EZXNsb3F1ZSBhIHDDoWdpbmEgcGFyYSBt
b3N0cmFyIGFub3MgYW50ZXJpb3JlcwAvMERlc2xvcXVlIGEgcMOhZ2luYSBwYXJhIG1vc3RyYXIg
YW5vcyBwb3N0ZXJpb3JlcwAtL0Rlc2xvcXVlIGEgcMOhZ2luYSBwYXJhIG1vc3RyYXIgbyBtw6pz
IGFudGVyaW9yAC0vRGVzbG9xdWUgYSBww6FnaW5hIHBhcmEgbW9zdHJhciBvIG3DqnMgc2VndWlu
dGUACAhFbSBjdXJzbwAmJ0VudHJhZGEgZG8gaW50ZXJ2YWxvIGRlIGRhdGFzIGludsOhbGlkYQAQ
EEVzY29saGVyIHVtYSBhcHAAGRtFeHBhbmRhIGEgc2Vjw6fDo28gaW5mZXJpb3IADAxGZWNoYXIg
Zm9saGEACApGdW7Dp8OjbyArAAcHSWdub3JhcgAYGklnbm9yZSBhIHNlY8Onw6NvIGluZmVyaW9y
ABcXSW5kaWNhZG9yIHBhcmEgYXJyYXN0YXIAEhJJbnRyb2R1emEgYXMgZGF0YXMADQ1NZW51IHBl
bmRlbnRlABARTW9zdHJhciBzdWdlc3TDo28ABQVNdWRhcgAvM011ZGFyIHBhcmEgbyBtw6l0b2Rv
IGRlIGludHJvZHXDp8OjbyBkZSBjYWxlbmTDoXJpbwAqLU11ZGFyIHBhcmEgbyBtw6l0b2RvIGRl
IGludHJvZHXDp8OjbyBkZSB0ZXh0bwAZGk11ZGFyIHBhcmEgbyBtw6pzIHNlZ3VpbnRlABocTXVk
ZSBwYXJhIGEgc2VsZcOnw6NvIGRvIGFubwAREU5hdmVnYXIgcGFyYSBjYXNhABcXTmF2ZWdhciBw
YXJhIG8gYW5vICUxJHMADQ1QYXJ0aWxoYXIgY29tABYWUGFydGlsaGFyIGNvbSBhIGFwcCAlcwAY
GlJlZHV6YSBhIHNlY8Onw6NvIGluZmVyaW9yAAgIUmVkdXppZG8ABwdSZWR1emlyABscU2VsZWNp
b25hZG9yIGRlIGFubyB2aXPDrXZlbAASElNlbGVjaW9uZSBhcyBkYXRhcwAJCVNlcGFyYWRvcgAI
CVN1Z2VzdMOjbwAJCXBhcmEgaG9yYQAMDHBhcmEgbWludXRvcwAKCiUxJGQgaG91cnMADAwlMSRk
IG1pbnV0ZXMADAwlMSRkIG8nY2xvY2sADg4lMSRkIHBlciBjZW50LgAGBkFuc3dlcgAUFENoYW5n
ZSB0byBuZXh0IG1vbnRoABgYQ2hhbmdlIHRvIHByZXZpb3VzIG1vbnRoAA0NQ2hvb3NlIGFuIGFw
cAALC0NsZWFyIHF1ZXJ5ABUVQ2xvc2UgbmF2aWdhdGlvbiBtZW51AAsLQ2xvc2Ugc2hlZXQACAhD
b2xsYXBzZQAVFUNvbGxhcHNlIGJvdHRvbSBzaGVldAAJCUNvbGxhcHNlZAAXF0N1cnJlbnQgc2Vs
ZWN0aW9uOiAlMSRzAAQERGF0ZQAqKkRhdGUgZG9lcyBub3QgbWF0Y2ggZXhwZWN0ZWQgcGF0dGVy
bjogJTEkcwAWFkRhdGUgbm90IGFsbG93ZWQ6ICUxJHMAKy1EYXRlIG91dCBvZiBleHBlY3RlZCB5
ZWFyIHJhbmdlICUxJHMg4oCTICUyJHMABwdEZWNsaW5lAAgIRGlhbG9ndWUABwdEaXNtaXNzABQU
RGlzbWlzcyBib3R0b20gc2hlZXQABAREb25lAAsLRHJhZyBoYW5kbGUADg5Ecm9wLWRvd24gbWVu
dQAICEVuZCBkYXRlAAsLRW50ZXIgZGF0ZXMADAxFbnRlcmVkIGRhdGUAEhJFbnRlcmVkIGRhdGU6
ICUxJHMAExNFeHBhbmQgYm90dG9tIHNoZWV0AAgIRXhwYW5kZWQABwdIYW5nIHVwAAQESG91cgAL
C0luIHByb2dyZXNzAAgISW4gcmFuZ2UADQ1JbmNvbWluZyBjYWxsABgYSW52YWxpZCBkYXRlIHJh
bmdlIGlucHV0AA0NSW52YWxpZCBpbnB1dAAMDE1vcmUgb3B0aW9ucwANDU5hdmlnYXRlIGhvbWUA
FRVOYXZpZ2F0ZSB0byB5ZWFyICUxJHMACwtOYXZpZ2F0ZSB1cAAPD05hdmlnYXRpb24gbWVudQAE
BE5vbmUADAxOb3Qgc2VsZWN0ZWQAAwNPRkYAAgJPTgADA09mZgACAk9uAA0NT24tZ29pbmcgY2Fs
bAAQEFBhcnRpYWxseSB0aWNrZWQADQ1Qb3AtdXAgd2luZG93AAkJUmFuZ2UgZW5kAAsLUmFuZ2Ug
c3RhcnQAGhpTY3JlZW5pbmcgYW4gaW5jb21pbmcgY2FsbAAcHFNjcm9sbCB0byBzaG93IGVhcmxp
ZXIgeWVhcnMAGhpTY3JvbGwgdG8gc2hvdyBsYXRlciB5ZWFycwAdHVNjcm9sbCB0byBzaG93IHRo
ZSBuZXh0IG1vbnRoACEhU2Nyb2xsIHRvIHNob3cgdGhlIHByZXZpb3VzIG1vbnRoAAwMU2VhcmNo
IHF1ZXJ5AAcJU2VhcmNo4oCmAAcHU2VlIGFsbAATE1NlbGVjdCBhLm0uIG9yIHAubS4ACwtTZWxl
Y3QgZGF0ZQAMDFNlbGVjdCBkYXRlcwALC1NlbGVjdCBob3VyAA4OU2VsZWN0IG1pbnV0ZXMACAhT
ZWxlY3RlZAANDVNlbGVjdGVkIGRhdGUACgpTaGFyZSB3aXRoAA0NU2hhcmUgd2l0aCAlcwAMDFNo
b3cgdG9vbHRpcAAKClN0YXJ0IGRhdGUADAxTdWJtaXQgcXVlcnkAERFTdWdnZXN0aW9ucyBiZWxv
dwBAQFN3aXBlIHRvIHNlbGVjdCBhIHllYXIsIG9yIHRhcCB0byBzd2l0Y2ggYmFjayB0byBzZWxl
Y3RpbmcgYSBkYXkABgZTd2l0Y2gAHR1Td2l0Y2ggdG8gY2FsZW5kYXIgaW5wdXQgbW9kZQAaGlN3
aXRjaCB0byBzZWxlY3RpbmcgYSB5ZWFyABkZU3dpdGNoIHRvIHRleHQgaW5wdXQgbW9kZQAFBVRv
ZGF5AAcHVG9vbHRpcAAMDFZvaWNlIHNlYXJjaAATE1llYXIgcGlja2VyIHZpc2libGUACAhmb3Ig
aG91cgALC2ZvciBtaW51dGVzAAgKRGVsZXRlIOmNtQAFB1RhYiDpjbUAAwnliIfmj5vpiJUABAzl
sI3oqbHmlrnloYoABAzlt6Xlhbfmj5DnpLoAAwnlt7LlsZXplosAAwnlt7LmlLblkIgAAwnlt7Lp
gbjlj5YAAwnlt7LplovllZ8AAwnlt7Lpl5zplokACh7mjbLli5XljbPlj6/poa/npLrkuIrkuIDl
gIvmnIgACh7mjbLli5XljbPlj6/poa/npLrkuIvkuIDlgIvmnIgACyHmjbLli5XljbPlj6/poa/n
pLrkuYvlvoznmoTlubTliIYACyHmjbLli5XljbPlj6/poa/npLrlhYjliY3nmoTlubTliIYABQ/m
lLnmiJDkuIrlgIvmnIgABQ/mlLnmiJDkuIvlgIvmnIgABhLmlLnngrrpgbjlj5blubTku70AAwnm
nKrpgbjlj5YAEjbmu5Hli5Xlj6/pgbjlj5blubTliIbvvIzkuZ/lj6/ovJXop7jov5Tlm57pgbjl
j5bml6XmnJ8ABAzngI/opr3pppbpoIEAAwnnqbrmoLzpjbUABAznr4TlnI3ntYLpu54ABAznr4Tl
nI3otbfpu54ABxHoiIfjgIwlc+OAjeWIhuS6qwADCeiZleeQhuS4rQACBuimluioigAGEui8uOWF
peWFp+WuueeEoeaViAAFD+i8uOWFpeeahOaXpeacnwAKFui8uOWFpeeahOaXpeacn++8miUxJHMA
BAzpg6jliIbmqqLmn6UABQ/pl5zplonlip/og73ooagABhLpl5zplonlsI7opr3pgbjllq4ABhLp
oa/npLrlt6Xlhbfmj5DnpLoABxXpoa/npLrlubTku73mjJHpgbjlmagAAAIgAVS6BAB/AAAAYwBv
AG0ALgBlAHgAYQBtAHAAbABlAC4AbQB5AGEAcABwAGwAaQBjAGEAdABpAG8AbgAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACABAAAAAAAAbAIAAAAAAAAAAAAAAQAcAEwBAAAQAAAA
AAAAAAAAAABcAAAAAAAAAAAAAAAMAAAAIAAAACwAAAA4AAAARgAAAFQAAABoAAAAcAAAAIIAAACe
AAAArgAAAL4AAADOAAAA3AAAAOYAAAAEAGEAbgBpAG0AAAAIAGEAbgBpAG0AYQB0AG8AcgAAAAQA
YQB0AHQAcgAAAAQAYgBvAG8AbAAAAAUAYwBvAGwAbwByAAAABQBkAGkAbQBlAG4AAAAIAGQAcgBh
AHcAYQBiAGwAZQAAAAIAaQBkAAAABwBpAG4AdABlAGcAZQByAAAADABpAG4AdABlAHIAcABvAGwA
YQB0AG8AcgAAAAYAbABhAHkAbwB1AHQAAAAGAG0AaQBwAG0AYQBwAAAABgBzAHQAcgBpAG4AZwAA
AAUAcwB0AHkAbABlAAAAAwA/ADEANQAAAAMAeABtAGwAAAABABwAFLMAAEgFAAAAAAAAAAEAADwV
AAAAAAAAAAAAAA4AAAAdAAAAPAAAAE4AAABfAAAAgQAAAJcAAACqAAAAwQAAANUAAADpAAAA/AAA
ADEBAABmAQAAlAEAAMsBAAADAgAAMwIAAF8CAACMAgAAvgIAAOkCAAAVAwAARgMAAGgDAAB/AwAA
lQMAAKsDAADAAwAA1gMAAOsDAAD+AwAAGAQAAC4EAAA+BAAAVAQAAGUEAAB8BAAAkAQAAKgEAAC5
BAAA0AQAAOQEAAD6BAAACQUAACQFAAA6BQAAUQUAAG4FAACSBQAArAUAAMUFAADdBQAA9gUAABAG
AAAtBgAASwYAAGUGAACBBgAAkwYAAKUGAADDBgAA3wYAAPkGAAAPBwAAIQcAADwHAABaBwAAdQcA
AIgHAACbBwAAqwcAALMHAADJBwAA2wcAAO4HAAAKCAAAIAgAADYIAABMCAAAZggAAHkIAACGCAAA
mAgAAKwIAAC9CAAA0ggAAN4IAAD2CAAADQkAACwJAABKCQAAaQkAAHoJAACJCQAAmQkAAKsJAADD
CQAA0QkAAOQJAADxCQAAAgoAABIKAAApCgAANQoAAEcKAABkCgAAcwoAAHsKAACJCgAAowoAALcK
AADPCgAA5woAAPwKAAAJCwAAGAsAACsLAABECwAAUQsAAGYLAAB4CwAAlQsAAKgLAAC8CwAA0AsA
APILAAAGDAAAHwwAADIMAABHDAAAYAwAAG4MAAB/DAAAiQwAAJ0MAACuDAAAwAwAANcMAADrDAAA
AA0AABYNAAAlDQAAOw0AAEoNAABdDQAAcQ0AAIQNAACcDQAAvg0AANMNAADjDQAA8w0AAP8NAAAm
DgAAQQ4AAEgOAABVDgAAbQ4AAIEOAACdDgAAuA4AAM4OAADiDgAAAQ8AAA0PAAAlDwAAMg8AAEMP
AABMDwAAVQ8AAGsPAAB/DwAAjA8AAJMPAACeDwAArQ8AAMIPAADVDwAA8g8AAAkQAAAYEAAAJhAA
AC4QAABLEAAAVBAAAGEQAACBEAAApxAAAMsQAADkEAAA9RAAAAIRAAAWEQAALREAAEcRAABmEQAA
hREAAKMRAADCEQAA4hEAAAISAAAJEgAAGxIAAC0SAABHEgAAThIAAGYSAACFEgAAlhIAAKcSAAC/
EgAA0hIAAOISAAD7EgAACBMAABcTAAArEwAAPRMAAFITAABnEwAAeBMAAIUTAACYEwAArhMAAMMT
AADWEwAA6BMAAPQTAAAEFAAAFxQAACgUAABCFAAAWBQAAGkUAAB2FAAAiBQAAJcUAACyFAAA1xQA
AO8UAAD+FAAADRUAABgVAAAkFQAAPRUAAEgVAABjFQAAchUAAH8VAACLFQAAoBUAAK8VAADCFQAA
zRUAAOYVAAD6FQAADhYAACQWAAA1FgAARRYAAFMWAABqFgAAeBYAAJcWAACwFgAA0hYAAPAWAAAQ
FwAANRcAAFcXAAB2FwAAlRcAAKoXAAC3FwAAvxcAAMsXAADeFwAA6hcAAPoXAAAFGAAAFBgAACcY
AAAuGAAAORgAAEEYAABPGAAAYxgAAHQYAACHGAAAmBgAAKcYAAC9GAAAzhgAAN8YAAD+GAAADRkA
ACYZAAA/GQAATRkAAFUZAABhGQAAcRkAAHwZAACQGQAAnBkAAK4ZAADHGQAA4RkAAPoZAAATGgAA
KxoAAEMaAABZGgAAbxoAAH8aAACbGgAAvhoAAPEaAAAlGwAAUBsAAHAbAACPGwAArRsAANEbAAD1
GwAAGhwAAEgcAAB3HAAAmBwAALocAADQHAAA7RwAAAsdAAAqHQAATR0AAHEdAACKHQAAnR0AALEd
AADHHQAA2h0AAPIdAAAJHgAAIR4AAEceAAB9HgAAoR4AAMYeAADhHgAA/R4AAAUfAAAwHwAAXB8A
AIYfAACxHwAA0x8AAPYfAAANIAAAJSAAAEYgAABoIAAAkCAAALkgAADYIAAA+CAAABQhAAAxIQAA
TCEAAGghAACJIQAAqyEAAMQhAADdIQAA9iEAAA8iAAAoIgAAPCIAAFAiAABjIgAAdyIAAIsiAACf
IgAAsyIAANYiAADzIgAAECMAAC4jAABGIwAAXyMAAIQjAACqIwAA0CMAAPcjAAAEJAAAESQAAB4k
AAA1JAAATSQAAHQkAACcJAAAxCQAAO0kAAATJQAAOiUAAFclAAB1JQAAmSUAAL4lAADJJQAA1CUA
AO4lAAAJJgAAHSYAADcmAAA/JgAAZyYAAI8mAAC4JgAA5iYAABYnAAA6JwAAaicAAJknAADKJwAA
7icAABUoAABGKAAAdCgAAJwoAADDKAAA8ygAABgpAAA4KQAAXykAAIQpAACtKQAA1CkAAP0pAAAa
KgAAOCoAAFUqAAB0KgAAmCoAALgqAADYKgAA9yoAABYrAABCKwAAaSsAAIYrAACjKwAAwSsAAOMr
AAAHLAAAKiwAAE4sAABsLAAAkSwAALcsAADdLAAABy0AACotAABCLQAAaC0AAIgtAACuLQAA2i0A
APYtAAAZLgAAPC4AAF4uAACNLgAAui4AAOUuAAD0LgAABi8AABcvAAAsLwAATC8AAGwvAACMLwAA
rS8AANAvAADzLwAAFjAAADkwAABbMAAAejAAAJowAAC/MAAA3TAAAPwwAAAdMQAARzEAAGYxAACN
MQAAtzEAAN8xAAALMgAANTIAAFYyAACCMgAArTIAAMwyAADsMgAADzMAAC8zAABQMwAAazMAAIcz
AACqMwAAzjMAAO4zAAAONAAALzQAAFM0AAB0NAAAlDQAALs0AADeNAAA/TQAACM1AABQNQAAeDUA
AJQ1AACrNQAAzTUAAOU1AAACNgAAEzYAADk2AABcNgAAdzYAAJQ2AACtNgAAyjYAAOk2AAATNwAA
MTcAAEo3AABoNwAAhzcAAKY3AADBNwAA3jcAAPc3AAAVOAAANDgAAFM4AAB1OAAAlzgAALg4AADa
OAAA/jgAACA5AABBOQAAWjkAAHQ5AACZOQAAsTkAANc5AAD3OQAAGDoAADU6AABVOgAAdzoAAJo6
AAC5OgAA1joAAPk6AAAZOwAAOjsAAFY7AAB0OwAAjDsAAKg7AADFOwAA4zsAABc8AABMPAAAczwA
AJs8AAC5PAAA2DwAAPs8AAAcPQAAPz0AAFg9AAB3PQAAnT0AAMg9AADzPQAAFT4AADU+AABSPgAA
cz4AAJA+AACsPgAA2D4AAO4+AAAJPwAAJT8AAEM/AABgPwAAfz8AAJo/AAC9PwAA4j8AAAZAAAAr
QAAATkAAAHpAAACkQAAAxEAAANZAAADyQAAAJUEAAENBAAB2QQAAi0EAALBBAADEQQAA6UEAAPpB
AAAPQgAAJkIAAEFCAABTQgAAaUIAAIJCAACbQgAAvEIAAM5CAADkQgAAAUMAAB9DAAA4QwAAWUMA
AHhDAACYQwAAvEMAANNDAAD3QwAADEQAACJEAAAoRAAAL0QAADpEAABBRAAASUQAAE9EAAB1RAAA
lUQAALVEAADWRAAA90QAABhFAAA5RQAAWkUAAHtFAACcRQAAvUUAAN5FAAD/RQAAH0YAAEBGAABh
RgAAgkYAAKNGAADERgAA5UYAAAZHAAAnRwAASEcAAGlHAACJRwAAqkcAAMtHAADrRwAAC0gAACtI
AABLSAAAa0gAAItIAACYSAAAtkgAAM1IAADfSAAA9EgAAApJAAAdSQAAMEkAAEVJAABWSQAAZUkA
AHtJAACTSQAApUkAALxJAADXSQAA5UkAAO9JAAAPSgAAFUoAACJKAAArSgAAWkoAAGJKAABuSgAA
eUoAAIJKAACQSgAAnUoAAK9KAAC6SgAAxEoAANJKAADnSgAABksAACJLAAAsSwAAO0sAAERLAABS
SwAAaUsAAINLAACTSwAAoUsAAK9LAAC8SwAAyUsAAM9LAADqSwAA+ksAAARMAAAiTAAAMkwAAEpM
AABRTAAAXEwAAGlMAAByTAAAekwAAIFMAACdTAAAuEwAAMFMAADJTAAA0UwAANxMAADoTAAA8kwA
APtMAAAGTQAADk0AABVNAAAeTQAAOE0AAFNNAAB4TQAAfk0AAINNAACRTQAAuU0AAM1NAADjTQAA
600AAPpNAAAHTgAAFE4AAB1OAAAzTgAAR04AAFROAABjTgAAcE4AAIBOAACTTgAAp04AALdOAADJ
TgAA2E4AAOpOAAD9TgAAFk8AACFPAAAuTwAAOU8AAEJPAABoTwAAe08AAIZPAACPTwAAmk8AAKlP
AAC3TwAAwU8AAN1PAAABUAAAHVAAADxQAABbUAAAfVAAAKFQAAC/UAAA11AAAO5QAAAQUQAALlEA
AFVRAABcUQAAZFEAAHpRAACOUQAAoVEAAKhRAAC/UQAA0FEAANZRAADhUQAA7VEAAPdRAAD8UQAA
BlIAACJSAABPUgAAdlIAAJlSAAC+UgAAyVIAANhSAADyUgAAElMAADBTAABMUwAAZVMAAItTAADA
UwAA9VMAACxUAABjVAAAlFQAAMRUAADXVAAA81QAABFVAAAvVQAASFUAAF5VAACEVQAAoFUAAMZV
AADtVQAACVYAACtWAABMVgAAaFYAAINWAAChVgAAu1YAANdWAADyVgAAFlcAADNXAABQVwAAZFcA
AIxXAAChVwAAyFcAANpXAAD3VwAABVgAABVYAAAlWAAAO1gAAFtYAAB+WAAAoVgAAMpYAADsWAAA
ClkAAC9ZAABVWQAAfFkAAIpZAACeWQAAwFkAAOBZAAAHWgAAHloAAEJaAABvWgAAgVoAAJJaAACw
WgAAz1oAAPBaAAAQWwAAM1sAAFJbAAByWwAAklsAALBbAADNWwAA31sAAAJcAAAlXAAASVwAAG1c
AACQXAAAtVwAAOZcAAAJXQAAHF0AACddAABLXQAAbl0AAJVdAAC3XQAA2V0AAAFeAAAkXgAAR14A
AGleAACKXgAArV4AALxeAADKXgAA1l4AAOxeAAAOXwAAL18AAFBfAABwXwAAg18AAKVfAAC4XwAA
z18AAPJfAAAdYAAARGAAAGpgAACOYAAAtGAAANpgAAD9YAAAIGEAAEdhAABuYQAAgmEAAKJhAADH
YQAA7mEAAAdiAAAoYgAASWIAAHJiAACfYgAAwmIAANxiAAD0YgAAEWMAABpjAAAqYwAANWMAAENj
AABTYwAAcWMAAINjAACSYwAAnmMAAKxjAADAYwAA1GMAAN9jAADyYwAAGmQAADJkAABAZAAARmQA
AFlkAABqZAAAfWQAAJtkAAC4ZAAA0mQAAPBkAAAFZQAAJGUAAEBlAABgZQAAiGUAAJllAAC0ZQAA
z2UAAOdlAAAFZgAAImYAAENmAABhZgAAfmYAAKFmAADDZgAA6WYAAAxnAAAvZwAAXGcAAHxnAACi
ZwAAyGcAAO9nAAAXaAAAQGgAAGloAACSaAAAu2gAAORoAAAMaQAAMmkAAGBpAACdaQAA2mkAAAFq
AAAwagAAVWoAAIJqAAC4agAA62oAABFrAAA/awAAZ2sAAJdrAAC9awAA62sAABNsAABJbAAAg2wA
AMVsAAD8bAAAO20AAHZtAACubQAA3G0AAB1uAABTbgAAiW4AAL1uAAD1bgAALG8AAGNvAACRbwAA
zW8AAAZwAAA+cAAAc3AAAIpwAACtcAAAy3AAAO9wAAAXcQAAPnEAAGVxAACCcQAArXEAANFxAAD7
cQAAKXIAAFZyAACDcgAAoXIAAMlyAADscgAAGXMAAD5zAABpcwAAjXMAAKhzAADKcwAA63MAABN0
AAA8dAAAV3QAAHh0AACTdAAAtHQAAM90AADwdAAAFHUAAC91AABQdQAAanUAAIt1AACrdQAA0nUA
APp1AAAqdgAATnYAAHF2AACTdgAAu3YAAOR2AAAOdwAAOHcAAF13AACMdwAAuncAAN13AAAJeAAA
NngAAFV4AAB/eAAAsXgAAOZ4AAANeQAAMnkAAFR5AACCeQAAsnkAAOV5AAATegAAPXoAAG56AACb
egAAvHoAAOB6AAAIewAANnsAAGV7AACVewAAzXsAAP17AAAlfAAAVnwAAHt8AACjfAAAxHwAAO58
AAAUfQAANn0AAGF9AACFfQAAqX0AANh9AAD6fQAAJn4AAE5+AABxfgAAnn4AAL5+AADnfgAAB38A
ADJ/AABTfwAAgH8AAKB/AADSfwAA5n8AAPx/AAAYgAAALYAAAEiAAABqgAAAkYAAALmAAADSgAAA
8YAAAAqBAAApgQAATYEAAHaBAACogQAA14EAAAOCAAA9ggAAcoIAAKuCAADcggAADoMAADyDAABw
gwAApIMAANiDAAALhAAAPIQAAGiEAACdhAAAuIQAANmEAAD6hAAAHIUAAD+FAABjhQAAh4UAAKuF
AADPhQAA84UAABaGAAA3hgAAYIYAAJeGAADLhgAAA4cAADuHAABdhwAAh4cAAKeHAADYhwAABogA
ACeIAABQiAAAc4gAAJ6IAAC/iAAA6IgAAAuJAAA8iQAAcYkAAK6JAADgiQAAGooAAFCKAACOigAA
wYoAAPyKAAAliwAAYYsAAJKLAADDiwAA8osAACWMAABXjAAAiYwAALKMAADpjAAADo0AADiNAABj
jQAAjY0AALiNAADsjQAAH44AAE+OAABhjgAAf44AAJqOAADDjgAA5Y4AAA2PAAA4jwAAY48AAIqP
AACjjwAAwo8AAOSPAAAGkAAAHpAAADaQAABckAAAe5AAAKCQAADIkAAA8JAAABSRAAAykQAASJEA
AGGRAACEkQAAopEAAMqRAADskQAAGJIAADiSAABekgAAfZIAAJqSAAC9kgAA4ZIAAAaTAAArkwAA
S5MAAHWTAACekwAAvJMAAOOTAAALlAAAJZQAAEqUAAB3lAAAp5QAAMmUAADplAAABpUAAC+VAABa
lQAAiJUAALGVAADWlQAA/pUAABqWAAA5lgAAXJYAAIWWAAC2lgAA4JYAABKXAAA9lwAAcJcAAJuX
AADOlwAA9JcAACSYAABTmAAAf5gAAKyYAADamAAACJkAADGZAABcmQAAf5kAAKuZAADPmQAAA5oA
ACOaAABGmgAAYpoAAIeaAAComgAAxZoAAOuaAAAKmwAAKZsAAFObAABwmwAAl5sAALqbAADYmwAA
AJwAABucAAA/nAAAWpwAAH6cAACsnAAA0pwAAO6cAAAWnQAAMZ0AAF6dAACKnQAAsZ0AAMCdAAAL
C2FiY19mYWRlX2luAAwMYWJjX2ZhZGVfb3V0ABwcYWJjX2dyb3dfZmFkZV9pbl9mcm9tX2JvdHRv
bQAPD2FiY19wb3B1cF9lbnRlcgAODmFiY19wb3B1cF9leGl0AB8fYWJjX3Nocmlua19mYWRlX291
dF9mcm9tX2JvdHRvbQATE2FiY19zbGlkZV9pbl9ib3R0b20AEBBhYmNfc2xpZGVfaW5fdG9wABQU
YWJjX3NsaWRlX291dF9ib3R0b20AERFhYmNfc2xpZGVfb3V0X3RvcAAREWFiY190b29sdGlwX2Vu
dGVyABAQYWJjX3Rvb2x0aXBfZXhpdAAyMmJ0bl9jaGVja2JveF90b19jaGVja2VkX2JveF9pbm5l
cl9tZXJnZWRfYW5pbWF0aW9uADIyYnRuX2NoZWNrYm94X3RvX2NoZWNrZWRfYm94X291dGVyX21l
cmdlZF9hbmltYXRpb24AKytidG5fY2hlY2tib3hfdG9fY2hlY2tlZF9pY29uX251bGxfYW5pbWF0
aW9uADQ0YnRuX2NoZWNrYm94X3RvX3VuY2hlY2tlZF9ib3hfaW5uZXJfbWVyZ2VkX2FuaW1hdGlv
bgA1NWJ0bl9jaGVja2JveF90b191bmNoZWNrZWRfY2hlY2tfcGF0aF9tZXJnZWRfYW5pbWF0aW9u
AC0tYnRuX2NoZWNrYm94X3RvX3VuY2hlY2tlZF9pY29uX251bGxfYW5pbWF0aW9uACkpYnRuX3Jh
ZGlvX3RvX29mZl9tdHJsX2RvdF9ncm91cF9hbmltYXRpb24AKipidG5fcmFkaW9fdG9fb2ZmX210
cmxfcmluZ19vdXRlcl9hbmltYXRpb24ALy9idG5fcmFkaW9fdG9fb2ZmX210cmxfcmluZ19vdXRl
cl9wYXRoX2FuaW1hdGlvbgAoKGJ0bl9yYWRpb190b19vbl9tdHJsX2RvdF9ncm91cF9hbmltYXRp
b24AKSlidG5fcmFkaW9fdG9fb25fbXRybF9yaW5nX291dGVyX2FuaW1hdGlvbgAuLmJ0bl9yYWRp
b190b19vbl9tdHJsX3Jpbmdfb3V0ZXJfcGF0aF9hbmltYXRpb24AHx9mcmFnbWVudF9mYXN0X291
dF9leHRyYV9zbG93X2luABQUZnJhZ21lbnRfY2xvc2VfZW50ZXIAExNmcmFnbWVudF9jbG9zZV9l
eGl0ABMTZnJhZ21lbnRfZmFkZV9lbnRlcgASEmZyYWdtZW50X2ZhZGVfZXhpdAATE2ZyYWdtZW50
X29wZW5fZW50ZXIAEhJmcmFnbWVudF9vcGVuX2V4aXQAEBBhY3Rpb25CYXJEaXZpZGVyABcXYWN0
aW9uQmFySXRlbUJhY2tncm91bmQAExNhY3Rpb25CYXJQb3B1cFRoZW1lAA0NYWN0aW9uQmFyU2l6
ZQATE2FjdGlvbkJhclNwbGl0U3R5bGUADg5hY3Rpb25CYXJTdHlsZQAUFGFjdGlvbkJhclRhYkJh
clN0eWxlABERYWN0aW9uQmFyVGFiU3R5bGUAFRVhY3Rpb25CYXJUYWJUZXh0U3R5bGUADg5hY3Rp
b25CYXJUaGVtZQAUFGFjdGlvbkJhcldpZGdldFRoZW1lABERYWN0aW9uQnV0dG9uU3R5bGUAExNh
Y3Rpb25Ecm9wRG93blN0eWxlAAwMYWN0aW9uTGF5b3V0ABgYYWN0aW9uTWVudVRleHRBcHBlYXJh
bmNlABMTYWN0aW9uTWVudVRleHRDb2xvcgAUFGFjdGlvbk1vZGVCYWNrZ3JvdW5kABoaYWN0aW9u
TW9kZUNsb3NlQnV0dG9uU3R5bGUAISFhY3Rpb25Nb2RlQ2xvc2VDb250ZW50RGVzY3JpcHRpb24A
FxdhY3Rpb25Nb2RlQ2xvc2VEcmF3YWJsZQAWFmFjdGlvbk1vZGVDb3B5RHJhd2FibGUAFRVhY3Rp
b25Nb2RlQ3V0RHJhd2FibGUAFhZhY3Rpb25Nb2RlRmluZERyYXdhYmxlABcXYWN0aW9uTW9kZVBh
c3RlRHJhd2FibGUAGhphY3Rpb25Nb2RlUG9wdXBXaW5kb3dTdHlsZQAbG2FjdGlvbk1vZGVTZWxl
Y3RBbGxEcmF3YWJsZQAXF2FjdGlvbk1vZGVTaGFyZURyYXdhYmxlABkZYWN0aW9uTW9kZVNwbGl0
QmFja2dyb3VuZAAPD2FjdGlvbk1vZGVTdHlsZQAPD2FjdGlvbk1vZGVUaGVtZQAbG2FjdGlvbk1v
ZGVXZWJTZWFyY2hEcmF3YWJsZQAZGWFjdGlvbk92ZXJmbG93QnV0dG9uU3R5bGUAFxdhY3Rpb25P
dmVyZmxvd01lbnVTdHlsZQATE2FjdGlvblByb3ZpZGVyQ2xhc3MADw9hY3Rpb25WaWV3Q2xhc3MA
GBhhY3Rpdml0eUNob29zZXJWaWV3U3R5bGUAGxthbGVydERpYWxvZ0J1dHRvbkdyb3VwU3R5bGUA
GBhhbGVydERpYWxvZ0NlbnRlckJ1dHRvbnMAEBBhbGVydERpYWxvZ1N0eWxlABAQYWxlcnREaWFs
b2dUaGVtZQANDWFsbG93U3RhY2tpbmcABQVhbHBoYQATE2FscGhhYmV0aWNNb2RpZmllcnMADw9h
cnJvd0hlYWRMZW5ndGgAEBBhcnJvd1NoYWZ0TGVuZ3RoABkZYXV0b0NvbXBsZXRlVGV4dFZpZXdT
dHlsZQATE2F1dG9TaXplTWF4VGV4dFNpemUAExNhdXRvU2l6ZU1pblRleHRTaXplABMTYXV0b1Np
emVQcmVzZXRTaXplcwAXF2F1dG9TaXplU3RlcEdyYW51bGFyaXR5ABAQYXV0b1NpemVUZXh0VHlw
ZQAKCmJhY2tncm91bmQADw9iYWNrZ3JvdW5kU3BsaXQAERFiYWNrZ3JvdW5kU3RhY2tlZAAODmJh
Y2tncm91bmRUaW50ABISYmFja2dyb3VuZFRpbnRNb2RlAAkJYmFyTGVuZ3RoABUVYm9yZGVybGVz
c0J1dHRvblN0eWxlABQUYnV0dG9uQmFyQnV0dG9uU3R5bGUAHBxidXR0b25CYXJOZWdhdGl2ZUJ1
dHRvblN0eWxlABsbYnV0dG9uQmFyTmV1dHJhbEJ1dHRvblN0eWxlABwcYnV0dG9uQmFyUG9zaXRp
dmVCdXR0b25TdHlsZQAODmJ1dHRvbkJhclN0eWxlAAwMYnV0dG9uQ29tcGF0AA0NYnV0dG9uR3Jh
dml0eQAPD2J1dHRvbkljb25EaW1lbgAVFWJ1dHRvblBhbmVsU2lkZUxheW91dAALC2J1dHRvblN0
eWxlABAQYnV0dG9uU3R5bGVTbWFsbAAKCmJ1dHRvblRpbnQADg5idXR0b25UaW50TW9kZQANDWNo
ZWNrYm94U3R5bGUAFBRjaGVja2VkVGV4dFZpZXdTdHlsZQAJCWNsb3NlSWNvbgAPD2Nsb3NlSXRl
bUxheW91dAAaGmNvbGxhcHNlQ29udGVudERlc2NyaXB0aW9uAAwMY29sbGFwc2VJY29uAAUFY29s
b3IACwtjb2xvckFjY2VudAAXF2NvbG9yQmFja2dyb3VuZEZsb2F0aW5nABERY29sb3JCdXR0b25O
b3JtYWwAFRVjb2xvckNvbnRyb2xBY3RpdmF0ZWQAFRVjb2xvckNvbnRyb2xIaWdobGlnaHQAEhJj
b2xvckNvbnRyb2xOb3JtYWwACgpjb2xvckVycm9yAAwMY29sb3JQcmltYXJ5ABAQY29sb3JQcmlt
YXJ5RGFyawAWFmNvbG9yU3dpdGNoVGh1bWJOb3JtYWwACgpjb21taXRJY29uABISY29udGVudERl
c2NyaXB0aW9uAA8PY29udGVudEluc2V0RW5kABoaY29udGVudEluc2V0RW5kV2l0aEFjdGlvbnMA
EBBjb250ZW50SW5zZXRMZWZ0ABERY29udGVudEluc2V0UmlnaHQAERFjb250ZW50SW5zZXRTdGFy
dAAfH2NvbnRlbnRJbnNldFN0YXJ0V2l0aE5hdmlnYXRpb24AERFjb250cm9sQmFja2dyb3VuZAAW
FmN1c3RvbU5hdmlnYXRpb25MYXlvdXQAEBBkZWZhdWx0UXVlcnlIaW50ABISZGlhbG9nQ29ybmVy
UmFkaXVzABYWZGlhbG9nUHJlZmVycmVkUGFkZGluZwALC2RpYWxvZ1RoZW1lAA4OZGlzcGxheU9w
dGlvbnMABwdkaXZpZGVyABERZGl2aWRlckhvcml6b250YWwADg5kaXZpZGVyUGFkZGluZwAPD2Rp
dmlkZXJWZXJ0aWNhbAAUFGRyYXdhYmxlQm90dG9tQ29tcGF0ABERZHJhd2FibGVFbmRDb21wYXQA
EhJkcmF3YWJsZUxlZnRDb21wYXQAExNkcmF3YWJsZVJpZ2h0Q29tcGF0AAwMZHJhd2FibGVTaXpl
ABMTZHJhd2FibGVTdGFydENvbXBhdAAMDGRyYXdhYmxlVGludAAQEGRyYXdhYmxlVGludE1vZGUA
ERFkcmF3YWJsZVRvcENvbXBhdAAQEGRyYXdlckFycm93U3R5bGUAFRVkcm9wRG93bkxpc3RWaWV3
U3R5bGUAHx9kcm9wZG93bkxpc3RQcmVmZXJyZWRJdGVtSGVpZ2h0ABISZWRpdFRleHRCYWNrZ3Jv
dW5kAA0NZWRpdFRleHRDb2xvcgANDWVkaXRUZXh0U3R5bGUACQllbGV2YXRpb24AJCRleHBhbmRB
Y3Rpdml0eU92ZXJmbG93QnV0dG9uRHJhd2FibGUAGBhmaXJzdEJhc2VsaW5lVG9Ub3BIZWlnaHQA
BARmb250AAoKZm9udEZhbWlseQAVFWZvbnRQcm92aWRlckF1dGhvcml0eQAREWZvbnRQcm92aWRl
ckNlcnRzABkZZm9udFByb3ZpZGVyRmV0Y2hTdHJhdGVneQAYGGZvbnRQcm92aWRlckZldGNoVGlt
ZW91dAATE2ZvbnRQcm92aWRlclBhY2thZ2UAERFmb250UHJvdmlkZXJRdWVyeQAcHGZvbnRQcm92
aWRlclN5c3RlbUZvbnRGYW1pbHkACQlmb250U3R5bGUAFRVmb250VmFyaWF0aW9uU2V0dGluZ3MA
Cgpmb250V2VpZ2h0AA4OZ2FwQmV0d2VlbkJhcnMABgZnb0ljb24ABgZoZWlnaHQAExNoaWRlT25D
b250ZW50U2Nyb2xsABERaG9tZUFzVXBJbmRpY2F0b3IACgpob21lTGF5b3V0AAQEaWNvbgAICGlj
b25UaW50AAwMaWNvblRpbnRNb2RlABISaWNvbmlmaWVkQnlEZWZhdWx0ABAQaW1hZ2VCdXR0b25T
dHlsZQAaGmluZGV0ZXJtaW5hdGVQcm9ncmVzc1N0eWxlABQUaW5pdGlhbEFjdGl2aXR5Q291bnQA
DAxpc0xpZ2h0VGhlbWUACwtpdGVtUGFkZGluZwAFBWxTdGFyABoabGFzdEJhc2VsaW5lVG9Cb3R0
b21IZWlnaHQABgZsYXlvdXQACgpsaW5lSGVpZ2h0AB0dbGlzdENob2ljZUJhY2tncm91bmRJbmRp
Y2F0b3IAIyNsaXN0Q2hvaWNlSW5kaWNhdG9yTXVsdGlwbGVBbmltYXRlZAAhIWxpc3RDaG9pY2VJ
bmRpY2F0b3JTaW5nbGVBbmltYXRlZAAWFmxpc3REaXZpZGVyQWxlcnREaWFsb2cADg5saXN0SXRl
bUxheW91dAAKCmxpc3RMYXlvdXQAERFsaXN0TWVudVZpZXdTdHlsZQAUFGxpc3RQb3B1cFdpbmRv
d1N0eWxlABcXbGlzdFByZWZlcnJlZEl0ZW1IZWlnaHQAHBxsaXN0UHJlZmVycmVkSXRlbUhlaWdo
dExhcmdlABwcbGlzdFByZWZlcnJlZEl0ZW1IZWlnaHRTbWFsbAAbG2xpc3RQcmVmZXJyZWRJdGVt
UGFkZGluZ0VuZAAcHGxpc3RQcmVmZXJyZWRJdGVtUGFkZGluZ0xlZnQAHR1saXN0UHJlZmVycmVk
SXRlbVBhZGRpbmdSaWdodAAdHWxpc3RQcmVmZXJyZWRJdGVtUGFkZGluZ1N0YXJ0AAQEbG9nbwAP
D2xvZ29EZXNjcmlwdGlvbgAPD21heEJ1dHRvbkhlaWdodAAXF21lYXN1cmVXaXRoTGFyZ2VzdENo
aWxkAAQEbWVudQAVFW11bHRpQ2hvaWNlSXRlbUxheW91dAAcHG5hdmlnYXRpb25Db250ZW50RGVz
Y3JpcHRpb24ADg5uYXZpZ2F0aW9uSWNvbgAODm5hdmlnYXRpb25Nb2RlABUVbmVzdGVkU2Nyb2xs
Vmlld1N0eWxlABAQbnVtZXJpY01vZGlmaWVycwANDW92ZXJsYXBBbmNob3IAFhZwYWRkaW5nQm90
dG9tTm9CdXR0b25zAAoKcGFkZGluZ0VuZAAMDHBhZGRpbmdTdGFydAAREXBhZGRpbmdUb3BOb1Rp
dGxlAA8PcGFuZWxCYWNrZ3JvdW5kABIScGFuZWxNZW51TGlzdFRoZW1lABIScGFuZWxNZW51TGlz
dFdpZHRoAA4OcG9wdXBNZW51U3R5bGUACgpwb3B1cFRoZW1lABAQcG9wdXBXaW5kb3dTdHlsZQAT
E3ByZXNlcnZlSWNvblNwYWNpbmcAEhJwcm9ncmVzc0JhclBhZGRpbmcAEBBwcm9ncmVzc0JhclN0
eWxlAA8PcXVlcnlCYWNrZ3JvdW5kAAkJcXVlcnlIaW50AA0NcXVlcnlQYXR0ZXJucwAQEHJhZGlv
QnV0dG9uU3R5bGUADg5yYXRpbmdCYXJTdHlsZQAXF3JhdGluZ0JhclN0eWxlSW5kaWNhdG9yABMT
cmF0aW5nQmFyU3R5bGVTbWFsbAAODnNlYXJjaEhpbnRJY29uAAoKc2VhcmNoSWNvbgAPD3NlYXJj
aFZpZXdTdHlsZQAMDHNlZWtCYXJTdHlsZQAYGHNlbGVjdGFibGVJdGVtQmFja2dyb3VuZAAiInNl
bGVjdGFibGVJdGVtQmFja2dyb3VuZEJvcmRlcmxlc3MAFRVzaG9ydGN1dE1hdGNoUmVxdWlyZWQA
DAxzaG93QXNBY3Rpb24ADAxzaG93RGl2aWRlcnMACAhzaG93VGV4dAAJCXNob3dUaXRsZQAWFnNp
bmdsZUNob2ljZUl0ZW1MYXlvdXQACAhzcGluQmFycwAYGHNwaW5uZXJEcm9wRG93bkl0ZW1TdHls
ZQAMDHNwaW5uZXJTdHlsZQAKCnNwbGl0VHJhY2sACQlzcmNDb21wYXQAEhJzdGF0ZV9hYm92ZV9h
bmNob3IADAxzdWJNZW51QXJyb3cAEBBzdWJtaXRCYWNrZ3JvdW5kAAgIc3VidGl0bGUAFhZzdWJ0
aXRsZVRleHRBcHBlYXJhbmNlABERc3VidGl0bGVUZXh0Q29sb3IAERFzdWJ0aXRsZVRleHRTdHls
ZQATE3N1Z2dlc3Rpb25Sb3dMYXlvdXQADg5zd2l0Y2hNaW5XaWR0aAANDXN3aXRjaFBhZGRpbmcA
Cwtzd2l0Y2hTdHlsZQAUFHN3aXRjaFRleHRBcHBlYXJhbmNlAAsLdGV4dEFsbENhcHMAHBx0ZXh0
QXBwZWFyYW5jZUxhcmdlUG9wdXBNZW51ABYWdGV4dEFwcGVhcmFuY2VMaXN0SXRlbQAfH3RleHRB
cHBlYXJhbmNlTGlzdEl0ZW1TZWNvbmRhcnkAGxt0ZXh0QXBwZWFyYW5jZUxpc3RJdGVtU21hbGwA
HR10ZXh0QXBwZWFyYW5jZVBvcHVwTWVudUhlYWRlcgAiInRleHRBcHBlYXJhbmNlU2VhcmNoUmVz
dWx0U3VidGl0bGUAHx90ZXh0QXBwZWFyYW5jZVNlYXJjaFJlc3VsdFRpdGxlABwcdGV4dEFwcGVh
cmFuY2VTbWFsbFBvcHVwTWVudQAcHHRleHRDb2xvckFsZXJ0RGlhbG9nTGlzdEl0ZW0AEhJ0ZXh0
Q29sb3JTZWFyY2hVcmwACgp0ZXh0TG9jYWxlAAUFdGhlbWUACQl0aGlja25lc3MAEBB0aHVtYlRl
eHRQYWRkaW5nAAkJdGh1bWJUaW50AA0NdGh1bWJUaW50TW9kZQAICHRpY2tNYXJrAAwMdGlja01h
cmtUaW50ABAQdGlja01hcmtUaW50TW9kZQAEBHRpbnQACAh0aW50TW9kZQAFBXRpdGxlAAsLdGl0
bGVNYXJnaW4AERF0aXRsZU1hcmdpbkJvdHRvbQAODnRpdGxlTWFyZ2luRW5kABAQdGl0bGVNYXJn
aW5TdGFydAAODnRpdGxlTWFyZ2luVG9wAAwMdGl0bGVNYXJnaW5zABMTdGl0bGVUZXh0QXBwZWFy
YW5jZQAODnRpdGxlVGV4dENvbG9yAA4OdGl0bGVUZXh0U3R5bGUAHBx0b29sYmFyTmF2aWdhdGlv
bkJ1dHRvblN0eWxlAAwMdG9vbGJhclN0eWxlABYWdG9vbHRpcEZvcmVncm91bmRDb2xvcgAWFnRv
b2x0aXBGcmFtZUJhY2tncm91bmQACwt0b29sdGlwVGV4dAAFBXRyYWNrAAkJdHJhY2tUaW50AA0N
dHJhY2tUaW50TW9kZQAICHR0Y0luZGV4ABERdmlld0luZmxhdGVyQ2xhc3MACQl2b2ljZUljb24A
Dw93aW5kb3dBY3Rpb25CYXIAFhZ3aW5kb3dBY3Rpb25CYXJPdmVybGF5ABcXd2luZG93QWN0aW9u
TW9kZU92ZXJsYXkAFhZ3aW5kb3dGaXhlZEhlaWdodE1ham9yABYWd2luZG93Rml4ZWRIZWlnaHRN
aW5vcgAVFXdpbmRvd0ZpeGVkV2lkdGhNYWpvcgAVFXdpbmRvd0ZpeGVkV2lkdGhNaW5vcgATE3dp
bmRvd01pbldpZHRoTWFqb3IAExN3aW5kb3dNaW5XaWR0aE1pbm9yAA0Nd2luZG93Tm9UaXRsZQAZ
GWFiY19hY3Rpb25fYmFyX2VtYmVkX3RhYnMAICBhYmNfY29uZmlnX2FjdGlvbk1lbnVJdGVtQWxs
Q2FwcwAwMGFiY19iYWNrZ3JvdW5kX2NhY2hlX2hpbnRfc2VsZWN0b3JfbWF0ZXJpYWxfZGFyawAx
MWFiY19iYWNrZ3JvdW5kX2NhY2hlX2hpbnRfc2VsZWN0b3JfbWF0ZXJpYWxfbGlnaHQAKChhYmNf
YnRuX2NvbG9yZWRfYm9yZGVybGVzc190ZXh0X21hdGVyaWFsAB0dYWJjX2J0bl9jb2xvcmVkX3Rl
eHRfbWF0ZXJpYWwAHBxhYmNfY29sb3JfaGlnaGxpZ2h0X21hdGVyaWFsABsbYWJjX2RlY29yX3Zp
ZXdfc3RhdHVzX2d1YXJkACEhYWJjX2RlY29yX3ZpZXdfc3RhdHVzX2d1YXJkX2xpZ2h0ACEhYWJj
X2hpbnRfZm9yZWdyb3VuZF9tYXRlcmlhbF9kYXJrACIiYWJjX2hpbnRfZm9yZWdyb3VuZF9tYXRl
cmlhbF9saWdodAArK2FiY19wcmltYXJ5X3RleHRfZGlzYWJsZV9vbmx5X21hdGVyaWFsX2RhcmsA
LCxhYmNfcHJpbWFyeV90ZXh0X2Rpc2FibGVfb25seV9tYXRlcmlhbF9saWdodAAeHmFiY19wcmlt
YXJ5X3RleHRfbWF0ZXJpYWxfZGFyawAfH2FiY19wcmltYXJ5X3RleHRfbWF0ZXJpYWxfbGlnaHQA
ExNhYmNfc2VhcmNoX3VybF90ZXh0ABoaYWJjX3NlYXJjaF91cmxfdGV4dF9ub3JtYWwAGxthYmNf
c2VhcmNoX3VybF90ZXh0X3ByZXNzZWQAHBxhYmNfc2VhcmNoX3VybF90ZXh0X3NlbGVjdGVkACAg
YWJjX3NlY29uZGFyeV90ZXh0X21hdGVyaWFsX2RhcmsAISFhYmNfc2Vjb25kYXJ5X3RleHRfbWF0
ZXJpYWxfbGlnaHQAFhZhYmNfdGludF9idG5fY2hlY2thYmxlABAQYWJjX3RpbnRfZGVmYXVsdAAR
EWFiY190aW50X2VkaXR0ZXh0ABMTYWJjX3RpbnRfc2Vla190aHVtYgAQEGFiY190aW50X3NwaW5u
ZXIAFRVhYmNfdGludF9zd2l0Y2hfdHJhY2sAFBRhY2NlbnRfbWF0ZXJpYWxfZGFyawAVFWFjY2Vu
dF9tYXRlcmlhbF9saWdodAAjI2FuZHJvaWR4X2NvcmVfcmlwcGxlX21hdGVyaWFsX2xpZ2h0ADMz
YW5kcm9pZHhfY29yZV9zZWNvbmRhcnlfdGV4dF9kZWZhdWx0X21hdGVyaWFsX2xpZ2h0ACEhYmFj
a2dyb3VuZF9mbG9hdGluZ19tYXRlcmlhbF9kYXJrACIiYmFja2dyb3VuZF9mbG9hdGluZ19tYXRl
cmlhbF9saWdodAAYGGJhY2tncm91bmRfbWF0ZXJpYWxfZGFyawAZGWJhY2tncm91bmRfbWF0ZXJp
YWxfbGlnaHQABQVibGFjawAoKGJyaWdodF9mb3JlZ3JvdW5kX2Rpc2FibGVkX21hdGVyaWFsX2Rh
cmsAKSlicmlnaHRfZm9yZWdyb3VuZF9kaXNhYmxlZF9tYXRlcmlhbF9saWdodAAnJ2JyaWdodF9m
b3JlZ3JvdW5kX2ludmVyc2VfbWF0ZXJpYWxfZGFyawAoKGJyaWdodF9mb3JlZ3JvdW5kX2ludmVy
c2VfbWF0ZXJpYWxfbGlnaHQAHx9icmlnaHRfZm9yZWdyb3VuZF9tYXRlcmlhbF9kYXJrACAgYnJp
Z2h0X2ZvcmVncm91bmRfbWF0ZXJpYWxfbGlnaHQAFBRidXR0b25fbWF0ZXJpYWxfZGFyawAVFWJ1
dHRvbl9tYXRlcmlhbF9saWdodAAeHmNhbGxfbm90aWZpY2F0aW9uX2Fuc3dlcl9jb2xvcgAfH2Nh
bGxfbm90aWZpY2F0aW9uX2RlY2xpbmVfY29sb3IAJSVkaW1fZm9yZWdyb3VuZF9kaXNhYmxlZF9t
YXRlcmlhbF9kYXJrACYmZGltX2ZvcmVncm91bmRfZGlzYWJsZWRfbWF0ZXJpYWxfbGlnaHQAHBxk
aW1fZm9yZWdyb3VuZF9tYXRlcmlhbF9kYXJrAB0dZGltX2ZvcmVncm91bmRfbWF0ZXJpYWxfbGln
aHQAGRllcnJvcl9jb2xvcl9tYXRlcmlhbF9kYXJrABoaZXJyb3JfY29sb3JfbWF0ZXJpYWxfbGln
aHQAGBhmb3JlZ3JvdW5kX21hdGVyaWFsX2RhcmsAGRlmb3JlZ3JvdW5kX21hdGVyaWFsX2xpZ2h0
AB4eaGlnaGxpZ2h0ZWRfdGV4dF9tYXRlcmlhbF9kYXJrAB8faGlnaGxpZ2h0ZWRfdGV4dF9tYXRl
cmlhbF9saWdodAAWFm1hdGVyaWFsX2JsdWVfZ3JleV84MDAAFhZtYXRlcmlhbF9ibHVlX2dyZXlf
OTAwABYWbWF0ZXJpYWxfYmx1ZV9ncmV5Xzk1MAAWFm1hdGVyaWFsX2RlZXBfdGVhbF8yMDAAFhZt
YXRlcmlhbF9kZWVwX3RlYWxfNTAwABERbWF0ZXJpYWxfZ3JleV8xMDAAERFtYXRlcmlhbF9ncmV5
XzMwMAAQEG1hdGVyaWFsX2dyZXlfNTAAERFtYXRlcmlhbF9ncmV5XzYwMAAREW1hdGVyaWFsX2dy
ZXlfODAwABERbWF0ZXJpYWxfZ3JleV84NTAAERFtYXRlcmlhbF9ncmV5XzkwMAAgIG5vdGlmaWNh
dGlvbl9hY3Rpb25fY29sb3JfZmlsdGVyABoabm90aWZpY2F0aW9uX2ljb25fYmdfY29sb3IAGhpw
cmltYXJ5X2RhcmtfbWF0ZXJpYWxfZGFyawAbG3ByaW1hcnlfZGFya19tYXRlcmlhbF9saWdodAAV
FXByaW1hcnlfbWF0ZXJpYWxfZGFyawAWFnByaW1hcnlfbWF0ZXJpYWxfbGlnaHQAIiJwcmltYXJ5
X3RleHRfZGVmYXVsdF9tYXRlcmlhbF9kYXJrACMjcHJpbWFyeV90ZXh0X2RlZmF1bHRfbWF0ZXJp
YWxfbGlnaHQAIyNwcmltYXJ5X3RleHRfZGlzYWJsZWRfbWF0ZXJpYWxfZGFyawAkJHByaW1hcnlf
dGV4dF9kaXNhYmxlZF9tYXRlcmlhbF9saWdodAAKCnB1cnBsZV8yMDAACgpwdXJwbGVfNTAwAAoK
cHVycGxlXzcwMAAUFHJpcHBsZV9tYXRlcmlhbF9kYXJrABUVcmlwcGxlX21hdGVyaWFsX2xpZ2h0
ACQkc2Vjb25kYXJ5X3RleHRfZGVmYXVsdF9tYXRlcmlhbF9kYXJrACUlc2Vjb25kYXJ5X3RleHRf
ZGVmYXVsdF9tYXRlcmlhbF9saWdodAAlJXNlY29uZGFyeV90ZXh0X2Rpc2FibGVkX21hdGVyaWFs
X2RhcmsAJiZzZWNvbmRhcnlfdGV4dF9kaXNhYmxlZF9tYXRlcmlhbF9saWdodAAjI3N3aXRjaF90
aHVtYl9kaXNhYmxlZF9tYXRlcmlhbF9kYXJrACQkc3dpdGNoX3RodW1iX2Rpc2FibGVkX21hdGVy
aWFsX2xpZ2h0ABoac3dpdGNoX3RodW1iX21hdGVyaWFsX2RhcmsAGxtzd2l0Y2hfdGh1bWJfbWF0
ZXJpYWxfbGlnaHQAISFzd2l0Y2hfdGh1bWJfbm9ybWFsX21hdGVyaWFsX2RhcmsAIiJzd2l0Y2hf
dGh1bWJfbm9ybWFsX21hdGVyaWFsX2xpZ2h0AAgIdGVhbF8yMDAACAh0ZWFsXzcwMAAXF3Rvb2x0
aXBfYmFja2dyb3VuZF9kYXJrABgYdG9vbHRpcF9iYWNrZ3JvdW5kX2xpZ2h0ABERdmVjdG9yX3Rp
bnRfY29sb3IAFxd2ZWN0b3JfdGludF90aGVtZV9jb2xvcgAFBXdoaXRlACUlYWJjX2FjdGlvbl9i
YXJfY29udGVudF9pbnNldF9tYXRlcmlhbAAlJWFiY19hY3Rpb25fYmFyX2NvbnRlbnRfaW5zZXRf
d2l0aF9uYXYAJiZhYmNfYWN0aW9uX2Jhcl9kZWZhdWx0X2hlaWdodF9tYXRlcmlhbAArK2FiY19h
Y3Rpb25fYmFyX2RlZmF1bHRfcGFkZGluZ19lbmRfbWF0ZXJpYWwALS1hYmNfYWN0aW9uX2Jhcl9k
ZWZhdWx0X3BhZGRpbmdfc3RhcnRfbWF0ZXJpYWwAISFhYmNfYWN0aW9uX2Jhcl9lbGV2YXRpb25f
bWF0ZXJpYWwALS1hYmNfYWN0aW9uX2Jhcl9pY29uX3ZlcnRpY2FsX3BhZGRpbmdfbWF0ZXJpYWwA
LCxhYmNfYWN0aW9uX2Jhcl9vdmVyZmxvd19wYWRkaW5nX2VuZF9tYXRlcmlhbAAuLmFiY19hY3Rp
b25fYmFyX292ZXJmbG93X3BhZGRpbmdfc3RhcnRfbWF0ZXJpYWwAISFhYmNfYWN0aW9uX2Jhcl9z
dGFja2VkX21heF9oZWlnaHQAJCRhYmNfYWN0aW9uX2Jhcl9zdGFja2VkX3RhYl9tYXhfd2lkdGgA
Li5hYmNfYWN0aW9uX2Jhcl9zdWJ0aXRsZV9ib3R0b21fbWFyZ2luX21hdGVyaWFsACsrYWJjX2Fj
dGlvbl9iYXJfc3VidGl0bGVfdG9wX21hcmdpbl9tYXRlcmlhbAAlJWFiY19hY3Rpb25fYnV0dG9u
X21pbl9oZWlnaHRfbWF0ZXJpYWwAJCRhYmNfYWN0aW9uX2J1dHRvbl9taW5fd2lkdGhfbWF0ZXJp
YWwALS1hYmNfYWN0aW9uX2J1dHRvbl9taW5fd2lkdGhfb3ZlcmZsb3dfbWF0ZXJpYWwAIiJhYmNf
YWxlcnRfZGlhbG9nX2J1dHRvbl9iYXJfaGVpZ2h0AB0dYWJjX2FsZXJ0X2RpYWxvZ19idXR0b25f
ZGltZW4AJCRhYmNfYnV0dG9uX2luc2V0X2hvcml6b250YWxfbWF0ZXJpYWwAIiJhYmNfYnV0dG9u
X2luc2V0X3ZlcnRpY2FsX21hdGVyaWFsACYmYWJjX2J1dHRvbl9wYWRkaW5nX2hvcml6b250YWxf
bWF0ZXJpYWwAJCRhYmNfYnV0dG9uX3BhZGRpbmdfdmVydGljYWxfbWF0ZXJpYWwAJiZhYmNfY2Fz
Y2FkaW5nX21lbnVzX21pbl9zbWFsbGVzdF93aWR0aAAaGmFiY19jb25maWdfcHJlZkRpYWxvZ1dp
ZHRoABsbYWJjX2NvbnRyb2xfY29ybmVyX21hdGVyaWFsABoaYWJjX2NvbnRyb2xfaW5zZXRfbWF0
ZXJpYWwAHBxhYmNfY29udHJvbF9wYWRkaW5nX21hdGVyaWFsACEhYWJjX2RpYWxvZ19jb3JuZXJf
cmFkaXVzX21hdGVyaWFsAB0dYWJjX2RpYWxvZ19maXhlZF9oZWlnaHRfbWFqb3IAHR1hYmNfZGlh
bG9nX2ZpeGVkX2hlaWdodF9taW5vcgAcHGFiY19kaWFsb2dfZml4ZWRfd2lkdGhfbWFqb3IAHBxh
YmNfZGlhbG9nX2ZpeGVkX3dpZHRoX21pbm9yACkpYWJjX2RpYWxvZ19saXN0X3BhZGRpbmdfYm90
dG9tX25vX2J1dHRvbnMAJCRhYmNfZGlhbG9nX2xpc3RfcGFkZGluZ190b3Bfbm9fdGl0bGUAGhph
YmNfZGlhbG9nX21pbl93aWR0aF9tYWpvcgAaGmFiY19kaWFsb2dfbWluX3dpZHRoX21pbm9yABsb
YWJjX2RpYWxvZ19wYWRkaW5nX21hdGVyaWFsAB8fYWJjX2RpYWxvZ19wYWRkaW5nX3RvcF9tYXRl
cmlhbAAhIWFiY19kaWFsb2dfdGl0bGVfZGl2aWRlcl9tYXRlcmlhbAAgIGFiY19kaXNhYmxlZF9h
bHBoYV9tYXRlcmlhbF9kYXJrACEhYWJjX2Rpc2FibGVkX2FscGhhX21hdGVyaWFsX2xpZ2h0ABsb
YWJjX2Ryb3Bkb3duaXRlbV9pY29uX3dpZHRoACIiYWJjX2Ryb3Bkb3duaXRlbV90ZXh0X3BhZGRp
bmdfbGVmdAAjI2FiY19kcm9wZG93bml0ZW1fdGV4dF9wYWRkaW5nX3JpZ2h0ACMjYWJjX2VkaXRf
dGV4dF9pbnNldF9ib3R0b21fbWF0ZXJpYWwAJydhYmNfZWRpdF90ZXh0X2luc2V0X2hvcml6b250
YWxfbWF0ZXJpYWwAICBhYmNfZWRpdF90ZXh0X2luc2V0X3RvcF9tYXRlcmlhbAAVFWFiY19mbG9h
dGluZ193aW5kb3dfegAjI2FiY19saXN0X2l0ZW1faGVpZ2h0X2xhcmdlX21hdGVyaWFsAB0dYWJj
X2xpc3RfaXRlbV9oZWlnaHRfbWF0ZXJpYWwAIyNhYmNfbGlzdF9pdGVtX2hlaWdodF9zbWFsbF9t
YXRlcmlhbAApKWFiY19saXN0X2l0ZW1fcGFkZGluZ19ob3Jpem9udGFsX21hdGVyaWFsABkZYWJj
X3BhbmVsX21lbnVfbGlzdF93aWR0aAAgIGFiY19wcm9ncmVzc19iYXJfaGVpZ2h0X21hdGVyaWFs
ACAgYWJjX3NlYXJjaF92aWV3X3ByZWZlcnJlZF9oZWlnaHQAHx9hYmNfc2VhcmNoX3ZpZXdfcHJl
ZmVycmVkX3dpZHRoACwsYWJjX3NlZWtiYXJfdHJhY2tfYmFja2dyb3VuZF9oZWlnaHRfbWF0ZXJp
YWwAKiphYmNfc2Vla2Jhcl90cmFja19wcm9ncmVzc19oZWlnaHRfbWF0ZXJpYWwAKChhYmNfc2Vs
ZWN0X2RpYWxvZ19wYWRkaW5nX3N0YXJ0X21hdGVyaWFsAAwMYWJjX3N0YXJfYmlnAA8PYWJjX3N0
YXJfbWVkaXVtAA4OYWJjX3N0YXJfc21hbGwAEhJhYmNfc3dpdGNoX3BhZGRpbmcAHR1hYmNfdGV4
dF9zaXplX2JvZHlfMV9tYXRlcmlhbAAdHWFiY190ZXh0X3NpemVfYm9keV8yX21hdGVyaWFsAB0d
YWJjX3RleHRfc2l6ZV9idXR0b25fbWF0ZXJpYWwAHh5hYmNfdGV4dF9zaXplX2NhcHRpb25fbWF0
ZXJpYWwAICBhYmNfdGV4dF9zaXplX2Rpc3BsYXlfMV9tYXRlcmlhbAAgIGFiY190ZXh0X3NpemVf
ZGlzcGxheV8yX21hdGVyaWFsACAgYWJjX3RleHRfc2l6ZV9kaXNwbGF5XzNfbWF0ZXJpYWwAICBh
YmNfdGV4dF9zaXplX2Rpc3BsYXlfNF9tYXRlcmlhbAAfH2FiY190ZXh0X3NpemVfaGVhZGxpbmVf
bWF0ZXJpYWwAHBxhYmNfdGV4dF9zaXplX2xhcmdlX21hdGVyaWFsAB0dYWJjX3RleHRfc2l6ZV9t
ZWRpdW1fbWF0ZXJpYWwAIiJhYmNfdGV4dF9zaXplX21lbnVfaGVhZGVyX21hdGVyaWFsABsbYWJj
X3RleHRfc2l6ZV9tZW51X21hdGVyaWFsABwcYWJjX3RleHRfc2l6ZV9zbWFsbF9tYXRlcmlhbAAe
HmFiY190ZXh0X3NpemVfc3ViaGVhZF9tYXRlcmlhbAAnJ2FiY190ZXh0X3NpemVfc3VidGl0bGVf
bWF0ZXJpYWxfdG9vbGJhcgAcHGFiY190ZXh0X3NpemVfdGl0bGVfbWF0ZXJpYWwAJCRhYmNfdGV4
dF9zaXplX3RpdGxlX21hdGVyaWFsX3Rvb2xiYXIAJydjb21wYXRfYnV0dG9uX2luc2V0X2hvcml6
b250YWxfbWF0ZXJpYWwAJSVjb21wYXRfYnV0dG9uX2luc2V0X3ZlcnRpY2FsX21hdGVyaWFsACkp
Y29tcGF0X2J1dHRvbl9wYWRkaW5nX2hvcml6b250YWxfbWF0ZXJpYWwAJydjb21wYXRfYnV0dG9u
X3BhZGRpbmdfdmVydGljYWxfbWF0ZXJpYWwAHh5jb21wYXRfY29udHJvbF9jb3JuZXJfbWF0ZXJp
YWwAKSljb21wYXRfbm90aWZpY2F0aW9uX2xhcmdlX2ljb25fbWF4X2hlaWdodAAoKGNvbXBhdF9u
b3RpZmljYXRpb25fbGFyZ2VfaWNvbl9tYXhfd2lkdGgAHBxkaXNhYmxlZF9hbHBoYV9tYXRlcmlh
bF9kYXJrAB0dZGlzYWJsZWRfYWxwaGFfbWF0ZXJpYWxfbGlnaHQAICBoaWdobGlnaHRfYWxwaGFf
bWF0ZXJpYWxfY29sb3JlZAAdHWhpZ2hsaWdodF9hbHBoYV9tYXRlcmlhbF9kYXJrAB4eaGlnaGxp
Z2h0X2FscGhhX21hdGVyaWFsX2xpZ2h0ABgYaGludF9hbHBoYV9tYXRlcmlhbF9kYXJrABkZaGlu
dF9hbHBoYV9tYXRlcmlhbF9saWdodAAgIGhpbnRfcHJlc3NlZF9hbHBoYV9tYXRlcmlhbF9kYXJr
ACEhaGludF9wcmVzc2VkX2FscGhhX21hdGVyaWFsX2xpZ2h0AB0dbm90aWZpY2F0aW9uX2FjdGlv
bl9pY29uX3NpemUAHR1ub3RpZmljYXRpb25fYWN0aW9uX3RleHRfc2l6ZQAeHm5vdGlmaWNhdGlv
bl9iaWdfY2lyY2xlX21hcmdpbgAhIW5vdGlmaWNhdGlvbl9jb250ZW50X21hcmdpbl9zdGFydAAe
Hm5vdGlmaWNhdGlvbl9sYXJnZV9pY29uX2hlaWdodAAdHW5vdGlmaWNhdGlvbl9sYXJnZV9pY29u
X3dpZHRoACQkbm90aWZpY2F0aW9uX21haW5fY29sdW1uX3BhZGRpbmdfdG9wACAgbm90aWZpY2F0
aW9uX21lZGlhX25hcnJvd19tYXJnaW4AHBxub3RpZmljYXRpb25fcmlnaHRfaWNvbl9zaXplACMj
bm90aWZpY2F0aW9uX3JpZ2h0X3NpZGVfcGFkZGluZ190b3AAKipub3RpZmljYXRpb25fc21hbGxf
aWNvbl9iYWNrZ3JvdW5kX3BhZGRpbmcAJSVub3RpZmljYXRpb25fc21hbGxfaWNvbl9zaXplX2Fz
X2xhcmdlABkZbm90aWZpY2F0aW9uX3N1YnRleHRfc2l6ZQAUFG5vdGlmaWNhdGlvbl90b3BfcGFk
AB8fbm90aWZpY2F0aW9uX3RvcF9wYWRfbGFyZ2VfdGV4dAAVFXRvb2x0aXBfY29ybmVyX3JhZGl1
cwAaGnRvb2x0aXBfaG9yaXpvbnRhbF9wYWRkaW5nAA4OdG9vbHRpcF9tYXJnaW4AIyN0b29sdGlw
X3ByZWNpc2VfYW5jaG9yX2V4dHJhX29mZnNldAAgIHRvb2x0aXBfcHJlY2lzZV9hbmNob3JfdGhy
ZXNob2xkABgYdG9vbHRpcF92ZXJ0aWNhbF9wYWRkaW5nABoadG9vbHRpcF95X29mZnNldF9ub25f
dG91Y2gAFhZ0b29sdGlwX3lfb2Zmc2V0X3RvdWNoABoaJGljX2xhdW5jaGVyX2ZvcmVncm91bmRf
XzAAHBxhYmNfYWJfc2hhcmVfcGFja19tdHJsX2FscGhhACcnYWJjX2FjdGlvbl9iYXJfaXRlbV9i
YWNrZ3JvdW5kX21hdGVyaWFsABsbYWJjX2J0bl9ib3JkZXJsZXNzX21hdGVyaWFsABYWYWJjX2J0
bl9jaGVja19tYXRlcmlhbAAbG2FiY19idG5fY2hlY2tfbWF0ZXJpYWxfYW5pbQAcHGFiY19idG5f
Y2hlY2tfdG9fb25fbXRybF8wMDAAHBxhYmNfYnRuX2NoZWNrX3RvX29uX210cmxfMDE1ABgYYWJj
X2J0bl9jb2xvcmVkX21hdGVyaWFsABoaYWJjX2J0bl9kZWZhdWx0X210cmxfc2hhcGUAFhZhYmNf
YnRuX3JhZGlvX21hdGVyaWFsABsbYWJjX2J0bl9yYWRpb19tYXRlcmlhbF9hbmltABwcYWJjX2J0
bl9yYWRpb190b19vbl9tdHJsXzAwMAAcHGFiY19idG5fcmFkaW9fdG9fb25fbXRybF8wMTUAHx9h
YmNfYnRuX3N3aXRjaF90b19vbl9tdHJsXzAwMDAxAB8fYWJjX2J0bl9zd2l0Y2hfdG9fb25fbXRy
bF8wMDAxMgAeHmFiY19jYWJfYmFja2dyb3VuZF9pbnRlcm5hbF9iZwAfH2FiY19jYWJfYmFja2dy
b3VuZF90b3BfbWF0ZXJpYWwAISFhYmNfY2FiX2JhY2tncm91bmRfdG9wX210cmxfYWxwaGEAHx9h
YmNfY29udHJvbF9iYWNrZ3JvdW5kX21hdGVyaWFsAB4eYWJjX2RpYWxvZ19tYXRlcmlhbF9iYWNr
Z3JvdW5kABYWYWJjX2VkaXRfdGV4dF9tYXRlcmlhbAAXF2FiY19pY19hYl9iYWNrX21hdGVyaWFs
ACIiYWJjX2ljX2Fycm93X2Ryb3BfcmlnaHRfYmxhY2tfMjRkcAAVFWFiY19pY19jbGVhcl9tYXRl
cmlhbAAjI2FiY19pY19jb21taXRfc2VhcmNoX2FwaV9tdHJsX2FscGhhAB0dYWJjX2ljX2dvX3Nl
YXJjaF9hcGlfbWF0ZXJpYWwAHh5hYmNfaWNfbWVudV9jb3B5X210cmxfYW1fYWxwaGEAGhphYmNf
aWNfbWVudV9jdXRfbXRybF9hbHBoYQAdHWFiY19pY19tZW51X292ZXJmbG93X21hdGVyaWFsAB8f
YWJjX2ljX21lbnVfcGFzdGVfbXRybF9hbV9hbHBoYQAgIGFiY19pY19tZW51X3NlbGVjdGFsbF9t
dHJsX2FscGhhABwcYWJjX2ljX21lbnVfc2hhcmVfbXRybF9hbHBoYQAaGmFiY19pY19zZWFyY2hf
YXBpX21hdGVyaWFsACAgYWJjX2ljX3ZvaWNlX3NlYXJjaF9hcGlfbWF0ZXJpYWwAHR1hYmNfaXRl
bV9iYWNrZ3JvdW5kX2hvbG9fZGFyawAeHmFiY19pdGVtX2JhY2tncm91bmRfaG9sb19saWdodAAZ
GWFiY19saXN0X2RpdmlkZXJfbWF0ZXJpYWwAGxthYmNfbGlzdF9kaXZpZGVyX210cmxfYWxwaGEA
FRVhYmNfbGlzdF9mb2N1c2VkX2hvbG8AGRlhYmNfbGlzdF9sb25ncHJlc3NlZF9ob2xvABoaYWJj
X2xpc3RfcHJlc3NlZF9ob2xvX2RhcmsAGxthYmNfbGlzdF9wcmVzc2VkX2hvbG9fbGlnaHQAMTFh
YmNfbGlzdF9zZWxlY3Rvcl9iYWNrZ3JvdW5kX3RyYW5zaXRpb25faG9sb19kYXJrADIyYWJjX2xp
c3Rfc2VsZWN0b3JfYmFja2dyb3VuZF90cmFuc2l0aW9uX2hvbG9fbGlnaHQAJCRhYmNfbGlzdF9z
ZWxlY3Rvcl9kaXNhYmxlZF9ob2xvX2RhcmsAJSVhYmNfbGlzdF9zZWxlY3Rvcl9kaXNhYmxlZF9o
b2xvX2xpZ2h0ABsbYWJjX2xpc3Rfc2VsZWN0b3JfaG9sb19kYXJrABwcYWJjX2xpc3Rfc2VsZWN0
b3JfaG9sb19saWdodAAgIGFiY19tZW51X2hhcmRrZXlfcGFuZWxfbXRybF9tdWx0AB4eYWJjX3Bv
cHVwX2JhY2tncm91bmRfbXRybF9tdWx0ACAgYWJjX3JhdGluZ2Jhcl9pbmRpY2F0b3JfbWF0ZXJp
YWwAFhZhYmNfcmF0aW5nYmFyX21hdGVyaWFsABwcYWJjX3JhdGluZ2Jhcl9zbWFsbF9tYXRlcmlh
bAAjI2FiY19zY3J1YmJlcl9jb250cm9sX29mZl9tdHJsX2FscGhhACgoYWJjX3NjcnViYmVyX2Nv
bnRyb2xfdG9fcHJlc3NlZF9tdHJsXzAwMAAoKGFiY19zY3J1YmJlcl9jb250cm9sX3RvX3ByZXNz
ZWRfbXRybF8wMDUAHx9hYmNfc2NydWJiZXJfcHJpbWFyeV9tdHJsX2FscGhhAB0dYWJjX3NjcnVi
YmVyX3RyYWNrX210cmxfYWxwaGEAGhphYmNfc2Vla2Jhcl90aHVtYl9tYXRlcmlhbAAeHmFiY19z
ZWVrYmFyX3RpY2tfbWFya19tYXRlcmlhbAAaGmFiY19zZWVrYmFyX3RyYWNrX21hdGVyaWFsABkZ
YWJjX3NwaW5uZXJfbXRybF9hbV9hbHBoYQApKWFiY19zcGlubmVyX3RleHRmaWVsZF9iYWNrZ3Jv
dW5kX21hdGVyaWFsABMTYWJjX3N0YXJfYmxhY2tfNDhkcAAYGGFiY19zdGFyX2hhbGZfYmxhY2tf
NDhkcAAZGWFiY19zd2l0Y2hfdGh1bWJfbWF0ZXJpYWwAGxthYmNfc3dpdGNoX3RyYWNrX210cmxf
YWxwaGEAGhphYmNfdGFiX2luZGljYXRvcl9tYXRlcmlhbAAcHGFiY190YWJfaW5kaWNhdG9yX210
cmxfYWxwaGEAGBhhYmNfdGV4dF9jdXJzb3JfbWF0ZXJpYWwAICBhYmNfdGV4dF9zZWxlY3RfaGFu
ZGxlX2xlZnRfbXRybAAiImFiY190ZXh0X3NlbGVjdF9oYW5kbGVfbWlkZGxlX210cmwAISFhYmNf
dGV4dF9zZWxlY3RfaGFuZGxlX3JpZ2h0X210cmwAIiJhYmNfdGV4dGZpZWxkX2FjdGl2YXRlZF9t
dHJsX2FscGhhACAgYWJjX3RleHRmaWVsZF9kZWZhdWx0X210cmxfYWxwaGEAKSlhYmNfdGV4dGZp
ZWxkX3NlYXJjaF9hY3RpdmF0ZWRfbXRybF9hbHBoYQAnJ2FiY190ZXh0ZmllbGRfc2VhcmNoX2Rl
ZmF1bHRfbXRybF9hbHBoYQAdHWFiY190ZXh0ZmllbGRfc2VhcmNoX21hdGVyaWFsAA8PYWJjX3Zl
Y3Rvcl90ZXN0ABkZYnRuX2NoZWNrYm94X2NoZWNrZWRfbXRybAAwMGJ0bl9jaGVja2JveF9jaGVj
a2VkX3RvX3VuY2hlY2tlZF9tdHJsX2FuaW1hdGlvbgAbG2J0bl9jaGVja2JveF91bmNoZWNrZWRf
bXRybAAwMGJ0bl9jaGVja2JveF91bmNoZWNrZWRfdG9fY2hlY2tlZF9tdHJsX2FuaW1hdGlvbgAS
EmJ0bl9yYWRpb19vZmZfbXRybAAiImJ0bl9yYWRpb19vZmZfdG9fb25fbXRybF9hbmltYXRpb24A
ERFidG5fcmFkaW9fb25fbXRybAAiImJ0bl9yYWRpb19vbl90b19vZmZfbXRybF9hbmltYXRpb24A
Dg5pY19jYWxsX2Fuc3dlcgASEmljX2NhbGxfYW5zd2VyX2xvdwAUFGljX2NhbGxfYW5zd2VyX3Zp
ZGVvABgYaWNfY2FsbF9hbnN3ZXJfdmlkZW9fbG93AA8PaWNfY2FsbF9kZWNsaW5lABMTaWNfY2Fs
bF9kZWNsaW5lX2xvdwAWFmljX2xhdW5jaGVyX2JhY2tncm91bmQAFhZpY19sYXVuY2hlcl9mb3Jl
Z3JvdW5kAB4ebm90aWZpY2F0aW9uX2FjdGlvbl9iYWNrZ3JvdW5kAA8Pbm90aWZpY2F0aW9uX2Jn
ABMTbm90aWZpY2F0aW9uX2JnX2xvdwAaGm5vdGlmaWNhdGlvbl9iZ19sb3dfbm9ybWFsABsbbm90
aWZpY2F0aW9uX2JnX2xvd19wcmVzc2VkABYWbm90aWZpY2F0aW9uX2JnX25vcm1hbAAeHm5vdGlm
aWNhdGlvbl9iZ19ub3JtYWxfcHJlc3NlZAAcHG5vdGlmaWNhdGlvbl9pY29uX2JhY2tncm91bmQA
HR1ub3RpZmljYXRpb25fdGVtcGxhdGVfaWNvbl9iZwAhIW5vdGlmaWNhdGlvbl90ZW1wbGF0ZV9p
Y29uX2xvd19iZwAUFG5vdGlmaWNhdGlvbl90aWxlX2JnACEhbm90aWZ5X3BhbmVsX25vdGlmaWNh
dGlvbl9pY29uX2JnABISdG9vbHRpcF9mcmFtZV9kYXJrABMTdG9vbHRpcF9mcmFtZV9saWdodAAD
A0FMVAAEBENUUkwACAhGVU5DVElPTgAEBE1FVEEABQVTSElGVAADA1NZTQAjI2FjY2Vzc2liaWxp
dHlfYWN0aW9uX2NsaWNrYWJsZV9zcGFuAB0dYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9uXzAA
HR1hY2Nlc3NpYmlsaXR5X2N1c3RvbV9hY3Rpb25fMQAeHmFjY2Vzc2liaWxpdHlfY3VzdG9tX2Fj
dGlvbl8xMAAeHmFjY2Vzc2liaWxpdHlfY3VzdG9tX2FjdGlvbl8xMQAeHmFjY2Vzc2liaWxpdHlf
Y3VzdG9tX2FjdGlvbl8xMgAeHmFjY2Vzc2liaWxpdHlfY3VzdG9tX2FjdGlvbl8xMwAeHmFjY2Vz
c2liaWxpdHlfY3VzdG9tX2FjdGlvbl8xNAAeHmFjY2Vzc2liaWxpdHlfY3VzdG9tX2FjdGlvbl8x
NQAeHmFjY2Vzc2liaWxpdHlfY3VzdG9tX2FjdGlvbl8xNgAeHmFjY2Vzc2liaWxpdHlfY3VzdG9t
X2FjdGlvbl8xNwAeHmFjY2Vzc2liaWxpdHlfY3VzdG9tX2FjdGlvbl8xOAAeHmFjY2Vzc2liaWxp
dHlfY3VzdG9tX2FjdGlvbl8xOQAdHWFjY2Vzc2liaWxpdHlfY3VzdG9tX2FjdGlvbl8yAB4eYWNj
ZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9uXzIwAB4eYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9u
XzIxAB4eYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9uXzIyAB4eYWNjZXNzaWJpbGl0eV9jdXN0
b21fYWN0aW9uXzIzAB4eYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9uXzI0AB4eYWNjZXNzaWJp
bGl0eV9jdXN0b21fYWN0aW9uXzI1AB4eYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9uXzI2AB4e
YWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9uXzI3AB4eYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0
aW9uXzI4AB4eYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9uXzI5AB0dYWNjZXNzaWJpbGl0eV9j
dXN0b21fYWN0aW9uXzMAHh5hY2Nlc3NpYmlsaXR5X2N1c3RvbV9hY3Rpb25fMzAAHh5hY2Nlc3Np
YmlsaXR5X2N1c3RvbV9hY3Rpb25fMzEAHR1hY2Nlc3NpYmlsaXR5X2N1c3RvbV9hY3Rpb25fNAAd
HWFjY2Vzc2liaWxpdHlfY3VzdG9tX2FjdGlvbl81AB0dYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0
aW9uXzYAHR1hY2Nlc3NpYmlsaXR5X2N1c3RvbV9hY3Rpb25fNwAdHWFjY2Vzc2liaWxpdHlfY3Vz
dG9tX2FjdGlvbl84AB0dYWNjZXNzaWJpbGl0eV9jdXN0b21fYWN0aW9uXzkACgphY3Rpb25fYmFy
ABsbYWN0aW9uX2Jhcl9hY3Rpdml0eV9jb250ZW50ABQUYWN0aW9uX2Jhcl9jb250YWluZXIADw9h
Y3Rpb25fYmFyX3Jvb3QAEhJhY3Rpb25fYmFyX3NwaW5uZXIAExNhY3Rpb25fYmFyX3N1YnRpdGxl
ABAQYWN0aW9uX2Jhcl90aXRsZQAQEGFjdGlvbl9jb250YWluZXIAEhJhY3Rpb25fY29udGV4dF9i
YXIADg5hY3Rpb25fZGl2aWRlcgAMDGFjdGlvbl9pbWFnZQATE2FjdGlvbl9tZW51X2RpdmlkZXIA
FRVhY3Rpb25fbWVudV9wcmVzZW50ZXIADw9hY3Rpb25fbW9kZV9iYXIAFBRhY3Rpb25fbW9kZV9i
YXJfc3R1YgAYGGFjdGlvbl9tb2RlX2Nsb3NlX2J1dHRvbgALC2FjdGlvbl90ZXh0AAcHYWN0aW9u
cwAdHWFjdGl2aXR5X2Nob29zZXJfdmlld19jb250ZW50AAMDYWRkAAoKYWxlcnRUaXRsZQAGBmFs
d2F5cwAsLGFuZHJvaWR4X2NvbXBvc2VfdWlfdmlld19jb21wb3NpdGlvbl9jb250ZXh0AAUFYXN5
bmMACQliZWdpbm5pbmcACAhibG9ja2luZwAGBmJvdHRvbQALC2J1dHRvblBhbmVsAAoKYnV0dG9u
U2VuZAAPD2NlbnRlcl92ZXJ0aWNhbAAICGNoZWNrYm94AAcHY2hlY2tlZAALC2Nocm9ub21ldGVy
ABISY29sbGFwc2VBY3Rpb25WaWV3ABwcY29tcG9zZV92aWV3X3NhdmVhYmxlX2lkX3RhZwAZGWNv
bnN1bWVfd2luZG93X2luc2V0c190YWcABwdjb250ZW50AAwMY29udGVudFBhbmVsAAYGY3VzdG9t
AAsLY3VzdG9tUGFuZWwAFBRkZWNvcl9jb250ZW50X3BhcmVudAAXF2RlZmF1bHRfYWN0aXZpdHlf
YnV0dG9uAA0NZGlhbG9nX2J1dHRvbgALC2Rpc2FibGVIb21lAAsLZWRpdFRleHRBZGQACgplZGl0
VGV4dElkAAoKZWRpdF9xdWVyeQADA2VuZAAYGGV4cGFuZF9hY3Rpdml0aWVzX2J1dHRvbgANDWV4
cGFuZGVkX21lbnUABwdmb3JldmVyABsbZnJhZ21lbnRfY29udGFpbmVyX3ZpZXdfdGFnAA0NZ3Jv
dXBfZGl2aWRlcgAVFWhpZGVfaW5faW5zcGVjdG9yX3RhZwAEBGhvbWUACAhob21lQXNVcAAKCmlj
b25fZ3JvdXAABgZpZlJvb20ABQVpbWFnZQAEBGluZm8AGRlpbnNwZWN0aW9uX3Nsb3RfdGFibGVf
c2V0ABgYaXNfcG9vbGluZ19jb250YWluZXJfdGFnAAYGaXRhbGljAAUFbGluZTEABQVsaW5lMwAI
CGxpc3RNb2RlAAkJbGlzdF9pdGVtAAcHbWVzc2FnZQAGBm1pZGRsZQAICG11bHRpcGx5AAUFbmV2
ZXIABARub25lAAYGbm9ybWFsABcXbm90aWZpY2F0aW9uX2JhY2tncm91bmQAGBhub3RpZmljYXRp
b25fbWFpbl9jb2x1bW4AIiJub3RpZmljYXRpb25fbWFpbl9jb2x1bW5fY29udGFpbmVyAAMDb2Zm
AAICb24ACwtwYXJlbnRQYW5lbAAlJXBvb2xpbmdfY29udGFpbmVyX2xpc3RlbmVyX2hvbGRlcl90
YWcAERFwcm9ncmVzc19jaXJjdWxhcgATE3Byb2dyZXNzX2hvcml6b250YWwABQVyYWRpbwAMDHJl
cG9ydF9kcmF3bgAKCnJpZ2h0X2ljb24ACgpyaWdodF9zaWRlAAYGc2NyZWVuABMTc2Nyb2xsSW5k
aWNhdG9yRG93bgAREXNjcm9sbEluZGljYXRvclVwAAoKc2Nyb2xsVmlldwAMDHNlYXJjaF9iYWRn
ZQAKCnNlYXJjaF9iYXIADQ1zZWFyY2hfYnV0dG9uABAQc2VhcmNoX2Nsb3NlX2J0bgAREXNlYXJj
aF9lZGl0X2ZyYW1lAA0Nc2VhcmNoX2dvX2J0bgAPD3NlYXJjaF9tYWdfaWNvbgAMDHNlYXJjaF9w
bGF0ZQAPD3NlYXJjaF9zcmNfdGV4dAAQEHNlYXJjaF92b2ljZV9idG4AFhZzZWxlY3RfZGlhbG9n
X2xpc3R2aWV3AAgIc2hvcnRjdXQACgpzaG93Q3VzdG9tAAgIc2hvd0hvbWUABgZzcGFjZXIAIyNz
cGVjaWFsX2VmZmVjdHNfY29udHJvbGxlcl92aWV3X3RhZwAQEHNwbGl0X2FjdGlvbl9iYXIACAhz
cmNfYXRvcAAGBnNyY19pbgAICHNyY19vdmVyAAwMc3VibWVudWFycm93AAsLc3VibWl0X2FyZWEA
Bwd0YWJNb2RlABkZdGFnX2FjY2Vzc2liaWxpdHlfYWN0aW9ucwAhIXRhZ19hY2Nlc3NpYmlsaXR5
X2NsaWNrYWJsZV9zcGFucwAZGXRhZ19hY2Nlc3NpYmlsaXR5X2hlYWRpbmcAHBx0YWdfYWNjZXNz
aWJpbGl0eV9wYW5lX3RpdGxlABwcdGFnX29uX2FwcGx5X3dpbmRvd19saXN0ZW5lcgAfH3RhZ19v
bl9yZWNlaXZlX2NvbnRlbnRfbGlzdGVuZXIAISF0YWdfb25fcmVjZWl2ZV9jb250ZW50X21pbWVf
dHlwZXMAGxt0YWdfc2NyZWVuX3JlYWRlcl9mb2N1c2FibGUAFRV0YWdfc3RhdGVfZGVzY3JpcHRp
b24AFBR0YWdfdHJhbnNpdGlvbl9ncm91cAAfH3RhZ191bmhhbmRsZWRfa2V5X2V2ZW50X21hbmFn
ZXIAGxt0YWdfdW5oYW5kbGVkX2tleV9saXN0ZW5lcnMAJCR0YWdfd2luZG93X2luc2V0c19hbmlt
YXRpb25fY2FsbGJhY2sABAR0ZXh0AAUFdGV4dDIAExN0ZXh0U3BhY2VyTm9CdXR0b25zABERdGV4
dFNwYWNlck5vVGl0bGUAEBB0ZXh0Vmlld1Jlc3BvbnNlAAQEdGltZQAUFHRpdGxlRGl2aWRlck5v
Q3VzdG9tAA4OdGl0bGVfdGVtcGxhdGUAAwN0b3AACAh0b3BQYW5lbAAJCXVuY2hlY2tlZAAHB3Vu
aWZvcm0AAgJ1cAAHB3VzZUxvZ28AGRl2aWV3X3RyZWVfbGlmZWN5Y2xlX293bmVyACoqdmlld190
cmVlX29uX2JhY2tfcHJlc3NlZF9kaXNwYXRjaGVyX293bmVyACQkdmlld190cmVlX3NhdmVkX3N0
YXRlX3JlZ2lzdHJ5X293bmVyACAgdmlld190cmVlX3ZpZXdfbW9kZWxfc3RvcmVfb3duZXIAIiJ2
aXNpYmxlX3JlbW92aW5nX2ZyYWdtZW50X3ZpZXdfdGFnAAgId2l0aFRleHQADAx3cmFwX2NvbnRl
bnQAFxd3cmFwcGVkX2NvbXBvc2l0aW9uX3RhZwAdHWFiY19jb25maWdfYWN0aXZpdHlEZWZhdWx0
RHVyABsbYWJjX2NvbmZpZ19hY3Rpdml0eVNob3J0RHVyABkZY2FuY2VsX2J1dHRvbl9pbWFnZV9h
bHBoYQAWFmNvbmZpZ190b29sdGlwQW5pbVRpbWUAIyNzdGF0dXNfYmFyX25vdGlmaWNhdGlvbl9p
bmZvX21heG51bQAyMmJ0bl9jaGVja2JveF9jaGVja2VkX210cmxfYW5pbWF0aW9uX2ludGVycG9s
YXRvcl8wADIyYnRuX2NoZWNrYm94X2NoZWNrZWRfbXRybF9hbmltYXRpb25faW50ZXJwb2xhdG9y
XzEANDRidG5fY2hlY2tib3hfdW5jaGVja2VkX210cmxfYW5pbWF0aW9uX2ludGVycG9sYXRvcl8w
ADQ0YnRuX2NoZWNrYm94X3VuY2hlY2tlZF9tdHJsX2FuaW1hdGlvbl9pbnRlcnBvbGF0b3JfMQAu
LmJ0bl9yYWRpb190b19vZmZfbXRybF9hbmltYXRpb25faW50ZXJwb2xhdG9yXzAALS1idG5fcmFk
aW9fdG9fb25fbXRybF9hbmltYXRpb25faW50ZXJwb2xhdG9yXzAAEBBmYXN0X291dF9zbG93X2lu
ABkZYWJjX2FjdGlvbl9iYXJfdGl0bGVfaXRlbQAbG2FiY19hY3Rpb25fYmFyX3VwX2NvbnRhaW5l
cgAbG2FiY19hY3Rpb25fbWVudV9pdGVtX2xheW91dAAWFmFiY19hY3Rpb25fbWVudV9sYXlvdXQA
ExNhYmNfYWN0aW9uX21vZGVfYmFyACMjYWJjX2FjdGlvbl9tb2RlX2Nsb3NlX2l0ZW1fbWF0ZXJp
YWwAGRlhYmNfYWN0aXZpdHlfY2hvb3Nlcl92aWV3ACMjYWJjX2FjdGl2aXR5X2Nob29zZXJfdmll
d19saXN0X2l0ZW0AJCRhYmNfYWxlcnRfZGlhbG9nX2J1dHRvbl9iYXJfbWF0ZXJpYWwAGRlhYmNf
YWxlcnRfZGlhbG9nX21hdGVyaWFsAB8fYWJjX2FsZXJ0X2RpYWxvZ190aXRsZV9tYXRlcmlhbAAe
HmFiY19jYXNjYWRpbmdfbWVudV9pdGVtX2xheW91dAAZGWFiY19kaWFsb2dfdGl0bGVfbWF0ZXJp
YWwAGBhhYmNfZXhwYW5kZWRfbWVudV9sYXlvdXQAGxthYmNfbGlzdF9tZW51X2l0ZW1fY2hlY2ti
b3gAFxdhYmNfbGlzdF9tZW51X2l0ZW1faWNvbgAZGWFiY19saXN0X21lbnVfaXRlbV9sYXlvdXQA
GBhhYmNfbGlzdF9tZW51X2l0ZW1fcmFkaW8AISFhYmNfcG9wdXBfbWVudV9oZWFkZXJfaXRlbV9s
YXlvdXQAGhphYmNfcG9wdXBfbWVudV9pdGVtX2xheW91dAAaGmFiY19zY3JlZW5fY29udGVudF9p
bmNsdWRlABERYWJjX3NjcmVlbl9zaW1wbGUAJSVhYmNfc2NyZWVuX3NpbXBsZV9vdmVybGF5X2Fj
dGlvbl9tb2RlABISYWJjX3NjcmVlbl90b29sYmFyACQkYWJjX3NlYXJjaF9kcm9wZG93bl9pdGVt
X2ljb25zXzJsaW5lAA8PYWJjX3NlYXJjaF92aWV3ABoaYWJjX3NlbGVjdF9kaWFsb2dfbWF0ZXJp
YWwACwthYmNfdG9vbHRpcAANDWFjdGl2aXR5X21haW4ADQ1jdXN0b21fZGlhbG9nABMTbm90aWZp
Y2F0aW9uX2FjdGlvbgAdHW5vdGlmaWNhdGlvbl9hY3Rpb25fdG9tYnN0b25lACAgbm90aWZpY2F0
aW9uX3RlbXBsYXRlX2N1c3RvbV9iaWcAICBub3RpZmljYXRpb25fdGVtcGxhdGVfaWNvbl9ncm91
cAAmJm5vdGlmaWNhdGlvbl90ZW1wbGF0ZV9wYXJ0X2Nocm9ub21ldGVyAB8fbm90aWZpY2F0aW9u
X3RlbXBsYXRlX3BhcnRfdGltZQAbG3NlbGVjdF9kaWFsb2dfaXRlbV9tYXRlcmlhbAAiInNlbGVj
dF9kaWFsb2dfbXVsdGljaG9pY2VfbWF0ZXJpYWwAIyNzZWxlY3RfZGlhbG9nX3NpbmdsZWNob2lj
ZV9tYXRlcmlhbAAkJHN1cHBvcnRfc2ltcGxlX3NwaW5uZXJfZHJvcGRvd25faXRlbQALC2ljX2xh
dW5jaGVyABERaWNfbGF1bmNoZXJfcm91bmQAHx9hYmNfYWN0aW9uX2Jhcl9ob21lX2Rlc2NyaXB0
aW9uAB0dYWJjX2FjdGlvbl9iYXJfdXBfZGVzY3JpcHRpb24AJCRhYmNfYWN0aW9uX21lbnVfb3Zl
cmZsb3dfZGVzY3JpcHRpb24AFBRhYmNfYWN0aW9uX21vZGVfZG9uZQAhIWFiY19hY3Rpdml0eV9j
aG9vc2VyX3ZpZXdfc2VlX2FsbAAqKmFiY19hY3Rpdml0eWNob29zZXJ2aWV3X2Nob29zZV9hcHBs
aWNhdGlvbgAPD2FiY19jYXBpdGFsX29mZgAODmFiY19jYXBpdGFsX29uABsbYWJjX21lbnVfYWx0
X3Nob3J0Y3V0X2xhYmVsABwcYWJjX21lbnVfY3RybF9zaG9ydGN1dF9sYWJlbAAeHmFiY19tZW51
X2RlbGV0ZV9zaG9ydGN1dF9sYWJlbAAdHWFiY19tZW51X2VudGVyX3Nob3J0Y3V0X2xhYmVsACAg
YWJjX21lbnVfZnVuY3Rpb25fc2hvcnRjdXRfbGFiZWwAHBxhYmNfbWVudV9tZXRhX3Nob3J0Y3V0
X2xhYmVsAB0dYWJjX21lbnVfc2hpZnRfc2hvcnRjdXRfbGFiZWwAHR1hYmNfbWVudV9zcGFjZV9z
aG9ydGN1dF9sYWJlbAAbG2FiY19tZW51X3N5bV9zaG9ydGN1dF9sYWJlbAAaGmFiY19wcmVwZW5k
X3Nob3J0Y3V0X2xhYmVsAA8PYWJjX3NlYXJjaF9oaW50ACAgYWJjX3NlYXJjaHZpZXdfZGVzY3Jp
cHRpb25fY2xlYXIAICBhYmNfc2VhcmNodmlld19kZXNjcmlwdGlvbl9xdWVyeQAhIWFiY19zZWFy
Y2h2aWV3X2Rlc2NyaXB0aW9uX3NlYXJjaAAhIWFiY19zZWFyY2h2aWV3X2Rlc2NyaXB0aW9uX3N1
Ym1pdAAgIGFiY19zZWFyY2h2aWV3X2Rlc2NyaXB0aW9uX3ZvaWNlACIiYWJjX3NoYXJlYWN0aW9u
cHJvdmlkZXJfc2hhcmVfd2l0aAAuLmFiY19zaGFyZWFjdGlvbnByb3ZpZGVyX3NoYXJlX3dpdGhf
YXBwbGljYXRpb24AICBhYmNfdG9vbGJhcl9jb2xsYXBzZV9kZXNjcmlwdGlvbgAQEGFuZHJvaWR4
X3N0YXJ0dXAACAhhcHBfbmFtZQAhIWJvdHRvbV9zaGVldF9jb2xsYXBzZV9kZXNjcmlwdGlvbgAg
IGJvdHRvbV9zaGVldF9kaXNtaXNzX2Rlc2NyaXB0aW9uACQkYm90dG9tX3NoZWV0X2RyYWdfaGFu
ZGxlX2Rlc2NyaXB0aW9uAB8fYm90dG9tX3NoZWV0X2V4cGFuZF9kZXNjcmlwdGlvbgAfH2NhbGxf
bm90aWZpY2F0aW9uX2Fuc3dlcl9hY3Rpb24AJSVjYWxsX25vdGlmaWNhdGlvbl9hbnN3ZXJfdmlk
ZW9fYWN0aW9uACAgY2FsbF9ub3RpZmljYXRpb25fZGVjbGluZV9hY3Rpb24AICBjYWxsX25vdGlm
aWNhdGlvbl9oYW5nX3VwX2FjdGlvbgAfH2NhbGxfbm90aWZpY2F0aW9uX2luY29taW5nX3RleHQA
Hh5jYWxsX25vdGlmaWNhdGlvbl9vbmdvaW5nX3RleHQAICBjYWxsX25vdGlmaWNhdGlvbl9zY3Jl
ZW5pbmdfdGV4dAAMDGNsb3NlX2RyYXdlcgALC2Nsb3NlX3NoZWV0AAkJY29sbGFwc2VkABMTZGF0
ZV9pbnB1dF9oZWFkbGluZQAfH2RhdGVfaW5wdXRfaGVhZGxpbmVfZGVzY3JpcHRpb24AHh5kYXRl
X2lucHV0X2ludmFsaWRfZm9yX3BhdHRlcm4AHh5kYXRlX2lucHV0X2ludmFsaWRfbm90X2FsbG93
ZWQAHR1kYXRlX2lucHV0X2ludmFsaWRfeWVhcl9yYW5nZQAQEGRhdGVfaW5wdXRfbGFiZWwAHx9k
YXRlX2lucHV0X25vX2lucHV0X2Rlc2NyaXB0aW9uABAQZGF0ZV9pbnB1dF90aXRsZQAUFGRhdGVf
cGlja2VyX2hlYWRsaW5lACAgZGF0ZV9waWNrZXJfaGVhZGxpbmVfZGVzY3JpcHRpb24AKChkYXRl
X3BpY2tlcl9uYXZpZ2F0ZV90b195ZWFyX2Rlc2NyaXB0aW9uACQkZGF0ZV9waWNrZXJfbm9fc2Vs
ZWN0aW9uX2Rlc2NyaXB0aW9uACMjZGF0ZV9waWNrZXJfc2Nyb2xsX3RvX2VhcmxpZXJfeWVhcnMA
ISFkYXRlX3BpY2tlcl9zY3JvbGxfdG9fbGF0ZXJfeWVhcnMAIyNkYXRlX3BpY2tlcl9zd2l0Y2hf
dG9fY2FsZW5kYXJfbW9kZQAjI2RhdGVfcGlja2VyX3N3aXRjaF90b19kYXlfc2VsZWN0aW9uACAg
ZGF0ZV9waWNrZXJfc3dpdGNoX3RvX2lucHV0X21vZGUAICBkYXRlX3BpY2tlcl9zd2l0Y2hfdG9f
bmV4dF9tb250aAAkJGRhdGVfcGlja2VyX3N3aXRjaF90b19wcmV2aW91c19tb250aAAkJGRhdGVf
cGlja2VyX3N3aXRjaF90b195ZWFyX3NlbGVjdGlvbgAREWRhdGVfcGlja2VyX3RpdGxlAB0dZGF0
ZV9waWNrZXJfdG9kYXlfZGVzY3JpcHRpb24AIiJkYXRlX3BpY2tlcl95ZWFyX3BpY2tlcl9wYW5l
X3RpdGxlACQkZGF0ZV9yYW5nZV9pbnB1dF9pbnZhbGlkX3JhbmdlX2lucHV0ABYWZGF0ZV9yYW5n
ZV9pbnB1dF90aXRsZQAeHmRhdGVfcmFuZ2VfcGlja2VyX2RheV9pbl9yYW5nZQAeHmRhdGVfcmFu
Z2VfcGlja2VyX2VuZF9oZWFkbGluZQAmJmRhdGVfcmFuZ2VfcGlja2VyX3Njcm9sbF90b19uZXh0
X21vbnRoACoqZGF0ZV9yYW5nZV9waWNrZXJfc2Nyb2xsX3RvX3ByZXZpb3VzX21vbnRoACAgZGF0
ZV9yYW5nZV9waWNrZXJfc3RhcnRfaGVhZGxpbmUAFxdkYXRlX3JhbmdlX3BpY2tlcl90aXRsZQAV
FWRlZmF1bHRfZXJyb3JfbWVzc2FnZQAaGmRlZmF1bHRfcG9wdXBfd2luZG93X3RpdGxlAAYGZGlh
bG9nAA0NZHJvcGRvd25fbWVudQAICGV4cGFuZGVkAAsLaW5fcHJvZ3Jlc3MADQ1pbmRldGVybWlu
YXRlABsbbTNjX2JvdHRvbV9zaGVldF9wYW5lX3RpdGxlAA8PbmF2aWdhdGlvbl9tZW51AAwMbm90
X3NlbGVjdGVkAAkJcmFuZ2VfZW5kAAsLcmFuZ2Vfc3RhcnQAERFzZWFyY2hfYmFyX3NlYXJjaAAR
EXNlYXJjaF9tZW51X3RpdGxlAAgIc2VsZWN0ZWQAEBBzbmFja2Jhcl9kaXNtaXNzACUlc3RhdHVz
X2Jhcl9ub3RpZmljYXRpb25faW5mb19vdmVyZmxvdwAVFXN1Z2dlc3Rpb25zX2F2YWlsYWJsZQAL
C3N3aXRjaF9yb2xlAAMDdGFiABAQdGVtcGxhdGVfcGVyY2VudAAODnRpbWVfcGlja2VyX2FtABAQ
dGltZV9waWNrZXJfaG91cgAbG3RpbWVfcGlja2VyX2hvdXJfMjRoX3N1ZmZpeAAaGnRpbWVfcGlj
a2VyX2hvdXJfc2VsZWN0aW9uABcXdGltZV9waWNrZXJfaG91cl9zdWZmaXgAGxt0aW1lX3BpY2tl
cl9ob3VyX3RleHRfZmllbGQAEhJ0aW1lX3BpY2tlcl9taW51dGUAHBx0aW1lX3BpY2tlcl9taW51
dGVfc2VsZWN0aW9uABkZdGltZV9waWNrZXJfbWludXRlX3N1ZmZpeAAdHXRpbWVfcGlja2VyX21p
bnV0ZV90ZXh0X2ZpZWxkACUldGltZV9waWNrZXJfcGVyaW9kX3RvZ2dsZV9kZXNjcmlwdGlvbgAO
DnRpbWVfcGlja2VyX3BtABgYdG9vbHRpcF9sb25nX3ByZXNzX2xhYmVsABgYdG9vbHRpcF9wYW5l
X2Rlc2NyaXB0aW9uABUVQWxlcnREaWFsb2cuQXBwQ29tcGF0ABsbQWxlcnREaWFsb2cuQXBwQ29t
cGF0LkxpZ2h0ABoaQW5pbWF0aW9uLkFwcENvbXBhdC5EaWFsb2cAHh5BbmltYXRpb24uQXBwQ29t
cGF0LkRyb3BEb3duVXAAGxtBbmltYXRpb24uQXBwQ29tcGF0LlRvb2x0aXAAGhpCYXNlLkFsZXJ0
RGlhbG9nLkFwcENvbXBhdAAgIEJhc2UuQWxlcnREaWFsb2cuQXBwQ29tcGF0LkxpZ2h0AB8fQmFz
ZS5BbmltYXRpb24uQXBwQ29tcGF0LkRpYWxvZwAjI0Jhc2UuQW5pbWF0aW9uLkFwcENvbXBhdC5E
cm9wRG93blVwACAgQmFzZS5BbmltYXRpb24uQXBwQ29tcGF0LlRvb2x0aXAAICBCYXNlLkRpYWxv
Z1dpbmRvd1RpdGxlLkFwcENvbXBhdAAqKkJhc2UuRGlhbG9nV2luZG93VGl0bGVCYWNrZ3JvdW5k
LkFwcENvbXBhdAAdHUJhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0ACMjQmFzZS5UZXh0QXBw
ZWFyYW5jZS5BcHBDb21wYXQuQm9keTEAIyNCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5C
b2R5MgAkJEJhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LkJ1dHRvbgAlJUJhc2UuVGV4dEFw
cGVhcmFuY2UuQXBwQ29tcGF0LkNhcHRpb24AJiZCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBh
dC5EaXNwbGF5MQAmJkJhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LkRpc3BsYXkyACYmQmFz
ZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuRGlzcGxheTMAJiZCYXNlLlRleHRBcHBlYXJhbmNl
LkFwcENvbXBhdC5EaXNwbGF5NAAmJkJhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LkhlYWRs
aW5lACUlQmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuSW52ZXJzZQAjI0Jhc2UuVGV4dEFw
cGVhcmFuY2UuQXBwQ29tcGF0LkxhcmdlACsrQmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQu
TGFyZ2UuSW52ZXJzZQA6OkJhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LkxpZ2h0LldpZGdl
dC5Qb3B1cE1lbnUuTGFyZ2UAOjpCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5MaWdodC5X
aWRnZXQuUG9wdXBNZW51LlNtYWxsACQkQmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuTWVk
aXVtACwsQmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuTWVkaXVtLkludmVyc2UAIiJCYXNl
LlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5NZW51ACoqQmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBD
b21wYXQuU2VhcmNoUmVzdWx0ADMzQmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuU2VhcmNo
UmVzdWx0LlN1YnRpdGxlADAwQmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuU2VhcmNoUmVz
dWx0LlRpdGxlACMjQmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuU21hbGwAKytCYXNlLlRl
eHRBcHBlYXJhbmNlLkFwcENvbXBhdC5TbWFsbC5JbnZlcnNlACUlQmFzZS5UZXh0QXBwZWFyYW5j
ZS5BcHBDb21wYXQuU3ViaGVhZAAtLUJhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LlN1Ymhl
YWQuSW52ZXJzZQAjI0Jhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LlRpdGxlACsrQmFzZS5U
ZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuVGl0bGUuSW52ZXJzZQAlJUJhc2UuVGV4dEFwcGVhcmFu
Y2UuQXBwQ29tcGF0LlRvb2x0aXAAMzNCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5XaWRn
ZXQuQWN0aW9uQmFyLk1lbnUANzdCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5XaWRnZXQu
QWN0aW9uQmFyLlN1YnRpdGxlAD8/QmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lkZ2V0
LkFjdGlvbkJhci5TdWJ0aXRsZS5JbnZlcnNlADQ0QmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21w
YXQuV2lkZ2V0LkFjdGlvbkJhci5UaXRsZQA8PEJhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0
LldpZGdldC5BY3Rpb25CYXIuVGl0bGUuSW52ZXJzZQA4OEJhc2UuVGV4dEFwcGVhcmFuY2UuQXBw
Q29tcGF0LldpZGdldC5BY3Rpb25Nb2RlLlN1YnRpdGxlADU1QmFzZS5UZXh0QXBwZWFyYW5jZS5B
cHBDb21wYXQuV2lkZ2V0LkFjdGlvbk1vZGUuVGl0bGUAKytCYXNlLlRleHRBcHBlYXJhbmNlLkFw
cENvbXBhdC5XaWRnZXQuQnV0dG9uAD4+QmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lk
Z2V0LkJ1dHRvbi5Cb3JkZXJsZXNzLkNvbG9yZWQAMzNCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENv
bXBhdC5XaWRnZXQuQnV0dG9uLkNvbG9yZWQAMzNCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBh
dC5XaWRnZXQuQnV0dG9uLkludmVyc2UAMTFCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5X
aWRnZXQuRHJvcERvd25JdGVtADU1QmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lkZ2V0
LlBvcHVwTWVudS5IZWFkZXIANDRCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5XaWRnZXQu
UG9wdXBNZW51LkxhcmdlADQ0QmFzZS5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lkZ2V0LlBv
cHVwTWVudS5TbWFsbAArK0Jhc2UuVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LldpZGdldC5Td2l0
Y2gAOTlCYXNlLlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5XaWRnZXQuVGV4dFZpZXcuU3Bpbm5l
ckl0ZW0ANjZCYXNlLlRleHRBcHBlYXJhbmNlLldpZGdldC5BcHBDb21wYXQuRXhwYW5kZWRNZW51
Lkl0ZW0ANTVCYXNlLlRleHRBcHBlYXJhbmNlLldpZGdldC5BcHBDb21wYXQuVG9vbGJhci5TdWJ0
aXRsZQAyMkJhc2UuVGV4dEFwcGVhcmFuY2UuV2lkZ2V0LkFwcENvbXBhdC5Ub29sYmFyLlRpdGxl
ABQUQmFzZS5UaGVtZS5BcHBDb21wYXQAICBCYXNlLlRoZW1lLkFwcENvbXBhdC5Db21wYWN0TWVu
dQAbG0Jhc2UuVGhlbWUuQXBwQ29tcGF0LkRpYWxvZwAhIUJhc2UuVGhlbWUuQXBwQ29tcGF0LkRp
YWxvZy5BbGVydAAlJUJhc2UuVGhlbWUuQXBwQ29tcGF0LkRpYWxvZy5GaXhlZFNpemUAJCRCYXNl
LlRoZW1lLkFwcENvbXBhdC5EaWFsb2cuTWluV2lkdGgAJCRCYXNlLlRoZW1lLkFwcENvbXBhdC5E
aWFsb2dXaGVuTGFyZ2UAGhpCYXNlLlRoZW1lLkFwcENvbXBhdC5MaWdodAAoKEJhc2UuVGhlbWUu
QXBwQ29tcGF0LkxpZ2h0LkRhcmtBY3Rpb25CYXIAISFCYXNlLlRoZW1lLkFwcENvbXBhdC5MaWdo
dC5EaWFsb2cAJydCYXNlLlRoZW1lLkFwcENvbXBhdC5MaWdodC5EaWFsb2cuQWxlcnQAKytCYXNl
LlRoZW1lLkFwcENvbXBhdC5MaWdodC5EaWFsb2cuRml4ZWRTaXplACoqQmFzZS5UaGVtZS5BcHBD
b21wYXQuTGlnaHQuRGlhbG9nLk1pbldpZHRoACoqQmFzZS5UaGVtZS5BcHBDb21wYXQuTGlnaHQu
RGlhbG9nV2hlbkxhcmdlABsbQmFzZS5UaGVtZU92ZXJsYXkuQXBwQ29tcGF0ACUlQmFzZS5UaGVt
ZU92ZXJsYXkuQXBwQ29tcGF0LkFjdGlvbkJhcgAgIEJhc2UuVGhlbWVPdmVybGF5LkFwcENvbXBh
dC5EYXJrACoqQmFzZS5UaGVtZU92ZXJsYXkuQXBwQ29tcGF0LkRhcmsuQWN0aW9uQmFyACIiQmFz
ZS5UaGVtZU92ZXJsYXkuQXBwQ29tcGF0LkRpYWxvZwAoKEJhc2UuVGhlbWVPdmVybGF5LkFwcENv
bXBhdC5EaWFsb2cuQWxlcnQAISFCYXNlLlRoZW1lT3ZlcmxheS5BcHBDb21wYXQuTGlnaHQAGBhC
YXNlLlYyMS5UaGVtZS5BcHBDb21wYXQAHx9CYXNlLlYyMS5UaGVtZS5BcHBDb21wYXQuRGlhbG9n
AB4eQmFzZS5WMjEuVGhlbWUuQXBwQ29tcGF0LkxpZ2h0ACUlQmFzZS5WMjEuVGhlbWUuQXBwQ29t
cGF0LkxpZ2h0LkRpYWxvZwAmJkJhc2UuVjIxLlRoZW1lT3ZlcmxheS5BcHBDb21wYXQuRGlhbG9n
ABgYQmFzZS5WMjIuVGhlbWUuQXBwQ29tcGF0AB4eQmFzZS5WMjIuVGhlbWUuQXBwQ29tcGF0Lkxp
Z2h0ABgYQmFzZS5WMjMuVGhlbWUuQXBwQ29tcGF0AB4eQmFzZS5WMjMuVGhlbWUuQXBwQ29tcGF0
LkxpZ2h0ABgYQmFzZS5WMjYuVGhlbWUuQXBwQ29tcGF0AB4eQmFzZS5WMjYuVGhlbWUuQXBwQ29t
cGF0LkxpZ2h0ACEhQmFzZS5WMjYuV2lkZ2V0LkFwcENvbXBhdC5Ub29sYmFyABgYQmFzZS5WMjgu
VGhlbWUuQXBwQ29tcGF0AB4eQmFzZS5WMjguVGhlbWUuQXBwQ29tcGF0LkxpZ2h0ABcXQmFzZS5W
Ny5UaGVtZS5BcHBDb21wYXQAHh5CYXNlLlY3LlRoZW1lLkFwcENvbXBhdC5EaWFsb2cAHR1CYXNl
LlY3LlRoZW1lLkFwcENvbXBhdC5MaWdodAAkJEJhc2UuVjcuVGhlbWUuQXBwQ29tcGF0LkxpZ2h0
LkRpYWxvZwAlJUJhc2UuVjcuVGhlbWVPdmVybGF5LkFwcENvbXBhdC5EaWFsb2cALS1CYXNlLlY3
LldpZGdldC5BcHBDb21wYXQuQXV0b0NvbXBsZXRlVGV4dFZpZXcAISFCYXNlLlY3LldpZGdldC5B
cHBDb21wYXQuRWRpdFRleHQAICBCYXNlLlY3LldpZGdldC5BcHBDb21wYXQuVG9vbGJhcgAfH0Jh
c2UuV2lkZ2V0LkFwcENvbXBhdC5BY3Rpb25CYXIAJSVCYXNlLldpZGdldC5BcHBDb21wYXQuQWN0
aW9uQmFyLlNvbGlkACYmQmFzZS5XaWRnZXQuQXBwQ29tcGF0LkFjdGlvbkJhci5UYWJCYXIAJydC
YXNlLldpZGdldC5BcHBDb21wYXQuQWN0aW9uQmFyLlRhYlRleHQAJydCYXNlLldpZGdldC5BcHBD
b21wYXQuQWN0aW9uQmFyLlRhYlZpZXcAIiJCYXNlLldpZGdldC5BcHBDb21wYXQuQWN0aW9uQnV0
dG9uACwsQmFzZS5XaWRnZXQuQXBwQ29tcGF0LkFjdGlvbkJ1dHRvbi5DbG9zZU1vZGUAKytCYXNl
LldpZGdldC5BcHBDb21wYXQuQWN0aW9uQnV0dG9uLk92ZXJmbG93ACAgQmFzZS5XaWRnZXQuQXBw
Q29tcGF0LkFjdGlvbk1vZGUAKSlCYXNlLldpZGdldC5BcHBDb21wYXQuQWN0aXZpdHlDaG9vc2Vy
VmlldwAqKkJhc2UuV2lkZ2V0LkFwcENvbXBhdC5BdXRvQ29tcGxldGVUZXh0VmlldwAcHEJhc2Uu
V2lkZ2V0LkFwcENvbXBhdC5CdXR0b24AJydCYXNlLldpZGdldC5BcHBDb21wYXQuQnV0dG9uLkJv
cmRlcmxlc3MALy9CYXNlLldpZGdldC5BcHBDb21wYXQuQnV0dG9uLkJvcmRlcmxlc3MuQ29sb3Jl
ZAAyMkJhc2UuV2lkZ2V0LkFwcENvbXBhdC5CdXR0b24uQnV0dG9uQmFyLkFsZXJ0RGlhbG9nACQk
QmFzZS5XaWRnZXQuQXBwQ29tcGF0LkJ1dHRvbi5Db2xvcmVkACIiQmFzZS5XaWRnZXQuQXBwQ29t
cGF0LkJ1dHRvbi5TbWFsbAAfH0Jhc2UuV2lkZ2V0LkFwcENvbXBhdC5CdXR0b25CYXIAKytCYXNl
LldpZGdldC5BcHBDb21wYXQuQnV0dG9uQmFyLkFsZXJ0RGlhbG9nAC0tQmFzZS5XaWRnZXQuQXBw
Q29tcGF0LkNvbXBvdW5kQnV0dG9uLkNoZWNrQm94ADAwQmFzZS5XaWRnZXQuQXBwQ29tcGF0LkNv
bXBvdW5kQnV0dG9uLlJhZGlvQnV0dG9uACsrQmFzZS5XaWRnZXQuQXBwQ29tcGF0LkNvbXBvdW5k
QnV0dG9uLlN3aXRjaAAnJ0Jhc2UuV2lkZ2V0LkFwcENvbXBhdC5EcmF3ZXJBcnJvd1RvZ2dsZQAu
LkJhc2UuV2lkZ2V0LkFwcENvbXBhdC5EcmF3ZXJBcnJvd1RvZ2dsZS5Db21tb24AKipCYXNlLldp
ZGdldC5BcHBDb21wYXQuRHJvcERvd25JdGVtLlNwaW5uZXIAHh5CYXNlLldpZGdldC5BcHBDb21w
YXQuRWRpdFRleHQAISFCYXNlLldpZGdldC5BcHBDb21wYXQuSW1hZ2VCdXR0b24AJSVCYXNlLldp
ZGdldC5BcHBDb21wYXQuTGlnaHQuQWN0aW9uQmFyACsrQmFzZS5XaWRnZXQuQXBwQ29tcGF0Lkxp
Z2h0LkFjdGlvbkJhci5Tb2xpZAAsLEJhc2UuV2lkZ2V0LkFwcENvbXBhdC5MaWdodC5BY3Rpb25C
YXIuVGFiQmFyAC0tQmFzZS5XaWRnZXQuQXBwQ29tcGF0LkxpZ2h0LkFjdGlvbkJhci5UYWJUZXh0
ADU1QmFzZS5XaWRnZXQuQXBwQ29tcGF0LkxpZ2h0LkFjdGlvbkJhci5UYWJUZXh0LkludmVyc2UA
LS1CYXNlLldpZGdldC5BcHBDb21wYXQuTGlnaHQuQWN0aW9uQmFyLlRhYlZpZXcAJSVCYXNlLldp
ZGdldC5BcHBDb21wYXQuTGlnaHQuUG9wdXBNZW51AC4uQmFzZS5XaWRnZXQuQXBwQ29tcGF0Lkxp
Z2h0LlBvcHVwTWVudS5PdmVyZmxvdwAiIkJhc2UuV2lkZ2V0LkFwcENvbXBhdC5MaXN0TWVudVZp
ZXcAJSVCYXNlLldpZGdldC5BcHBDb21wYXQuTGlzdFBvcHVwV2luZG93AB4eQmFzZS5XaWRnZXQu
QXBwQ29tcGF0Lkxpc3RWaWV3ACcnQmFzZS5XaWRnZXQuQXBwQ29tcGF0Lkxpc3RWaWV3LkRyb3BE
b3duACMjQmFzZS5XaWRnZXQuQXBwQ29tcGF0Lkxpc3RWaWV3Lk1lbnUAHx9CYXNlLldpZGdldC5B
cHBDb21wYXQuUG9wdXBNZW51ACgoQmFzZS5XaWRnZXQuQXBwQ29tcGF0LlBvcHVwTWVudS5PdmVy
ZmxvdwAhIUJhc2UuV2lkZ2V0LkFwcENvbXBhdC5Qb3B1cFdpbmRvdwAhIUJhc2UuV2lkZ2V0LkFw
cENvbXBhdC5Qcm9ncmVzc0JhcgAsLEJhc2UuV2lkZ2V0LkFwcENvbXBhdC5Qcm9ncmVzc0Jhci5I
b3Jpem9udGFsAB8fQmFzZS5XaWRnZXQuQXBwQ29tcGF0LlJhdGluZ0JhcgApKUJhc2UuV2lkZ2V0
LkFwcENvbXBhdC5SYXRpbmdCYXIuSW5kaWNhdG9yACUlQmFzZS5XaWRnZXQuQXBwQ29tcGF0LlJh
dGluZ0Jhci5TbWFsbAAgIEJhc2UuV2lkZ2V0LkFwcENvbXBhdC5TZWFyY2hWaWV3ACoqQmFzZS5X
aWRnZXQuQXBwQ29tcGF0LlNlYXJjaFZpZXcuQWN0aW9uQmFyAB0dQmFzZS5XaWRnZXQuQXBwQ29t
cGF0LlNlZWtCYXIAJiZCYXNlLldpZGdldC5BcHBDb21wYXQuU2Vla0Jhci5EaXNjcmV0ZQAdHUJh
c2UuV2lkZ2V0LkFwcENvbXBhdC5TcGlubmVyACgoQmFzZS5XaWRnZXQuQXBwQ29tcGF0LlNwaW5u
ZXIuVW5kZXJsaW5lZAAeHkJhc2UuV2lkZ2V0LkFwcENvbXBhdC5UZXh0VmlldwAqKkJhc2UuV2lk
Z2V0LkFwcENvbXBhdC5UZXh0Vmlldy5TcGlubmVySXRlbQAdHUJhc2UuV2lkZ2V0LkFwcENvbXBh
dC5Ub29sYmFyAC8vQmFzZS5XaWRnZXQuQXBwQ29tcGF0LlRvb2xiYXIuQnV0dG9uLk5hdmlnYXRp
b24AERFEaWFsb2dXaW5kb3dUaGVtZQATE0Zsb2F0aW5nRGlhbG9nVGhlbWUAGRlGbG9hdGluZ0Rp
YWxvZ1dpbmRvd1RoZW1lABISUGxhdGZvcm0uQXBwQ29tcGF0ABgYUGxhdGZvcm0uQXBwQ29tcGF0
LkxpZ2h0AB8fUGxhdGZvcm0uVGhlbWVPdmVybGF5LkFwcENvbXBhdAAkJFBsYXRmb3JtLlRoZW1l
T3ZlcmxheS5BcHBDb21wYXQuRGFyawAlJVBsYXRmb3JtLlRoZW1lT3ZlcmxheS5BcHBDb21wYXQu
TGlnaHQAFhZQbGF0Zm9ybS5WMjEuQXBwQ29tcGF0ABwcUGxhdGZvcm0uVjIxLkFwcENvbXBhdC5M
aWdodAAWFlBsYXRmb3JtLlYyNS5BcHBDb21wYXQAHBxQbGF0Zm9ybS5WMjUuQXBwQ29tcGF0Lkxp
Z2h0ACEhUGxhdGZvcm0uV2lkZ2V0LkFwcENvbXBhdC5TcGlubmVyACYmUnRsT3ZlcmxheS5EaWFs
b2dXaW5kb3dUaXRsZS5BcHBDb21wYXQALy9SdGxPdmVybGF5LldpZGdldC5BcHBDb21wYXQuQWN0
aW9uQmFyLlRpdGxlSXRlbQAsLFJ0bE92ZXJsYXkuV2lkZ2V0LkFwcENvbXBhdC5EaWFsb2dUaXRs
ZS5JY29uACkpUnRsT3ZlcmxheS5XaWRnZXQuQXBwQ29tcGF0LlBvcHVwTWVudUl0ZW0ANzdSdGxP
dmVybGF5LldpZGdldC5BcHBDb21wYXQuUG9wdXBNZW51SXRlbS5JbnRlcm5hbEdyb3VwADIyUnRs
T3ZlcmxheS5XaWRnZXQuQXBwQ29tcGF0LlBvcHVwTWVudUl0ZW0uU2hvcnRjdXQANjZSdGxPdmVy
bGF5LldpZGdldC5BcHBDb21wYXQuUG9wdXBNZW51SXRlbS5TdWJtZW51QXJyb3cALi5SdGxPdmVy
bGF5LldpZGdldC5BcHBDb21wYXQuUG9wdXBNZW51SXRlbS5UZXh0AC8vUnRsT3ZlcmxheS5XaWRn
ZXQuQXBwQ29tcGF0LlBvcHVwTWVudUl0ZW0uVGl0bGUAKytSdGxPdmVybGF5LldpZGdldC5BcHBD
b21wYXQuU2VhcmNoLkRyb3BEb3duADExUnRsT3ZlcmxheS5XaWRnZXQuQXBwQ29tcGF0LlNlYXJj
aC5Ecm9wRG93bi5JY29uMQAxMVJ0bE92ZXJsYXkuV2lkZ2V0LkFwcENvbXBhdC5TZWFyY2guRHJv
cERvd24uSWNvbjIAMTFSdGxPdmVybGF5LldpZGdldC5BcHBDb21wYXQuU2VhcmNoLkRyb3BEb3du
LlF1ZXJ5ADAwUnRsT3ZlcmxheS5XaWRnZXQuQXBwQ29tcGF0LlNlYXJjaC5Ecm9wRG93bi5UZXh0
AC4uUnRsT3ZlcmxheS5XaWRnZXQuQXBwQ29tcGF0LlNlYXJjaFZpZXcuTWFnSWNvbgApKVJ0bFVu
ZGVybGF5LldpZGdldC5BcHBDb21wYXQuQWN0aW9uQnV0dG9uADIyUnRsVW5kZXJsYXkuV2lkZ2V0
LkFwcENvbXBhdC5BY3Rpb25CdXR0b24uT3ZlcmZsb3cAGBhUZXh0QXBwZWFyYW5jZS5BcHBDb21w
YXQAHh5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuQm9keTEAHh5UZXh0QXBwZWFyYW5jZS5BcHBD
b21wYXQuQm9keTIAHx9UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuQnV0dG9uACAgVGV4dEFwcGVh
cmFuY2UuQXBwQ29tcGF0LkNhcHRpb24AISFUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuRGlzcGxh
eTEAISFUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuRGlzcGxheTIAISFUZXh0QXBwZWFyYW5jZS5B
cHBDb21wYXQuRGlzcGxheTMAISFUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuRGlzcGxheTQAISFU
ZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuSGVhZGxpbmUAICBUZXh0QXBwZWFyYW5jZS5BcHBDb21w
YXQuSW52ZXJzZQAeHlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5MYXJnZQAmJlRleHRBcHBlYXJh
bmNlLkFwcENvbXBhdC5MYXJnZS5JbnZlcnNlADQ0VGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0Lkxp
Z2h0LlNlYXJjaFJlc3VsdC5TdWJ0aXRsZQAxMVRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5MaWdo
dC5TZWFyY2hSZXN1bHQuVGl0bGUANTVUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuTGlnaHQuV2lk
Z2V0LlBvcHVwTWVudS5MYXJnZQA1NVRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5MaWdodC5XaWRn
ZXQuUG9wdXBNZW51LlNtYWxsAB8fVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0Lk1lZGl1bQAnJ1Rl
eHRBcHBlYXJhbmNlLkFwcENvbXBhdC5NZWRpdW0uSW52ZXJzZQAdHVRleHRBcHBlYXJhbmNlLkFw
cENvbXBhdC5NZW51AC4uVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LlNlYXJjaFJlc3VsdC5TdWJ0
aXRsZQArK1RleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5TZWFyY2hSZXN1bHQuVGl0bGUAHh5UZXh0
QXBwZWFyYW5jZS5BcHBDb21wYXQuU21hbGwAJiZUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuU21h
bGwuSW52ZXJzZQAgIFRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5TdWJoZWFkACgoVGV4dEFwcGVh
cmFuY2UuQXBwQ29tcGF0LlN1YmhlYWQuSW52ZXJzZQAeHlRleHRBcHBlYXJhbmNlLkFwcENvbXBh
dC5UaXRsZQAmJlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5UaXRsZS5JbnZlcnNlACAgVGV4dEFw
cGVhcmFuY2UuQXBwQ29tcGF0LlRvb2x0aXAALi5UZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lk
Z2V0LkFjdGlvbkJhci5NZW51ADIyVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LldpZGdldC5BY3Rp
b25CYXIuU3VidGl0bGUAOjpUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lkZ2V0LkFjdGlvbkJh
ci5TdWJ0aXRsZS5JbnZlcnNlAC8vVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LldpZGdldC5BY3Rp
b25CYXIuVGl0bGUANzdUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lkZ2V0LkFjdGlvbkJhci5U
aXRsZS5JbnZlcnNlADMzVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LldpZGdldC5BY3Rpb25Nb2Rl
LlN1YnRpdGxlADs7VGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LldpZGdldC5BY3Rpb25Nb2RlLlN1
YnRpdGxlLkludmVyc2UAMDBUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lkZ2V0LkFjdGlvbk1v
ZGUuVGl0bGUAODhUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lkZ2V0LkFjdGlvbk1vZGUuVGl0
bGUuSW52ZXJzZQAmJlRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5XaWRnZXQuQnV0dG9uADk5VGV4
dEFwcGVhcmFuY2UuQXBwQ29tcGF0LldpZGdldC5CdXR0b24uQm9yZGVybGVzcy5Db2xvcmVkAC4u
VGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LldpZGdldC5CdXR0b24uQ29sb3JlZAAuLlRleHRBcHBl
YXJhbmNlLkFwcENvbXBhdC5XaWRnZXQuQnV0dG9uLkludmVyc2UALCxUZXh0QXBwZWFyYW5jZS5B
cHBDb21wYXQuV2lkZ2V0LkRyb3BEb3duSXRlbQAwMFRleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5X
aWRnZXQuUG9wdXBNZW51LkhlYWRlcgAvL1RleHRBcHBlYXJhbmNlLkFwcENvbXBhdC5XaWRnZXQu
UG9wdXBNZW51LkxhcmdlAC8vVGV4dEFwcGVhcmFuY2UuQXBwQ29tcGF0LldpZGdldC5Qb3B1cE1l
bnUuU21hbGwAJiZUZXh0QXBwZWFyYW5jZS5BcHBDb21wYXQuV2lkZ2V0LlN3aXRjaAA0NFRleHRB
cHBlYXJhbmNlLkFwcENvbXBhdC5XaWRnZXQuVGV4dFZpZXcuU3Bpbm5lckl0ZW0AIiJUZXh0QXBw
ZWFyYW5jZS5Db21wYXQuTm90aWZpY2F0aW9uACcnVGV4dEFwcGVhcmFuY2UuQ29tcGF0Lk5vdGlm
aWNhdGlvbi5JbmZvACgoVGV4dEFwcGVhcmFuY2UuQ29tcGF0Lk5vdGlmaWNhdGlvbi5MaW5lMgAn
J1RleHRBcHBlYXJhbmNlLkNvbXBhdC5Ob3RpZmljYXRpb24uVGltZQAoKFRleHRBcHBlYXJhbmNl
LkNvbXBhdC5Ob3RpZmljYXRpb24uVGl0bGUAMTFUZXh0QXBwZWFyYW5jZS5XaWRnZXQuQXBwQ29t
cGF0LkV4cGFuZGVkTWVudS5JdGVtADAwVGV4dEFwcGVhcmFuY2UuV2lkZ2V0LkFwcENvbXBhdC5U
b29sYmFyLlN1YnRpdGxlAC0tVGV4dEFwcGVhcmFuY2UuV2lkZ2V0LkFwcENvbXBhdC5Ub29sYmFy
LlRpdGxlAA8PVGhlbWUuQXBwQ29tcGF0ABsbVGhlbWUuQXBwQ29tcGF0LkNvbXBhY3RNZW51ABgY
VGhlbWUuQXBwQ29tcGF0LkRheU5pZ2h0ACYmVGhlbWUuQXBwQ29tcGF0LkRheU5pZ2h0LkRhcmtB
Y3Rpb25CYXIAHx9UaGVtZS5BcHBDb21wYXQuRGF5TmlnaHQuRGlhbG9nACUlVGhlbWUuQXBwQ29t
cGF0LkRheU5pZ2h0LkRpYWxvZy5BbGVydAAoKFRoZW1lLkFwcENvbXBhdC5EYXlOaWdodC5EaWFs
b2cuTWluV2lkdGgAKChUaGVtZS5BcHBDb21wYXQuRGF5TmlnaHQuRGlhbG9nV2hlbkxhcmdlACQk
VGhlbWUuQXBwQ29tcGF0LkRheU5pZ2h0Lk5vQWN0aW9uQmFyABYWVGhlbWUuQXBwQ29tcGF0LkRp
YWxvZwAcHFRoZW1lLkFwcENvbXBhdC5EaWFsb2cuQWxlcnQAHx9UaGVtZS5BcHBDb21wYXQuRGlh
bG9nLk1pbldpZHRoAB8fVGhlbWUuQXBwQ29tcGF0LkRpYWxvZ1doZW5MYXJnZQAVFVRoZW1lLkFw
cENvbXBhdC5FbXB0eQAVFVRoZW1lLkFwcENvbXBhdC5MaWdodAAjI1RoZW1lLkFwcENvbXBhdC5M
aWdodC5EYXJrQWN0aW9uQmFyABwcVGhlbWUuQXBwQ29tcGF0LkxpZ2h0LkRpYWxvZwAiIlRoZW1l
LkFwcENvbXBhdC5MaWdodC5EaWFsb2cuQWxlcnQAJSVUaGVtZS5BcHBDb21wYXQuTGlnaHQuRGlh
bG9nLk1pbldpZHRoACUlVGhlbWUuQXBwQ29tcGF0LkxpZ2h0LkRpYWxvZ1doZW5MYXJnZQAhIVRo
ZW1lLkFwcENvbXBhdC5MaWdodC5Ob0FjdGlvbkJhcgAbG1RoZW1lLkFwcENvbXBhdC5Ob0FjdGlv
bkJhcgATE1RoZW1lLk15QXBwbGljYXRpb24AFhZUaGVtZU92ZXJsYXkuQXBwQ29tcGF0ACAgVGhl
bWVPdmVybGF5LkFwcENvbXBhdC5BY3Rpb25CYXIAGxtUaGVtZU92ZXJsYXkuQXBwQ29tcGF0LkRh
cmsAJSVUaGVtZU92ZXJsYXkuQXBwQ29tcGF0LkRhcmsuQWN0aW9uQmFyAB8fVGhlbWVPdmVybGF5
LkFwcENvbXBhdC5EYXlOaWdodAApKVRoZW1lT3ZlcmxheS5BcHBDb21wYXQuRGF5TmlnaHQuQWN0
aW9uQmFyAB0dVGhlbWVPdmVybGF5LkFwcENvbXBhdC5EaWFsb2cAIyNUaGVtZU92ZXJsYXkuQXBw
Q29tcGF0LkRpYWxvZy5BbGVydAAcHFRoZW1lT3ZlcmxheS5BcHBDb21wYXQuTGlnaHQAGhpXaWRn
ZXQuQXBwQ29tcGF0LkFjdGlvbkJhcgAgIFdpZGdldC5BcHBDb21wYXQuQWN0aW9uQmFyLlNvbGlk
ACEhV2lkZ2V0LkFwcENvbXBhdC5BY3Rpb25CYXIuVGFiQmFyACIiV2lkZ2V0LkFwcENvbXBhdC5B
Y3Rpb25CYXIuVGFiVGV4dAAiIldpZGdldC5BcHBDb21wYXQuQWN0aW9uQmFyLlRhYlZpZXcAHR1X
aWRnZXQuQXBwQ29tcGF0LkFjdGlvbkJ1dHRvbgAnJ1dpZGdldC5BcHBDb21wYXQuQWN0aW9uQnV0
dG9uLkNsb3NlTW9kZQAmJldpZGdldC5BcHBDb21wYXQuQWN0aW9uQnV0dG9uLk92ZXJmbG93ABsb
V2lkZ2V0LkFwcENvbXBhdC5BY3Rpb25Nb2RlACQkV2lkZ2V0LkFwcENvbXBhdC5BY3Rpdml0eUNo
b29zZXJWaWV3ACUlV2lkZ2V0LkFwcENvbXBhdC5BdXRvQ29tcGxldGVUZXh0VmlldwAXF1dpZGdl
dC5BcHBDb21wYXQuQnV0dG9uACIiV2lkZ2V0LkFwcENvbXBhdC5CdXR0b24uQm9yZGVybGVzcwAq
KldpZGdldC5BcHBDb21wYXQuQnV0dG9uLkJvcmRlcmxlc3MuQ29sb3JlZAAtLVdpZGdldC5BcHBD
b21wYXQuQnV0dG9uLkJ1dHRvbkJhci5BbGVydERpYWxvZwAfH1dpZGdldC5BcHBDb21wYXQuQnV0
dG9uLkNvbG9yZWQAHR1XaWRnZXQuQXBwQ29tcGF0LkJ1dHRvbi5TbWFsbAAaGldpZGdldC5BcHBD
b21wYXQuQnV0dG9uQmFyACYmV2lkZ2V0LkFwcENvbXBhdC5CdXR0b25CYXIuQWxlcnREaWFsb2cA
KChXaWRnZXQuQXBwQ29tcGF0LkNvbXBvdW5kQnV0dG9uLkNoZWNrQm94ACsrV2lkZ2V0LkFwcENv
bXBhdC5Db21wb3VuZEJ1dHRvbi5SYWRpb0J1dHRvbgAmJldpZGdldC5BcHBDb21wYXQuQ29tcG91
bmRCdXR0b24uU3dpdGNoACIiV2lkZ2V0LkFwcENvbXBhdC5EcmF3ZXJBcnJvd1RvZ2dsZQAlJVdp
ZGdldC5BcHBDb21wYXQuRHJvcERvd25JdGVtLlNwaW5uZXIAGRlXaWRnZXQuQXBwQ29tcGF0LkVk
aXRUZXh0ABwcV2lkZ2V0LkFwcENvbXBhdC5JbWFnZUJ1dHRvbgAgIFdpZGdldC5BcHBDb21wYXQu
TGlnaHQuQWN0aW9uQmFyACYmV2lkZ2V0LkFwcENvbXBhdC5MaWdodC5BY3Rpb25CYXIuU29saWQA
Li5XaWRnZXQuQXBwQ29tcGF0LkxpZ2h0LkFjdGlvbkJhci5Tb2xpZC5JbnZlcnNlACcnV2lkZ2V0
LkFwcENvbXBhdC5MaWdodC5BY3Rpb25CYXIuVGFiQmFyAC8vV2lkZ2V0LkFwcENvbXBhdC5MaWdo
dC5BY3Rpb25CYXIuVGFiQmFyLkludmVyc2UAKChXaWRnZXQuQXBwQ29tcGF0LkxpZ2h0LkFjdGlv
bkJhci5UYWJUZXh0ADAwV2lkZ2V0LkFwcENvbXBhdC5MaWdodC5BY3Rpb25CYXIuVGFiVGV4dC5J
bnZlcnNlACgoV2lkZ2V0LkFwcENvbXBhdC5MaWdodC5BY3Rpb25CYXIuVGFiVmlldwAwMFdpZGdl
dC5BcHBDb21wYXQuTGlnaHQuQWN0aW9uQmFyLlRhYlZpZXcuSW52ZXJzZQAjI1dpZGdldC5BcHBD
b21wYXQuTGlnaHQuQWN0aW9uQnV0dG9uAC0tV2lkZ2V0LkFwcENvbXBhdC5MaWdodC5BY3Rpb25C
dXR0b24uQ2xvc2VNb2RlACwsV2lkZ2V0LkFwcENvbXBhdC5MaWdodC5BY3Rpb25CdXR0b24uT3Zl
cmZsb3cAKSlXaWRnZXQuQXBwQ29tcGF0LkxpZ2h0LkFjdGlvbk1vZGUuSW52ZXJzZQAqKldpZGdl
dC5BcHBDb21wYXQuTGlnaHQuQWN0aXZpdHlDaG9vc2VyVmlldwArK1dpZGdldC5BcHBDb21wYXQu
TGlnaHQuQXV0b0NvbXBsZXRlVGV4dFZpZXcAKytXaWRnZXQuQXBwQ29tcGF0LkxpZ2h0LkRyb3BE
b3duSXRlbS5TcGlubmVyACYmV2lkZ2V0LkFwcENvbXBhdC5MaWdodC5MaXN0UG9wdXBXaW5kb3cA
KChXaWRnZXQuQXBwQ29tcGF0LkxpZ2h0Lkxpc3RWaWV3LkRyb3BEb3duACAgV2lkZ2V0LkFwcENv
bXBhdC5MaWdodC5Qb3B1cE1lbnUAKSlXaWRnZXQuQXBwQ29tcGF0LkxpZ2h0LlBvcHVwTWVudS5P
dmVyZmxvdwAhIVdpZGdldC5BcHBDb21wYXQuTGlnaHQuU2VhcmNoVmlldwAxMVdpZGdldC5BcHBD
b21wYXQuTGlnaHQuU3Bpbm5lci5Ecm9wRG93bi5BY3Rpb25CYXIAHR1XaWRnZXQuQXBwQ29tcGF0
Lkxpc3RNZW51VmlldwAgIFdpZGdldC5BcHBDb21wYXQuTGlzdFBvcHVwV2luZG93ABkZV2lkZ2V0
LkFwcENvbXBhdC5MaXN0VmlldwAiIldpZGdldC5BcHBDb21wYXQuTGlzdFZpZXcuRHJvcERvd24A
Hh5XaWRnZXQuQXBwQ29tcGF0Lkxpc3RWaWV3Lk1lbnUAGhpXaWRnZXQuQXBwQ29tcGF0LlBvcHVw
TWVudQAjI1dpZGdldC5BcHBDb21wYXQuUG9wdXBNZW51Lk92ZXJmbG93ABwcV2lkZ2V0LkFwcENv
bXBhdC5Qb3B1cFdpbmRvdwAcHFdpZGdldC5BcHBDb21wYXQuUHJvZ3Jlc3NCYXIAJydXaWRnZXQu
QXBwQ29tcGF0LlByb2dyZXNzQmFyLkhvcml6b250YWwAGhpXaWRnZXQuQXBwQ29tcGF0LlJhdGlu
Z0JhcgAkJFdpZGdldC5BcHBDb21wYXQuUmF0aW5nQmFyLkluZGljYXRvcgAgIFdpZGdldC5BcHBD
b21wYXQuUmF0aW5nQmFyLlNtYWxsABsbV2lkZ2V0LkFwcENvbXBhdC5TZWFyY2hWaWV3ACUlV2lk
Z2V0LkFwcENvbXBhdC5TZWFyY2hWaWV3LkFjdGlvbkJhcgAYGFdpZGdldC5BcHBDb21wYXQuU2Vl
a0JhcgAhIVdpZGdldC5BcHBDb21wYXQuU2Vla0Jhci5EaXNjcmV0ZQAYGFdpZGdldC5BcHBDb21w
YXQuU3Bpbm5lcgAhIVdpZGdldC5BcHBDb21wYXQuU3Bpbm5lci5Ecm9wRG93bgArK1dpZGdldC5B
cHBDb21wYXQuU3Bpbm5lci5Ecm9wRG93bi5BY3Rpb25CYXIAIyNXaWRnZXQuQXBwQ29tcGF0LlNw
aW5uZXIuVW5kZXJsaW5lZAAZGVdpZGdldC5BcHBDb21wYXQuVGV4dFZpZXcAJSVXaWRnZXQuQXBw
Q29tcGF0LlRleHRWaWV3LlNwaW5uZXJJdGVtABgYV2lkZ2V0LkFwcENvbXBhdC5Ub29sYmFyACoq
V2lkZ2V0LkFwcENvbXBhdC5Ub29sYmFyLkJ1dHRvbi5OYXZpZ2F0aW9uACkpV2lkZ2V0LkNvbXBh
dC5Ob3RpZmljYXRpb25BY3Rpb25Db250YWluZXIAJCRXaWRnZXQuQ29tcGF0Lk5vdGlmaWNhdGlv
bkFjdGlvblRleHQADAxiYWNrdXBfcnVsZXMAFRVkYXRhX2V4dHJhY3Rpb25fcnVsZXMAAgIQAHQA
AAABAAAAGQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAlQA
SAIAAAEAAAAZAAAAuAAAAEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAA
AACQAAAAoAAAALAAAADAAAAA0AAAAOAAAADwAAAAAAEAABABAAAgAQAAMAEAAEABAABQAQAAYAEA
AHABAACAAQAACAAAAAAAAAAIAAADBAAAAAgAAAABAAAACAAAAwUAAAAIAAAAAgAAAAgAAAMGAAAA
CAAAAAMAAAAIAAADBwAAAAgAAAAEAAAACAAAAwgAAAAIAAAABQAAAAgAAAMJAAAACAAAAAYAAAAI
AAADCgAAAAgAAAAHAAAACAAAAwsAAAAIAAAACAAAAAgAAAMMAAAACAAAAAkAAAAIAAADDQAAAAgA
AAAKAAAACAAAAw4AAAAIAAAACwAAAAgAAAMPAAAACAAAAAwAAAAIAAADEAAAAAgAAAANAAAACAAA
AxEAAAAIAAAADgAAAAgAAAMSAAAACAAAAA8AAAAIAAADEwAAAAgAAAAQAAAACAAAAxQAAAAIAAAA
EQAAAAgAAAMVAAAACAAAABIAAAAIAAADFgAAAAgAAAATAAAACAAAAxcAAAAIAAAAFAAAAAgAAAMY
AAAACAAAABUAAAAIAAADGQAAAAgAAAAWAAAACAAAAxoAAAAIAAAAFwAAAAgAAAMbAAAACAAAABgA
AAAIAAADAwAAAAICEAAoAAAAAgAAAAYAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAlQAzAAA
AAIAAAAGAAAAbAAAAEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEAAAACAAAAAwAAAAQAAAAFAAAAAIAAAAGQAAAAgAAAMc
AAAACAAAABoAAAAIAAADHQAAAAgAAAAbAAAACAAAAx4AAAAIAAAAHAAAAAgAAAMfAAAACAAAAB0A
AAAIAAADIAAAAAgAAAAeAAAACAAAAyEAAAACAhAAhAQAAAMAAAAdAQAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQJUACwoAAADAAAAHQEA
AMgEAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAABwAAAA4AAAAVAAAAHwAAACYAAAAtAAAANAAAADsAAAACAEAACQBAABA
AQAAXAEAAHgBAACUAQAAsAEAAMwBAADoAQAABAIAACACAAA8AgAAWAIAAHQCAACQAgAArAIAAMgC
AADkAgAAAAMAABwDAAA4AwAAVAMAAHADAACMAwAAqAMAAMQDAADgAwAA/AMAABgEAAA0BAAAUAQA
AGwEAACIBAAApAQAAAgFAAAkBQAAQAUAAFwFAAB4BQAAlAUAALAFAADMBQAAAAYAABwGAAA4BgAA
VAYAAHAGAADUBgAA8AYAAAwHAAAoBwAARAcAAGAHAAB8BwAAmAcAALQHAAD0BwAAEAgAACwIAABI
CAAAZAgAAIAIAADkCAAAAAkAABwJAAA4CQAAVAkAAHAJAACMCQAAqAkAAMQJAADgCQAA/AkAABgK
AAA0CgAAUAoAAGwKAACICgAApAoAAMAKAADcCgAA+AoAABQLAAAwCwAATAsAAGgLAACECwAAoAsA
ALwLAADYCwAA9AsAABAMAAAsDAAASAwAALgMAADUDAAA8AwAAAwNAAAoDQAARA0AAGANAAB8DQAA
mA0AALQNAADQDQAA7A0AAFAOAABsDgAAiA4AAKQOAADADgAA3A4AAPgOAAAUDwAAMA8AAEwPAABo
DwAAhA8AAKAPAAC8DwAA2A8AAAwQAAA0EAAAUBAAAGwQAACIEAAAvBAAANgQAAD0EAAAEBEAACwR
AABIEQAAZBEAAIARAACcEQAAuBEAANQRAAA4EgAAVBIAAHASAACMEgAAqBIAAMQSAADgEgAA/BIA
ABgTAAA0EwAAUBMAAGwTAACIEwAApBMAAMATAADcEwAA+BMAABQUAAAwFAAATBQAAGgUAACEFAAA
oBQAALwUAADYFAAA9BQAABAVAAAsFQAASBUAAGQVAACAFQAAnBUAALgVAADUFQAAFBYAADAWAACU
FgAAsBYAAMwWAADoFgAABBcAACAXAAA8FwAAWBcAAHQXAACQFwAArBcAAMgXAADkFwAAABgAABwY
AAA4GAAAVBgAAHAYAACMGAAAqBgAAMQYAADgGAAA/BgAABgZAAA0GQAAUBkAAGwZAACIGQAApBkA
APwZAABIGgAAZBoAAIAaAACcGgAAuBoAANQaAADwGgAADBsAACgbAABEGwAAYBsAAHwbAACYGwAA
tBsAANAbAADsGwAACBwAACQcAABAHAAAXBwAAHgcAACUHAAAsBwAAMwcAADoHAAABB0AACAdAAA8
HQAAWB0AAHQdAACQHQAArB0AAMgdAADkHQAAAB4AABweAAA4HgAAnB4AALgeAADUHgAAOB8AAFQf
AAC4HwAA1B8AAPAfAAAMIAAAKCAAAEQgAABgIAAAfCAAAJggAAC0IAAA0CAAAOwgAAAIIQAAJCEA
AEAhAABcIQAAeCEAAJQhAAD4IQAAFCIAADAiAABMIgAAaCIAAIQiAACgIgAAvCIAANgiAAD0IgAA
ECMAACwjAABIIwAAEAABAB8AAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQAgAAAAAAAAAAEAAAAA
AAABCAAAEAEAAAAQAAEAIQAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABACIAAAAAAAAAAgAAAAAA
AAEIAAAQQAABALwACH8IAAAQAAAAABAAAQAjAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAJAAA
AAAAAAABAAAAAAAAAQgAABABAAAAEAABACUAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQAmAAAA
AAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAJwAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABACgAAAAA
AAAAAQAAAAAAAAEIAAAQAQAAABAAAQApAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAKgAAAAAA
AAABAAAAAAAAAQgAABABAAAAEAABACsAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQAsAAAAAAAA
AAEAAAAAAAABCAAAEAEAAAAQAAEALQAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAC4AAAAAAAAA
AQAAAAAAAAEIAAAQEQAAABAAAQAvAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAMAAAAAAAAAAB
AAAAAAAAAQgAABABAAAAEAABADEAAAAAAAAAAQAAAAAAAAEIAAAQAgAAABAAAQAyAAAAAAAAAAEA
AAAAAAABCAAAEAEAAAAQAAEAMwAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABADQAAAAAAAAAAQAA
AAAAAAEIAAAQAQAAABAAAQA1AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEANgAAAAAAAAABAAAA
AAAAAQgAABABAAAAEAABADcAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQA4AAAAAAAAAAEAAAAA
AAABCAAAEAEAAAAQAAEAOQAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABADoAAAAAAAAAAQAAAAAA
AAEIAAAQAQAAABAAAQA7AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAPAAAAAAAAAABAAAAAAAA
AQgAABABAAAAEAABAD0AAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQA+AAAAAAAAAAEAAAAAAAAB
CAAAEAEAAAAQAAEAPwAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAEAAAAAAAAAAAQAAAAAAAAEI
AAAQAgAAABAAAQBBAAAAAAAAAAEAAAAAAAABCAAAEAIAAAAQAAEAQgAAAAAAAAABAAAAAAAAAQgA
ABABAAAAEAABAEMAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQBEAAAAAAAAAAEAAAAAAAABCAAA
EAgAAAAQAAEARQAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAEYAAAAAAAAAAQAAAAAAAAEIAAAQ
AQAAABAAAQBHAAAAAAAAAAEAAAAAAAABCAAAEAgAAAAQAAEASAAAAAAAAAABAAAAAAAAAQgAABAg
AAAAEAABAEkAAAAAAAAABwAAAAAAAAEIAAAQAAACAAMACH8IAAARAAABAAEACH8IAAARABAAAAAA
CH8IAAARAgAAAAQACH8IAAARAQAAAAUACH8IAAARBAAAAAIACH8IAAARCAAAABAAAQBKAAAAAAAA
AAEAAAAAAAABCAAAEEAAAAAQAAEASwAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAABAEwAAAAAAAAA
AQAAAAAAAAEIAAAQAQAAABAAAQBNAAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQAAEATgAAAAAAAAAB
AAAAAAAAAQgAABBAAAAAEAABAE8AAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQBQAAAAAAAAAAEA
AAAAAAABCAAAEEAAAAAQAAEAUQAAAAAAAAADAAAAAAAAAQgAABAAAAEAbwAIfwgAABAAAAAAswAI
fwgAABABAAAAEAABAFIAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQBTAAAAAAAAAAEAAAAAAAAB
CAAAEBEAAAAQAAEAVAAAAAAAAAABAAAAAAAAAQgAABARAAAAEAABAFUAAAAAAAAAAQAAAAAAAAEI
AAAQEAAAABAAAQBWAAAAAAAAAAcAAAAAAAABCAAAEAAAAQCWAAh/CAAAEAMAAACVAAh/CAAAEAUA
AACUAAh/CAAAEAkAAABtAAh/CAAAEA4AAAB+AAh/CAAAEA8AAAA6AAh/CAAAEBAAAAAQAAEAVwAA
AAAAAAABAAAAAAAAAQgAABBAAAAAEAABAFgAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQBZAAAA
AAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAWgAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAFsAAAAA
AAAAAQAAAAAAAAEIAAAQAQAAABAAAQBcAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAXQAAAAAA
AAABAAAAAAAAAQgAABABAAAAEAABAF4AAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQBfAAAAAAAA
AAQAAAAAAAABCAAAEAAAAgBEAAh/CAAAERAAAACwAAh/CAAAETAAAABBAAh/CAAAEVAAAAAQAAEA
YAAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAABAGEAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQBi
AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAYwAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAGQA
AAAAAAAAAQAAAAAAAAEIAAAQEAAAABAAAQBlAAAAAAAAAAcAAAAAAAABCAAAEAAAAQCWAAh/CAAA
EAMAAACVAAh/CAAAEAUAAACUAAh/CAAAEAkAAABtAAh/CAAAEA4AAAB+AAh/CAAAEA8AAAA6AAh/
CAAAEBAAAAAQAAEAZgAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAGcAAAAAAAAAAQAAAAAAAAEI
AAAQAQAAABAAAQBoAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAaQAAAAAAAAABAAAAAAAAAQgA
ABABAAAAEAABAGoAAAAAAAAAAQAAAAAAAAEIAAAQAgAAABAAAQBrAAAAAAAAAAEAAAAAAAABCAAA
EAEAAAAQAAEAbAAAAAAAAAABAAAAAAAAAQgAABAQAAAAEAABAG0AAAAAAAAAAQAAAAAAAAEIAAAQ
EAAAABAAAQBuAAAAAAAAAAEAAAAAAAABCAAAEBAAAAAQAAEAbwAAAAAAAAABAAAAAAAAAQgAABAQ
AAAAEAABAHAAAAAAAAAAAQAAAAAAAAEIAAAQEAAAABAAAQBxAAAAAAAAAAEAAAAAAAABCAAAEBAA
AAAQAAEAcgAAAAAAAAABAAAAAAAAAQgAABAQAAAAEAABAHMAAAAAAAAAAQAAAAAAAAEIAAAQEQAA
ABAAAQB0AAAAAAAAAAEAAAAAAAABCAAAEBAAAAAQAAEAdQAAAAAAAAABAAAAAAAAAQgAABAQAAAA
EAABAHYAAAAAAAAAAQAAAAAAAAEIAAAQEAAAABAAAQB3AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQ
AAEAeAAAAAAAAAABAAAAAAAAAQgAABACAAAAEAABAHkAAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAA
AQB6AAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQAAEAewAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAAB
AHwAAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAAAQB9AAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQAAEA
fgAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAABAH8AAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQCA
AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAgQAAAAAAAAABAAAAAAAAAQgAABACAAAAEAABAIIA
AAAAAAAAAQAAAAAAAAEIAAAQQAAAABAAAQCDAAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQAAEAhAAA
AAAAAAABAAAAAAAAAQgAABABAAAAEAABAIUAAAAAAAAACAAAAAAAAAEIAAAQAAACAG8ACH8IAAAQ
AAAAALUACH8IAAARAQAAAI8ACH8IAAARAgAAAF4ACH8IAAARBAAAAJAACH8IAAARCAAAAI4ACH8I
AAAREAAAAFIACH8IAAARIAAAABAAAQCGAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAhwAAAAAA
AAABAAAAAAAAAQgAABABAAAAEAABAIgAAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAAAQCJAAAAAAAA
AAEAAAAAAAABCAAAEAEAAAAQAAEAigAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAIsAAAAAAAAA
AQAAAAAAAAEIAAAQAQAAABAAAQCMAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAjQAAAAAAAAAB
AAAAAAAAAQgAABABAAAAEAABAI4AAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAAAQCPAAAAAAAAAAEA
AAAAAAABCAAAEAEAAAAQAAEAkAAAAAAAAAABAAAAAAAAAQgAABAQAAAAEAABAJEAAAAAAAAABwAA
AAAAAAEIAAAQAAABAJYACH8IAAAQAwAAAJUACH8IAAAQBQAAAJQACH8IAAAQCQAAAG0ACH8IAAAQ
DgAAAH4ACH8IAAAQDwAAADoACH8IAAAQEAAAABAAAQCSAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQ
AAEAkwAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAJQAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAA
AQCVAAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQAAEAlgAAAAAAAAABAAAAAAAAAQgAABABAAAAEAAB
AJcAAAAAAAAAAQAAAAAAAAEIAAAQEQAAABAAAQCYAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEA
mQAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAABAJoAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQCb
AAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQAAEAnAAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAJ0A
AAAAAAAAAQAAAAAAAAEIAAAQAgAAABAAAQCeAAAAAAAAAAEAAAAAAAABCAAAEAIAAAAQAAEAnwAA
AAAAAAABAAAAAAAAAQgAABABAAAAEAABAKAAAAAAAAAAAwAAAAAAAAEIAAAQAAABAEAACH8IAAAQ
AAAAAD4ACH8IAAAQAQAAABAAAQChAAAAAAAAAAIAAAAAAAABCAAAEAQAAQBZAAh/CAAAEP////8Q
AAEAogAAAAAAAAABAAAAAAAAAQgAABACAAAAEAABAKMAAAAAAAAAAQAAAAAAAAEIAAAQAgAAABAA
AQCkAAAAAAAAAAEAAAAAAAABCAAAEAIAAAAQAAEApQAAAAAAAAADAAAAAAAAAQgAABAAAAEAcAAI
fwgAABAAAAAAZgAIfwgAABABAAAAEAABAKYAAAAAAAAAAQAAAAAAAAEIAAAQAgAAABAAAQCnAAAA
AAAAAAEAAAAAAAABCAAAEAQAAAAQAAEAqAAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAABAKkAAAAA
AAAAAQAAAAAAAAEIAAAQAQAAABAAAQCqAAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQAAEAqwAAAAAA
AAABAAAAAAAAAQgAABAIAAAAEAABAKwAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQCtAAAAAAAA
AAEAAAAAAAABCAAAEAEAAAAQAAEArgAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAK8AAAAAAAAA
AQAAAAAAAAEIAAAQEAAAABAAAQCwAAAAAAAAAAcAAAAAAAABCAAAEAAAAQCWAAh/CAAAEAMAAACV
AAh/CAAAEAUAAACUAAh/CAAAEAkAAABtAAh/CAAAEA4AAAB+AAh/CAAAEA8AAAA6AAh/CAAAEBAA
AAAQAAEAsQAAAAAAAAABAAAAAAAAAQgAABAIAAAAEAABALIAAAAAAAAAAQAAAAAAAAEIAAAQAQAA
ABAAAQCzAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAtAAAAAAAAAABAAAAAAAAAQgAABACAAAA
EAABALUAAAAAAAAAAQAAAAAAAAEIAAAQCAAAABAAAQC2AAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQ
AAEAtwAAAAAAAAABAAAAAAAAAQgAABAgAAAAEAABALgAAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAA
AQC5AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAugAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAAB
ALsAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQC8AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEA
vQAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAL4AAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQC/
AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAwAAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAMEA
AAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQDCAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAwwAA
AAAAAAABAAAAAAAAAQgAABBAAAAAEAABAMQAAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAAAQDFAAAA
AAAAAAEAAAAAAAABCAAAEEAAAAAQAAEAxgAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAABAMcAAAAA
AAAAAQAAAAAAAAEIAAAQQAAAABAAAQDIAAAAAAAAAAEAAAAAAAABCAAAEEAAAAAQAAEAyQAAAAAA
AAABAAAAAAAAAQgAABBAAAAAEAABAMoAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQDLAAAAAAAA
AAEAAAAAAAABCAAAEAIAAAAQAAEAzAAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAABAM0AAAAAAAAA
AQAAAAAAAAEIAAAQCAAAABAAAQDOAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAzwAAAAAAAAAB
AAAAAAAAAQgAABABAAAAEAABANAAAAAAAAAAAQAAAAAAAAEIAAAQAgAAABAAAQDRAAAAAAAAAAEA
AAAAAAABCAAAEAEAAAAQAAEA0gAAAAAAAAAEAAAAAAAAAQgAABAAAAEAcAAIfwgAABAAAAAAaQAI
fwgAABABAAAAmQAIfwgAABACAAAAEAABANMAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQDUAAAA
AAAAAAcAAAAAAAABCAAAEAAAAgADAAh/CAAAEQAAAQABAAh/CAAAEQAQAAAAAAh/CAAAEQIAAAAE
AAh/CAAAEQEAAAAFAAh/CAAAEQQAAAACAAh/CAAAEQgAAAAQAAEA1QAAAAAAAAABAAAAAAAAAQgA
ABAIAAAAEAABANYAAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAAAQDXAAAAAAAAAAEAAAAAAAABCAAA
EEAAAAAQAAEA2AAAAAAAAAABAAAAAAAAAQgAABBAAAAAEAABANkAAAAAAAAAAQAAAAAAAAEIAAAQ
QAAAABAAAQDaAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEA2wAAAAAAAAABAAAAAAAAAQgAABAB
AAAAEAABANwAAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAAAQDdAAAAAAAAAAEAAAAAAAABCAAAEAEA
AAAQAAEA3gAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAN8AAAAAAAAAAQAAAAAAAAEIAAAQAQAA
ABAAAQDgAAAAAAAAAAEAAAAAAAABCAAAEAgAAAAQAAEA4QAAAAAAAAABAAAAAAAAAQgAABBAAAAA
EAABAOIAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQDjAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQ
AAEA5AAAAAAAAAABAAAAAAAAAQgAABACAAAAEAABAOUAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAA
AQDmAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEA5wAAAAAAAAABAAAAAAAAAQgAABABAAAAEAAB
AOgAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQDpAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEA
6gAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAOsAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQDs
AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEA7QAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAO4A
AAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQDvAAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEA8AAA
AAAAAAABAAAAAAAAAQgAABAIAAAAEAABAPEAAAAAAAAABgAAAAAAAAEIAAAQAAACAG4ACH8IAAAQ
AAAAAGEACH8IAAAQAQAAADwACH8IAAAQAgAAALsACH8IAAAQBAAAAEgACH8IAAAQCAAAABAAAQDy
AAAAAAAAAAUAAAAAAAABCAAAEAAAAgBvAAh/CAAAEAAAAAA/AAh/CAAAEAEAAABsAAh/CAAAEAIA
AABWAAh/CAAAEAQAAAAQAAEA8wAAAAAAAAABAAAAAAAAAQgAABAIAAAAEAABAPQAAAAAAAAAAQAA
AAAAAAEIAAAQCAAAABAAAQD1AAAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEA9gAAAAAAAAABAAAA
AAAAAQgAABAIAAAAEAABAPcAAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQD4AAAAAAAAAAEAAAAA
AAABCAAAEAEAAAAQAAEA+QAAAAAAAAABAAAAAAAAAQgAABAIAAAAEAABAPoAAAAAAAAAAQAAAAAA
AAEIAAAQAQAAABAAAQD7AAAAAAAAAAEAAAAAAAABCAAAEAgAAAAQAAEA/AAAAAAAAAABAAAAAAAA
AQgAABABAAAAEAABAP0AAAAAAAAAAQAAAAAAAAEIAAAQAQAAABAAAQD+AAAAAAAAAAEAAAAAAAAB
CAAAEAIAAAAQAAEA/wAAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAAABAAAAAAAAAQAAAAAAAAEI
AAAQEAAAABAAAQABAQAAAAAAAAEAAAAAAAABCAAAEAEAAAAQAAEAAgEAAAAAAAABAAAAAAAAAQgA
ABABAAAAEAABAAMBAAAAAAAAAQAAAAAAAAEIAAAQQAAAABAAAQAEAQAAAAAAAAEAAAAAAAABCAAA
EEAAAAAQAAEABQEAAAAAAAABAAAAAAAAAQgAABABAAAAEAABAAYBAAAAAAAAAQAAAAAAAAEIAAAQ
AQAAABAAAQAHAQAAAAAAAAEAAAAAAAABCAAAEAkAAAAQAAEACAE